Academic Press is an imprint of Elsevier 525 B Street, Suite 1900, San Diego, CA 92101-4495, USA 30 Corporate Drive, Suite 400, Burlington, MA 01803, USA 32 Jamestown Road, London, NW1 7BY, UK Radarweg 29, PO Box 211, 1000 AE Amsterdam, The Netherlands First edition 2009 Copyright # 2009 Elsevier Inc. All rights reserved No part of this publication may be reproduced, stored in a retrieval system or transmitted in any form or by any means electronic, mechanical, photocopying, recording or otherwise without the prior written permission of the publisher Permissions may be sought directly from Elsevier’s Science & Technology Rights Department in Oxford, UK: phone (+44) (0) 1865 843830; fax (+44) (0) 1865 853333; email:
[email protected]. Alternatively you can submit your request online by visiting the Elsevier web site at http://elsevier.com/locate/permissions, and selecting Obtaining permission to use Elsevier material Notice No responsibility is assumed by the publisher for any injury and/or damage to persons or property as a matter of products liability, negligence or otherwise, or from any use or operation of any methods, products, instructions or ideas contained in the material herein. Because of rapid advances in the medical sciences, in particular, independent verification of diagnoses and drug dosages should be made ISBN: 978-0-12-374793-8 ISSN: 0065-2776 For information on all Academic Press publications visit our website at elsevierdirect.com Printed and bound in USA 09 10 11 12 10 9 8 7 6 5 4 3 2 1
CONTRIBUTORS
Numbers in parentheses indicate the pages on which the authors’ contributions begin.
Carine Blanchard Division of Allergy and Immunology, Department of Pediatrics, Cincinnati Children’s Hospital Medical Center, University of Cincinnati College of Medicine, Cincinnati, Ohio 45229-3039 (81) Christopher Garris Genentech, Immunology Discovery Group, South San Francisco, California 94080 (163) Jason A. Hackney Genentech, Immunology Discovery Group, South San Francisco, California 94080 (163) A. Helena Jonsson Medical Scientist Training Program; and Rheumatology Division, Departments of Medicine, Pathology, and Immunology, Washington University School of Medicine, St. Louis, Missouri 63110 (27) Taku Kouro National Institute of Biomedical Innovation, 7-6-8 Asagi Saito IbarakiCity, Osaka 567-0085, Japan (191) Yong-Jun Liu Department of Immunology, Center for Cancer Immunology Research, The University of Texas, M. D. Anderson Cancer Center, Houston, Texas (1) Maria N. Lorenzo Genentech, Immunology Discovery Group, South San Francisco, California 94080 (163) Shahram Misaghi Genentech, Immunology Discovery Group, South San Francisco, California 94080 (163) Yoshinori Nagai Department of Immunobiology and Genetics, Graduate School of Medicine and Pharmaceutical Science for Research, University of Toyama, Toyama 930-0194, Japan (191)
ix
x
Contributors
Marc E. Rothenberg Division of Allergy and Immunology, Department of Pediatrics, Cincinnati Children’s Hospital Medical Center, University of Cincinnati College of Medicine, Cincinnati, Ohio 45229-3039 (81) John T. Schroeder The Department of Medicine, Division of Allergy and Clinical Immunology, The Johns Hopkins Asthma and Allergy Center, Johns Hopkins University, Baltimore, Maryland 21224 (123) Kate Senger Genentech, Immunology Discovery Group, South San Francisco, California 94080 (163) Yonglian Sun Genentech, Immunology Discovery Group, South San Francisco, California 94080 (163) Kiyoshi Takatsu Department of Immunobiology and Genetics, Graduate School of Medicine and Pharmaceutical Science for Research, University of Toyama, Toyama 930-0194, Japan; and Toyama Prefectural Institute for Pharmaceutical Research, Imizu-shi, Toyama 939-0363, Japan (191) Wayne M. Yokoyama Howard Hughes Medical Institute; and Rheumatology Division, Departments of Medicine, Pathology, and Immunology, Washington University School of Medicine, St. Louis, Missouri 63110 (27) Ali A. Zarrin Genentech, Immunology Discovery Group, South San Francisco, California 94080 (163)
CHAPTER
1 TSLP in Epithelial Cell and Dendritic Cell Cross Talk Yong-Jun Liu
Contents
Abstract
1. Introduction 2. Thymic Stromal Lymphopoietin (TSLP) and TSLP Receptor (TSLPR) 3. TSLP in Lymphocyte Development in Mice 4. TSLP Activates Human Myeloid Dendritic Cells 5. TSLP in Allergic Inflammation 5.1. TSLP induces innate allergic immune responses by targeting mDCs, mast cells, and NK T cells 5.2. TSLP triggers adaptive allergic immune responses via mDCs 5.3. TSLP association with human atopic dermatitis and asthma 5.4. TSLP in allergic inflammation in vivo 5.5. Does TSLP directly activate CD4þ T cells and induce Th2 differentiation? 5.6. Regulation of TSLP expression in allergic inflammation 6. TSLP in Peripheral CD4þ T Cell Homeostasis 7. TSLP in the Development of Regulatory T Cells in Thymus 8. Summary and Future Perspectives Acknowledgments References
2 2 3 4 5 5 6 8 9 10 11 12 14 17 19 20
Dendritic cells (DCs) are professional antigen-presenting cells that have the ability to sense infection and tissue stress, sample and
Department of Immunology, Center for Cancer Immunology Research, The University of Texas, M. D. Anderson Cancer Center, Houston, Texas Advances in Immunology, Volume 101 ISSN 0065-2776, DOI: 10.1016/S0065-2776(08)01001-8
#
2009 Elsevier Inc. All rights reserved.
1
2
Yong-Jun Liu
present antigen to T lymphocytes, and instruct the initiation of different forms of immunity and tolerance. The functional versatility of DCs depends on their remarkable ability to translate collectively the information from the invading microbes, as well as their resident tissue microenvironments. Recent progress in understanding Toll-like receptor (TLR) biology has illuminated the mechanisms by which DCs link innate and adaptive antimicrobial immune responses. However, how tissue microenvironments shape the function of DCs has remained elusive. Recent studies of TSLP (thymic stromal lymphopoietin), an epithelial cell-derived cytokine that strongly activates DCs, provide strong evidence at a molecular level that epithelial cells/tissue microenvironments directly communicate with DCs, the professional antigen-presenting cells of the immune system. We review recent progress on how TSLP expressed within thymus and peripheral lymphoid and nonlymphoid tissues regulates DC-mediated central tolerance, peripheral T cell homeostasis, and inflammatory Th2 responses.
1. INTRODUCTION Epithelium is a tissue composed of layers of epithelial cells that line the cavities and surfaces of structures throughout the body, including the skin, lungs, the gastrointestinal tract, the reproductive and urinary tracts, and the exocrine and endocrine glands. Functions of epithelial cells include secretion, absorption, protection, transcellular transport, sensation detection, and selective permeability. Most immunologists rarely think about epithelial cells, with the exception of thymologists (immunologists working on thymus gland). The role of epithelial cells in the cortical region and medulla region of the thymic gland in T cell development have been one of the central focus of immunology for the past several decades (Anderson et al., 2007). Epithelial cells in the skin, gut, and lung have long been suspected to play a key role in shaping the local and systemic immune responses (Holgate, 2007; Kato and Schleimer, 2007; Stingl, 1991; Xu et al., 2007). However, how epithelial cells regulate immune homeostasis at the steady state and during immune response to infection and in disease states in the periphery have been relatively unclear. In this article, we will review the current progress on the biology of TSLP in the communication between epithelial cells and dendritic cells (DCs) in the development of the immune system, the maintenance of the immune homeostasis and the regulation of the immune responses.
2. THYMIC STROMAL LYMPHOPOIETIN (TSLP) AND TSLP RECEPTOR (TSLPR) TSLP was first identified as an activity in conditioned medium supernatants from the mouse thymic stromal cell line, Z210R.1 that supported the long-term growth of a pre-B cell line and enhanced the proliferation of
TSLP in Epithelial Cell and Dendritic Cell Cross Talk
3
unfractionated thymocytes to suboptimal concentrations of anti-CD3 antibodies in vitro (Friend et al., 1994). Subsequent expression cloning revealed that the mouse TSLP (mTSLP) is a member of the hematopoietic cytokine family (Sims et al., 2000). A cDNA clone encoding human TSLP (hTSLP) was isolated using database search methods (Quentmeier et al., 2001; Reche et al., 2001). Sequence prediction revealed a similar four-helix structured cytokine with two N-glycosylation sites and six cysteine residues. hTSLP and mTSLP exhibit poor homology with only 43% amino acid identity. TSLP is expressed mainly in the lung, skin, and gut (Reche et al., 2001). TSLP receptor (TSLPR) is a heterodimeric receptor complex that consists of TSLPR and the IL-7a. The TSLPR chain is a member of the hematopoietin receptor family and binds to TSLP at low affinity. A combination of TSLPR and IL-7a chain results not only in high-affinity binding but also in SATT3 and STAT5 activation (Pandey et al., 2000; Park et al., 2000; Reche et al., 2001; Fig. 1.1). hTSLP and mTSLPR share only 39% amino acid identity.
3. TSLP IN LYMPHOCYTE DEVELOPMENT IN MICE Although mTSLP was identified and cloned based on a biological activity from a thymic epithelial cell line in supporting the growth of early B and T progenitors (Friend et al., 1994; Levin et al., 1999; Ray et al., 1996; Sims et al., 2000), Tslpr/ mice display apparently normal T and B cell development (Al-Shami et al., 2004). Therefore, mTSLP has been regarded as ‘‘an uninteresting weak brother of IL-7.’’ However, subsequent studies demonstrated that the target cells of TSLP and IL-7 are different. In bone marrow, IL-7 acts mainly on early lymphoid progenitors and prepro-B progenitors, TSLP acts on relatively late stage B cell progenitors, specifically at large pre-B stage that already expresses the pre-B cell receptor. Interestingly, fetal liver pro-B cells but not bone marrowderived pro-B cells respond to TSLP (Vosshenrich et al., 2003, 2004). TSLP displays an activity in supporting the growth of mouse CD4CD8 thymocytes in the presence of IL-1b in culture (Sims et al., 2000). Administration of TSLP into gc-deficient mice led to a 5–10-fold increase in the thymus cell numbers with an early increase in the DP cells at one week, followed by an increase in the CD4þ SP cells (Al-Shami et al., 2004). More recent studies suggest that TSLP directly stimulate the thymic CD4þ CD8CD25thymocytes to differentiate into Foxp3þ Treg cells (Lee et al., 2008; Mazzucchelli et al., 2008).
4
Yong-Jun Liu
TSLP TSLPR
IL-7Ra
Y
Y Y Y Y
P-Stat 5 unidentified molecules
• B cell development • T cell development
Dendritic cell mast cell T cell activation
FIGURE 1.1 TSLP and TSLPR structure and function. The TSLPR complex contains a heterodimer of TSLPR and IL-7Ra. TSLP stimulation induces activation and phosphorylation of STAT5 (P-STAT5), as well as activation of other as yet unidentified pathways. TSLP was discovered by its biological activity to promote B and T cell development. In the periphery, TSLP directly strongly activates DCs by upregulating MHC class I and II molecules and costimulatory molecules, promotes cell survival, and induces secretion of chemokines, which mediate different functions in central tolerance, T cell homeostasis and Th2 differentiation. In addition, TSLP may act directly on mast cells, NK cells, and CD4þ T cells.
4. TSLP ACTIVATES HUMAN MYELOID DENDRITIC CELLS Following the identification of hTSLP and TSLPR, hTSLP was found to dramatically and uniquely activate human CD11cþ myeloid DCs (mDC). The initial observation that human monocytes express TSLPR and respond to hTSLP by producing chemokines TARC was found to be contributed by the contaminating mDCs in the monocyte preparations (Reche et al., 2001; Soumelis et al., 2002). The ability of mDCs to respond to TSLP is consistent with the finding that mDC express the highest levels of TSLPR at the both mRNA (Soumelis et al., 2002) and protein levels among all human hematopoietic cell types (Liu Y.-J., unpublished observations). Because DCs represent the professional antigen-presenting cells, the central research focus on TSLP was then shifted from its role in regulating early lymphocyte development in the central lymphoid organs to its function in regulating DC-mediated immune responses in the peripheral lymphoid organs.
TSLP in Epithelial Cell and Dendritic Cell Cross Talk
5
5. TSLP IN ALLERGIC INFLAMMATION 5.1. TSLP induces innate allergic immune responses by targeting mDCs, mast cells, and NK T cells Like all stimuli that activate mDCs, including CD40L and Toll-like receptor (TLR) ligands, such as bacterial LPS, poly I:C, and R848, TSLP strongly upregulates the expression of MHC class II, CD54, CD80, CD83, CD86, and DC-lamp on human mDCs. However, unlike CD40L and TLR ligands, TSLP does not stimulate mDCs to produce the Th1-polarizing cytokine IL-12 and type 1 interferones or the proinflammatory cytokines TNF, IL-1b, and IL-6 (Table 1.1; Soumelis et al., 2002). Interestingly, TSLP treatment causes mDCs to produce large amounts of the chemokines IL-8 and eotaxin-2, which attract neutrophils and eosinophils, followed by production of TARC (CCL17) and MDC (CCL22), which attract Th2 cells (Table 1.1). A more recent study showed that hTSLP potently activates human mast cells to produce IL-5, IL-6, IL-13 and GM-CSF, and IL8 and I-309, in the presence of IL-1b and TNF (Allakhverdi et al., 2007). Another study showed that TSLP may potentially activate NKT cells to produce IL-13 in a mouse asthma model (Nagata et al., 2007). These studies suggest that TSLP produced by epithelial cells may rapidly induce an innate phase of allergic inflammatory response by activating mDCs, mast cells, and NK cells to produce TH2 cytokines, chemokines, and proinflamatory cytokines. The role of TSLP in the triggering of an early innate phase of allergic inflammation is supported by an in vivo observation that TSLP can induce moderate airway inflammation in B and T cell deficient RAG/ mice (Zhou et al., 2005). TSLP induced innate phase of TABLE 1.1
TSLP induced DC maturation is uncoupled with IL-12 production
CD80/CD86 MHC II Survival IL-1a/b IL-6 IL-12 IFNs IP10 Eotaxin 2 IL-8 TARC (TH2) MDC (TH2)
TSLP-DC
CD40L-DC
TLRL-DC
Up Up Up þþ þþ þþ þþ
up up up þþ þþ þþ þþ þþ þþ þ
up up up þþ þþ þþ þþ þþ þþ þ þ
6
Yong-Jun Liu
allergic immune response has three important consequences: (1) it induces a transient inflammatory response via IL-6, IL-13, and GM-CSG; (2) it recruits eosinophils via IL-5 and eotaxin-2, as well as neutrophils via IL-8; (3) it prepares for the local adaptive Th2 responses by producing TARC and MDCs which will attract Th2 cells generated subsequently by TSLP-activated mDCs (TSLP-DC) during the adaptive phase of allergic immune responses; and (4) it educates a unique population of mDCs that acquire the ability to induce naı¨ve CD4þ T cells to differentiate into inflammatory Th2 cells.
5.2. TSLP triggers adaptive allergic immune responses via mDCs 5.2.1. TSLP-DC induce inflammatory Th2
When TSLP-DCs are used to stimulate naive allogeneic CD4þ T cells in vitro, they induce a unique type of Th2 cell that produces the classical Th2 cytokines IL-4, IL-5, and IL-13 and large amounts of TNF, but little or no IL-10 (Soumelis et al., 2002). Although not typically considered a Th2 cytokine, TNF is prominent in asthmatic airways, and genotypes that correlate with increased TNF secretion are associated with an increased risk of asthma (Moffatt and Cookson, 1997), suggesting that TNF plays an important role in the development of asthma and allergic inflammation. In addition to inducing the production of Th2 cytokines and TNF, CD4þ T cells activated by TSLP-DCs produce decreased levels of IL-10 and IFN-g, two cytokines known to downregulate Th2 inflammation (O’Garra, 1998). IL-10, although initially classified as a Th2 cytokine, counteracts inflammation, and is produced at decreased levels in bronchoalveolar lavage fluid from atopic patients compared with normal subjects (Borish et al., 1996). In addition, recent studies show that DC- or T cell–derived IL-10 prevents airway hypersensitivity after allergen exposure (Akbari et al., 2001; Oh et al., 2002). Because of their unique profile of cytokine production, we propose that Th2 cells induced by TSLP-activated DCs be called inflammatory Th2 cells, in contrast to the conventional Th2 cells (Fig. 1.2). Conventional Th2
Inflammatory Th2
IL-4 IL-5 IL-13 IL-10
IL-4 IL-5 IL-13 TNF-a
FIGURE 1.2 Two types of Th2 cells defined by their IL-10 and TNF-a production. Conventional Th2 cells produce IL-4, IL-5, IL-13, and IL-10. Inflammatory Th2 cells produce IL-4, IL-5, IL-13, and TNF-a.
TSLP in Epithelial Cell and Dendritic Cell Cross Talk
7
The pathogenic T cells involved in allergic diseases such as atopic dermatitis and asthma are likely to be inflammatory Th2 cells. Conventional Th2 cells that produce IL-4, IL-5, IL-13, and IL-10, but little TNF, may not be involved in promoting allergic diseases but are induced in many circumstances, including when APCs or T cells are treated with immunosuppressive drugs and when T cells are triggered by low-affinity TCR ligands (Boonstra et al., 2001; Constant and Bottomly, 1997; de Jong et al., 1999).
5.2.2. TSLP-DC express a Th2 polarizing molecule OX40L In an attempt to identify the molecular mechanism by which TSLP-DCs induce naive CD4þ T cells to differentiate into TNF-producing inflammatory Th2 cells, our group performed gene expression analysis on immature human mDCs that were either resting or were activated by TSLP, poly I:C, or CD40L. This analysis showed that only TSLP induces human mDCs to express the TNF superfamily protein OX40L at both the mRNA and protein levels (Ito et al., 2005). The expression of OX40L by TSLP-DCs was important for the induction of inflammatory Th2 cells, as blocking OX40L with a neutralizing antibody inhibited the production of Th2 cytokines and TNF and enhanced the production of IL-10 by the CD4þ T cells. Consistent with these results, we found that treating naive T cells with recombinant OX40L promoted the production of TNF but inhibited the production of IL-10. In other words, signals triggered by OX40L induced the generation of inflammatory Th2 cells. A recent study demonstrates that OX40 signaling directly induces Th2 lineage commitment by inducing NFATc1, which triggers IL-4 production and then IL-4dependent GATA-3 transcription (So et al., 2006). In addition, blocking OX40L was shown to inhibit TSLP-induced asthma in a mouse model in vivo (Seshasayee et al., 2007).
5.2.3. TSLP-DC provide a permissive condition for Th2 development One of the key features of TSLP-DC is their expression of all the major costimulatory molecules and OX40L that is uncoupled with IL-12 production. In the presence of exogenous IL-12, TSLP-DC or recombinant OX40L loses the ability to induce Th2 differentiation. We thus conclude that TSLP-activated DCs create a Th2-permissive microenvironment by upregulating OX40L without inducing the production of Th1-polarizing cytokines. The dominance of IL-12 over OX40L may provide a molecular explanation for the hygiene theory, which proposes that microbial infections that trigger Th1 responses may decrease the subsequent development of Th2-driven atopy. Historically, two models have been proposed to explain how Th2 development is initiated: (1) Th2 differentiation requires a positive Th2-polarizing signal, or (2) Th2 development is initiated by a default mechanism in the absence of IL-12 (Eisenbarth et al., 2003; Kapsenberg, 2003; Moser and Murphy, 2000; Sher et al., 2003;
8
Yong-Jun Liu
i. Instruction model
TH1
ii. Default model
TH1
iii. A unified model
TH1
A (IL-12)
A (IL-12)
A (IL-12)
TH
TH
B
No A
TH2
TH2
B (OX40L) TH
TH2 No A (IL-12)
FIGURE 1.3 Three models for the regulation of Th1 and Th2 differentiation. (A) Instruction model: Th1 differentiation requires a Th1-polarizing signal, and Th2 differentiation requires a Th2-polarizing signal. (B) Default model: Th1 differentiation requires a Th1-polarizing signal, and Th2 differentiation occurs spontaneously in the absence of the Th1-polarizing signal. (C) A unified model: Th1 differentiation requires a Th1-polarizing signal, and Th2 differentiation requires a Th2-polarizing signal. However, the Th1-polarizing signal is dominant over the Th2-polarizing signals. The Th2 signal can induce a Th2 response only in the absence of a Th1-polarizing signal.
Fig. 1.3). Our findings suggest that the two previously proposed models are not mutually exclusive and that Th2 differentiation requires a positive polarizing signal, such as OX40L as well as a default mechanism (the absence of IL-12).
5.3. TSLP association with human atopic dermatitis and asthma Early studies showed that TSLP mRNA is highly expressed by human primary skin keratinocytes, bronchial epithelial cells, smooth muscle cells, and lung fibroblasts but not by most hematopoietic cells, including B cells, T cells, NK cells, granulocytes, macrophages, monocytes, or DCs (Soumelis et al., 2002). Interestingly, mast cells activated by IgE receptor cross-linking expressed high levels of TSLP, suggesting an additional cell type that may help trigger allergic inflammation. TSLP protein, examined by immunohistology on cryopreserved tissue sections, is undetectable in normal skin or nonlesional skin in patients with atopic dermatitis but is highly expressed in acute and chronic atopic dermatitis lesions (Soumelis et al., 2002). TSLP is expressed mainly in keratinocytes of the apical layers of the epidermis, suggesting that TSLP production is a feature of fully differentiated keratinocytes (Fig. 1.4). TSLP is not found in skin lesions from patients with nickel-induced contact dermatitis or disseminated lupus erythematosus (Soumelis et al., 2002). Interestingly, TSLP
TSLP in Epithelial Cell and Dendritic Cell Cross Talk
A
C
TSLP + Langerine
B
9
TSLP + DC-lamp
D
FIGURE 1.4 TSLP expression in atopic dermatitis associates with Langerhans cell migration and activation. (A) Normal skin Langerinþ Langerhans cells in epidermis (blue staining) but does not express TSLP (thus no red staining). (B) Normal skin does not contain DC-lampþ-activated DCs in epidermis and dermis nor does it express TSLP (thus no blue or red staining). (C) In skin lesion of atopic dermatitis, high expression of TSLP (red staining) is associated with the migration of Langerhans cells from epidermis to dermis. (D) The expression of TSLP (red staining) in skin lesion of atopic dermatitis is associated with the appearance of many DC-lampþ activated DCs in dermis (blue staining).
expression in patients with atopic dermatitis is associated with Langerhans cell migration and activation in situ (Fig. 1.4), suggesting that TSLP may contribute directly to the activation of these cells, which could then migrate into the draining lymph nodes and prime allergen-specific Th2 responses (Soumelis et al., 2002). A more recent study showed by in situ hybridization that TSLP expression is increased in asthmatic airways and correlates with both the expression of Th2-attracting chemokines and with disease severity (Ying et al., 2005), providing the first link between TSLP and human asthma.
5.4. TSLP in allergic inflammation in vivo In 2005, 3 years after the initial report on the function of TSLP in DCinduced Th2 responses in culture and association of TSLP in situ with alergic diseases in humans, three groups provided the genetic in vivo data
10
Yong-Jun Liu
showing that TSLP is critical for the development of allergic inflammation in mouse models. While Ziegler’s group demonstrated that tissue specific over expression of TSLP in lung and skin induces asthma and atopic dermatitis, respectively (Yoo et al., 2005; Zhou et al., 2005), Leonard’s group showed that TSLPR knock out mice fail to develop airway inflammatory disease in an asthma model (Al-Shami et al., 2005). Chambon’s group reported that retinoid X receptor ablation in adult skin keratinocytes triggers TSLP production and atopic dermatitis in mice. Over expression of TSLP in skin keratinocytes induces atopic dermatitis (Li et al., 2005). A recent study further showed that administration of TSLP protein directly into mouse airway causes asthmatic inflammation, which could be blocked by administration of neutralizing antibody to OX40L (Seshasayee et al., 2007). This study also showed that in a rhesus monkey dust-mite-induced asthma model, there are elevated expressions of both TSLP and OX40L in the lung. Treatment with antihuman OX40L monoclonal antibody reduces the numbers of infiltrating cells and levels of Th2 cytokine IL-5 and IL-13 in the lung (Seshasayee et al., 2007). A more recent study suggests that TSLP may also play a key role in the development of a protective Th2-immunity in the gut, which is critical for controlling parasite infection, as well as maintaining mucosal immune homeostasis by limiting Th1 or Th17 immune responses (Zaph et al., 2007). During parasite trichuris infection, intestinal epithelial cells deficient in IKK-b expression fail to produce TSLP, leading to impaired protective Th2 responses and uncontrolled Th1 and Th17 inflammatory responses (Zaph et al., 2007).
5.5. Does TSLP directly activate CD4þ T cells and induce Th2 differentiation? Although it is more established in both human and mice that TSLP can activate CD4þ T cells and induce Th2 differentiation via mDCs, whether TSLP can directly induce CD4þ T cell proliferation and Th2 differentiation and the relative contribution of the direct effect versus indirect effect of TSLP on CD4þ T cells are still unclear. Several studies in mice suggest that TSLP may indeed have direct effects on CD4þ T cells. The finding that CD4þ T cells from TSLPR Ko mice expanded less efficiently than WT CD4þ T cell in irradiated hosts suggest that TSLP does play a role directly in the CD4þ T cell homeostasis (Al-Shami et al., 2004). However, it is unclear whether TSLP plays a role in maintaining CD4þ T cell survival or in promoting CD4þ T cell proliferation, or both. In vitro culture of naı¨ve CD4þ T cells with anti-CD3 and anti-IFN-g showed that addition of TSLP could prime cultured CD4þ T cells to produce IL-4, IL-5, and IL-13 (Omori and Ziegler, 2007). However, TSLP does not induce Stat6 phosphrylation in the cultured CD4þ T cells, suggesting that the ability of TSLP to induce IL-4 production by cutlured
TSLP in Epithelial Cell and Dendritic Cell Cross Talk
11
CD4þ T cells was Stat6-independent. Paradoxically, TSLP fails to induce the generation of IL-4 producing cells from the Stat6/ CD4þ T cells, suggesting the TSLP-mediated Stat6-independent mechanisms is not enough for TH2 differentiation (Omori and Ziegler, 2007). In a murine model of Th2 immune responses induced by injection of a protease allergen papain in the footpads, basophils were found to be directly activated and recruited to the draining lymph nodes. Activated basophils produced both IL-4 and TSLP. In vivo neutralization of TSLP by monoclonal antibody leads to considerable inhibition of Th2 differentiation without affecting DC maturation and migration, thus suggesting that TSLP released by basophils play a critical role in direct Th2 differentiation. This study further shows that in vitro cutlure of naı¨ve CD4þ T cells with antiCD3, TSLP was found to induce cultured T cells to produce Th2 cytokines and expression of GATA-3 (Sokol et al., 2007). A recent study in humans showed that human naı¨ve CD4þ T cells express low levels of TSLPR after 3 days of activation by anti-CD3 and anti-CD28. TSLP activates Stat5 and promotes the proliferation of activated CD4þ T cells (Rochman et al., 2007). Although the above studies all suggest that TSLP can directly induce CD4þ T cell proliferation or Th2 differentiation, the fact is that the levels of TSLPR expression on activated CD4þ T cells is extremely low when compared with that expressed by mDCs in the human system. Because both human and mouse mDCs can express CD4, and TSLP activated mDCs could induce potent naı¨ve CD4þ T cell proliferation at even 1:150 DC/T cell ratio, the possible contribution of the few mDCs in the culture should be carefully examined in both human and mouse system.
5.6. Regulation of TSLP expression in allergic inflammation Experimental evidence in both human and mice suggest that TSLP derived from epithelial cells represent an early trigger of allergic inflammation. Fibroblasts, smooth muscle cells, basophils, and mast cells have also been implicated in having the ability to proudce TSLP (Soumelis et al., 2002). However, how TSLP expression in epithelial cells and other cells is triggered upon allergen exposure remains elusive. Using mouse genetic approach, Chambon’s group demonstrated that retinoid X receptor/retinoid acid receptor complex and retinoid X receptor/vitamin D receptor complex negatively regulate the expression of TSLP in skin keratinocytes at the steady state. Deletion of retinoid X receptor (a/b) or blocking their transcription repression function by vitamin D3 or its analog led to uncontrolled expression of TSLP in skin kerotinocytes and atopic dermatitis (Li et al., 2006; Yoo et al., 2005). Ziegler’s group found that TSLP promoter in humans and mice contain a NF-kB site. TNF and IL-1b were shown to stimulate human epithelial cell lines to produce TSLP in a NF-kB-dependent fashion (Lee and Ziegler, 2007).
12
Yong-Jun Liu
The importance of NF-kB activation in TSLP production was further demonstrated in vivo by a experiment showing that mice with a specific deletion of IKK-b in intestinal epithelial cells have reduced expression of TSLP at the steady state or upon parasite infection (Zaph et al., 2007). Other studies further showed that in addition to TNF and IL-1b, Th2 cytokines IL-4 and IL-13 and TLR3-ligand Poly I:C could also stimulate human epithelial cells to produce TSLP (Bogiatzi et al., 2007; Kato and Schleimer, 2007). A recent study demonstrates that basophils produce TSLP in the allergen papin induced Th2 immune responses model (Sokol et al., 2007). Another study showed that TSLP production by nasal epithelial cells depends on mast cells in a mouse allergic rhinitis model (Miyata et al., 2008). The link between allergen exposure and induction of TSLP is still missing. The identification of the putative innate receptors that potentially sense allergen and the link between these receptors to retinoid X receptor signaling and NF-kB activation may help to reveal the missing link.
6. TSLP IN PERIPHERAL CD4þ T CELL HOMEOSTASIS Over two decades ago, Nussenzweig and colleagues (Nussenzweig et al., 1980) observed that mouse splenic DCs could induce the proliferation of autologous T cells in culture in the absence of exogenous antigens, a phenomenon referred to as a syngeneic mixed lymphocyte reaction. Investigators concluded from this study that DCs may present selfpMHC complexes to autologous T cells. A more recent study illustrated that exposure to self-pMHC on the surface of autologous DCs induces phosphorylation of TCR3 and ZAP-70 in CD4þ T cells (Kondo et al., 2001). Using a mouse model in which only peripheral DCs expressed MHC class II, Brocker (1997) further demonstrated that the homeostatic survival and proliferation of naive CD4þ T cells depended on their interaction with peripheral DCs. Proliferation of naive CD8þ T cells adoptively transferred into lymphopenic hosts was enhanced by cotransfer of syngeneic DCs (Ge et al., 2002). Similarly, syngeneic DCs, but not B cells or macrophages, induced homeostatic proliferation of naive CD8þ T cells in vitro (Ge et al., 2002). Collectively, these studies suggest that DCs play a critical role in the maintenance of T cell homeostasis under normal physiological conditions. However, we do not know if the ability of DCs to induce homeostatic T cell proliferation can be regulated or, if so, how. By immunohistology, we found that TSLP is expressed by crypt epithelial cells of human tonsils and TSLP expression is closely associated with DC-lampþ-activated DCs under normal physiological conditions (Watanabe et al., 2004; Fig. 1.5). Because TSLP-activated DCs have the capacity to induce very strong expansion of naive CD4þ T cells, we
TSLP in Epithelial Cell and Dendritic Cell Cross Talk
13
FIGURE 1.5 Expression of TSLP in human tonsillar epithelial cells and its association with DC-lampþ activated DCs. (A, B) Double staining of TSLP (red staining) and DC-lamp (blue, an activated DC marker) shows expression of TSLP by crypt epithelial cells (red), which are in close association with DC-lampþ lymphocytes and DCs (blue; A, 100; B, 200). (C, D) Double staining of TSLP (red) and Langerin (blue, a Langerhans cell marker) shows TSLP expression (red) by crypt epithelial cells, but not by squamous epithelial cells characterized by the presence of Langerin-positive Langerhans cells (blue staining). Langerin-positive Langerhans cells within epidermis do not express DC-lamp (C, 100; D, 200).
hypothesized that hTSLP expressed by the epithelial cells of peripheral mucosa lymphoid tissues may play a critical role in DC-mediated homeostatic proliferation of naive and memory T cells. Indeed, we found that only TSLP-activated mDCs, but not resting or mDCs activated by IL-7, CD40L, lipopolysaccharide (LPS), or poly I:C, could induce a robust and sustained expansion of autologous naive CD4þ T cells without any exogenous antigens, cytokines, or fetal bovine serum (Watanabe et al., 2004). This unique ability of TSLP-activated DCs correlates with their strong capacity to form prolonged conjugate with the autologous naive CD4þ T cells and thus provides sustained proliferation and survival signals (Watanabe et al., 2004). The expansion of the autologous naive CD4þ T cells induced by TSLP-activated mDCs displays features of homeostatic expansion mediated by self-pMHC complexes: (1) It is dependent on MHC class II and costimulatory molecules CD80/CD86, but not on IL-7
14
Yong-Jun Liu
or IL-15; (2) it is a polyclonal expansion, as indicated by the TCRVb repertoire analyses and CFSE-labeling experiments; and (3) the expanded cells display central memory T cell phenotype (CD45R0þCCR7þ CD27þCD62Lþ) and have the potential to further expand and differentiate into either Th1 or Th2 effector cells (Watanabe et al., 2004). A recent study suggests that a low level of TSLP constitutively produced by the mucosal epithelium is critical to condition mucosal DCs to have a noninflammatory phenotype and maintain mucosal homeostasis (Rimoldi et al., 2005). In support of this model, decreased TSLP production was found to associate with Crohn’s disease (Rimoldi et al., 2005). Experiments in TSLPR-deficient mice suggest a similar role for TSLP in the maintenance of peripheral CD4þ T cell homeostasis in vivo (Al-Shami et al., 2004). Current data suggest that TSLP may promote CD4þ T cell homeostasis through both direct effect on CD4þ T cells and indirect effect via DCs.
7. TSLP IN THE DEVELOPMENT OF REGULATORY T CELLS IN THYMUS TSLP was originally cloned from mouse thymic epithelial cells, however, neither the type of epithelial cell expressing TSLP nor their function in thymus is known. The first clue for the possible function of TSLP in human thymus came from the observation that hTSLP was found that TSLP is selectively expressed by epithelial cells of the Hassall’s corpuscles (HCs) within the human thymic medulla (Watanabe et al., 2005; Fig. 1.6). The major function of TSLP in human thymus appears to activate a subpopulation of DCs in the thymic medulla. Indeed, we found that TSLP strongly activates mDCs isolated from human thymus, and TSLP expression by HCs is associated with an activated mDC subpopulation in the thymic medulla (Watanabe et al., 2005; Fig. 1.6). Because thymus is not a peripheral lymphoid organ that is normally exposed to microbial infection or immune responses, this raised a question regarding the functions of TSLP or TSLP-activated DCs in the thymus. Our hypothesis that TSLPactivated mDCs may play a critical role in the secondary positive selection of medium- to high-affinity self-reactive thymocytes to differentiate into Tregs (Watanabe et al., 2005) is based on the following considerations: 1. CD28 signaling is critical for Treg development in thymus (Salomon et al., 2000), and TSLP may represent the only physiological signal to activate thymic DCs to express CD80 and CD86, the ligands for CD28, in the medulla of human thymus (Watanabe et al., 2005);
TSLP in Epithelial Cell and Dendritic Cell Cross Talk
15
A Hassal’s corpuscle
DC-lamp+ DC
Medulla
Cortex
Cortical-Medulla junction
B DC-lamp/CD11c
Medulla
Cortex
FIGURE 1.6 TSLP expression in human thymus. (A) TSLP expression by HCs and thymic DC subpopulations. Epithelial cells of HCs that express TSLP (pink) are surrounded by the DC-lampþ-activated DCs (dark blue) in the medulla of human thymus (100). (B) Two subsets of DCs in human thymus. Human thymus contains a subset of CD11cþ DC-lamp immature DCs (blue) and a subset of CD11cþ DC-lampþ activated DCs in the medulla of thymus (red brown; 100).
2. TSLP-activated DCs induce a robust homeostatic proliferation of naive CD4þ T cells owing to their unique ability to form strong and prolonged conjugates with autologous CD4þ T cells (Watanabe et al., 2004); 3. Using the same mechanisms of inducing peripheral T cell homeostatic proliferation, TSLP-activated DCs may provide strong survival signals to the medium- to high-affinity self-reactive T cells and therefore, switch negative selection to a secondary positive selection. This hypothesis is supported by our recent experiments showing that TSLP-activated DCs, but not DCs stimulated with IL-7, CD40-L, or poly
16
Yong-Jun Liu
I:C nor unstimulated DCs (Med-DC), induce a vigorous expansion of CD4þ CD8CD25 thymocytes, and about 50% of the expanded cells differentiate into CD4þ CD8CD25Foxp3þ Tregs (Watanabe et al., 2005). The ability of TSLP-DCs to induce the differentiation of CD4þCD8CD25 thymocytes into Tregs depends on IL-2 and CD28 signaling (Watanabe et al., 2005). By immunohistology, we found that CD4þCD25þ Tregs are exclusively localized within the thymic medulla in close association with DC-LAMPþ/CD86þ-activated DCs and HCs (Watanabe et al., 2005). These data suggest that human CD4þCD25þ Tregs are generated in the thymic medulla, in close association with DCs that appear to be activated by TSLP produced by epithelial cells of the HCs (Watanabe et al., 2005).
CD4+ CD8+
Cortex
CEC Primary positive selection No-affinity CD4+ CD8−
Medulla
HC
CD4+ CD8−
High-affinity TSLP
Low-affinity Im-DC
TSLP-DC Secondary positive selection
CD4+ CD8−
Treg
MEC Negative selection
Death
CD4+ CD8−
Naïve T cells
FIGURE 1.7 A unified model of central tolerance in thymus. Developing T cells undergo the primary positive selection in the cortex by cortical epithelial cells. The positively selected T cells migrate into the medullary areas. The low-affinity self-reactive T cells may escape negative selection by medullary epithelial cells or immature DCs, and are exported to the periphery as naive conventional T cells. Majority of the high-affinity self-reactive T cells will undergo negative selection when binding antigen presented by medullary epithelial cells or immature thymic DCs. A small number of the high-affinity self-reactive T cells will undergo secondary positive selection when binding antigens presented by TSLP-activated thymic DCs.
TSLP in Epithelial Cell and Dendritic Cell Cross Talk
17
On the basis of these findings, we proposed a new model of central tolerance, as illustrated in detail in Fig. 1.7, that has the following features: 1. It explains how thymic DCs can mediate both negative and positive selection. 2. It suggests that the fate of a T cell within the thymus also follows the two-signal model: When the high-affinity self-reactive T cells receive strong TCR signaling without adequate costimulatory signals from either medullary epithelial cells or immature DCs, they die by negative selection. However, when the high-affinity self-reactive T cells receive strong TCR signaling and multiple costimulatory/survival signals from the TSLP-activated DCs, they will be converted into Tregs by a secondary positive selection. 3. It is consistent with the in vivo localization of Tregs within thymic medulla. 4. It explains the biological function of TSLP expressed by the epithelial cells of HCs, and why both activated and nonactivated myeloid DCs are present in the thymic medulla. 5. It overcomes the limited ability of thymic epithelial cells to express all the organ-specific antigens. DCs have the potential to cross-present thymic-derived antigens, as well as to sample all peripheral antigens and then migrate and present these antigens in the thymus. Several studies in mice shows that mTSLP strongly promotes the differentiation and expansion of Foxp3þ Tregs in thymus and periphery (Besin et al., 2008; Jiang et al., 2006; Lee et al., 2008). However, TSLPR-deficient mice do not appear to have abnormal Treg development. The precise role of TSLP in Treg development still remains to be established.
8. SUMMARY AND FUTURE PERSPECTIVES The function of TSLP in both mouse and human is pleiotropic. The major cell type that responds to TSLP is mDC. TSLP represents the only factor that activates mDCs without inducing them to produce Th1-polarizing cytokines. This sterile/aseptic way of activating mDCs, in contrast to the way of activating DCs by different TLR ligands and TNF family members, may explain the uniqueness of TSLP-DC function. Further investigation on how TSLP versus TLR-Ligands signal mDCs will be critical to understand the molecular basis of the functional plasticity of mDCs in directing different types of T cell responses. Under normal physiological conditions, TSLP appears to play a critical role in CD4þ T cell homeostasis in the peripheral mucosa-associated lymphoid tissues (Rimoldi et al., 2005; Watanabe et al., 2004) and in the positive selection and/or expansion of Tregs in the thymus (Watanabe
18
Yong-Jun Liu
et al., 2005). The signals that control the steady state level of TSLP production are unknown, but may involve RXRa and RXRb (Li et al., 2005). In inflammatory conditions, such as atopic dermatitis and asthma, epithelial cells markedly increase TSLP expression in response to inflammation. Although the link between allergen and TSLP production is still missing, TSLP production in epithelial cells can be triggered by virus via TLR3 or by TH2 plus proinflammatory cytokines through NF-kB activation. The increased local TSLP will activate DCs mast cells and NK cells to initiate the innate phase of allergic immune responses (Fig. 1.8). The TSLP-activated DCs migrate to the draining lymph nodes, priming CD4þ T cells via OX40L to differentiate into inflammatory TH2 effector and memory cells and therefore initiate the adaptive phase of allergic
Lymph node OX40L Allergen virus
TSLP
No IL-12 Immature mDC
MC
Mature mDC
NKT
IL-5 IL-8 IL-13 Eotaxin-2 GM-CSF TARC IL-6 MDC Innate allergic immune responses
CD4+ naive T
TH2inf
IL-4 IL-5 IL-13 TNF-a No IL-10 Adaptive allergic immune responses
Tissue inflammation IgE production Eosinophilia Mucus production Fibroblast proliferation
FIGURE 1.8 TSLP initiates innate and adaptive phases of allergic inflammation. Insults from allergens or viruses trigger mucosal epithelial cells or skin cells (keratinocytes, fibroblasts, and mast cells) to produce TSLP. TSLP initiates the innate phase of allergic immune responses by activating immature DCs to produce the chemokines IL-8, eotaxin-2, and TH2 attracting chemokines TARC and MDC and by costimulating mast cells to produce IL-5 and IL-13, as well as GM-CSF and IL-6. TSLP-activated mDCs mature and migrate into the draining lymph nodes to initiate the adaptive phase of allergic immune responses. TSLP-activated DCs express OX40L, which triggers the differentiation of allergen-specific naı¨ve CD4þ T cells to inflammatory TH2 cells that produce IL-4, IL-5, IL-13, and TNF but not IL-10. Inflammatory TH2 cells then migrate back to the site of inflammation, due to the local production of TARC and MDC. The TH2 cytokines IL-4, IL-5, IL-13, and TNF-a, produced by the inflammatory TH2 cells, initiate allergic inflammation by triggering IgE production, eosinophilia, and mucus production.
TSLP in Epithelial Cell and Dendritic Cell Cross Talk
19
immune responses (Fig. 1.8). When considering the pathophysiology and therapeutic targets of allergic diseases, both innate and adaptive phases of allergic immune response should be considered. TSLP instructs mDCs to induce inflammatory Th2 cells in two ways. First, TSLP induces DC maturation without driving the production of the Th1-polarizing cytokine IL-12, thus creating a Th2-permissive microenvironment. Second, TSLP induces the expression of OX40L on DCs, which directly triggers the differentiation of inflammatory Th2 cells. The signaling pathway that is triggered by TSLP and leads to this unique Th2 phenotype is unknown, but it appears to involve STAT5 activation, independent of the classical NF-kB and MyD88 signaling pathways. OX40L signaling has several important features. It triggers Th2 polarization independent of IL-4, promotes TNF production, and inhibits IL-10 production by the developing Th2 cells, but only in the absence of IL-12. In the presence of IL-12, OX40L signaling instead promotes the development of Th1 cells that, like inflammatory Th2 cells, produce TNF but not IL-10. This finding may help explain why blocking OX40/OX40L interaction reduces the severity of Th1-mediated autoimmune diseases (Croft, 2003)—the reason some immunologists are reluctant to accept OX40L as a Th2-polarizing factor. We now believe that this inhibition of Th1-induced pathology is due to the increased production of the immunosuppressive cytokine IL-10 and the decreased production of the inflammationpromoting cytokine TNF-a, which results from blocking OX40–OX40L interactions. On the basis of these recent studies, we propose the subdivision of Th2 cells into inflammatory Th2 cells that produce high levels of TNF but little IL-10, and conventional Th2 cells that produce little TNF but high levels of IL-10. Inflammatory Th2 cells, but not conventional Th2 cells, may be involved in allergic inflammatory diseases. Our initial finding that epithelial cell-derived TSLP triggers DCmediated inflammatory Th2 responses in humans together with the exciting in vivo studies reported in early 2006 suggest that TSLP represents a master switch of allergic inflammation at the epithelial cell–DC interface. TSLP should, therefore, be considered as a target for immunological intervention in the treatment of allergic diseases.
ACKNOWLEDGMENTS I would like to thank Drs. Soumelis V, Watanabe N, Ito T and Wang YH for their contribution to the projects. Dr. Arima K for critically reading the manuscript. The projects have been supported by M. D. Anderson Cancer Center Foundation and NIAID (AI061645 and U19 AI071130).
20
Yong-Jun Liu
REFERENCES Abbas, A. K., Murphy, K. M., and Sher, A. (1996). Functional diversity of helper T lymphocytes. Nature 383, 787–793. Akbari, O., DeKruyff, R. H., and Umetsu, D. T. (2001). Pulmonary dendritic cells producing IL-10 mediate tolerance induced by respiratory exposure to antigen. Nat. Immunol. 2, 725–731. Al-Shami, A., Spolski, R., Kelly, J., Fry, T., Schwartzberg, P. L., et al. (2004). A role for thymic stromal lymphopoietin in CD4+ T cell development. J. Exp. Med. 200, 159–168. Al-Shami, A., Spolski, R., Kelly, J., Keane-Myers, A., and Leonard, W. J. (2005). A role for TSLP in the development of inflammation in an asthma model. J. Exp. Med. 202, 829–839. Apostolou, I., Sarukhan, A., Klein, L., and von Boehmer, H. (2002). Origin of regulatory T cells with known specificity for antigen. Nat. Immunol. 3, 756–763. Anderson, G., Moore, N. C., Owen, J. J., and Jenkinson, E. J. (1996). Cellular interactions in thymocyte development. Annu. Rev. Immunol. 14, 73–99. Anderson, M. S., Venanzi, E. S., Klein, L., Chen, Z., Berzins, S. P., et al. (2002). Projection of an immunological self shadow within the thymus by the Aire protein. Science 298, 1395–1401. Anderson, M. S., Venanzi, E. S., Chen, Z., Berzins, S. P., Benoist, C., and Mathis, D. (2005). The cellular mechanism of Aire control of T cell tolerance. Immunity 23, 227–239. Anderson, G., Partington, K. M., and Jenkinson, E. J. (1998). Differential effects of peptide diversity and stromal cell type in positive and negative selection in the thymus. J. Immunol. 161, 6599–6603. Annunziato, F., Romagnani, P., Cosmi, L., Beltrame, C., Steiner, B. H., et al. (2000). Macrophage-derived chemokine and EBI1-ligand chemokine attract human thymocytes in different stage of development and are produced by distinct subsets of medullary epithelial cells: Possible implications for negative selection. J. Immunol. 165, 238–246. Ardavin, C., Wu, L., Li, C. L., and Shortman, K. (1993). Thymic dendritic cells and T cells develop simultaneously in the thymus from a common precursor population. Nature 362, 761–763. Bensinger, S. J., Bandeira, A., Jordan, M. S., Caton, A. J., and Laufer, T. M. (2001). Major histocompatibility complex class II-positive cortical epithelium mediates the selection of CD4+25+ immunoregulatory T cells. J. Exp. Med. 194, 427–438. Beschorner, W. E., Yao, X., and Divic, J. (1995). Recruitment of semiallogeneic dendritic cells to the thymus during postcyclosporine thymic regeneration. Transplantation 60, 1326–1330. Blau, J. N., and Veall, N. (1967). The uptake and localization of proteins, Evans Blue and carbon black in the normal and pathological thymus of the guinea-pig. Immunology 12, 363–372. Boonstra, A., Barrat, F. J., Crain, C., Heath, V. L., Savelkoul, H. F., and O’Garra, A. (2001). 1a,25-Dihydroxyvitamin d3 has a direct effect on naive CD4+ T cells to enhance the development of Th2 cells. J. Immunol. 167, 4974–4980. von Boehmer, H. (1994). Positive selection of lymphocytes. Cell 76, 219–228. Borish, L., Aarons, A., Rumbyrt, J., Cvietusa, P., Negri, J., and Wenzel, S. (1996). Interleukin10 regulation in normal subjects and patients with asthma. J. Allergy Clin. Immunol. 97, 1288–1296. Brocker, T. (1997). Survival of mature CD4 T lymphocytes is dependent on major histocompatibility complex class II-expressing dendritic cells. J. Exp. Med. 186, 1223–1232. Carpino, N., Thierfelder, W. E., Chang, M. S., Saris, C., Turner, S. J., et al. (2004). Absence of an essential role for thymic stromal lymphopoietin receptor in murine B-cell development. Mol. Cell. Biol. 24, 2584–2592.
TSLP in Epithelial Cell and Dendritic Cell Cross Talk
21
Chiffoleau, E., Beriou, G., Dutartre, P., Usal, C., Soulillou, J. P., and Cuturi, M. C. (2002). Role for thymic and splenic regulatory CD4+ T cells induced by donor dendritic cells in allograft tolerance by LF15–0195 treatment. J. Immunol. 168, 5058–5069. Clare-Salzler, M. J., Brooks, J., Chai, A., Van Herle, K., and Anderson, C. (1992). Prevention of diabetes in nonobese diabetic mice by dendritic cell transfer. J. Clin. Invest. 90, 741–748. Constant, S. L., and Bottomly, K. (1997). Induction of Th1 and Th2 CD4+ T cell responses: The alternative approaches. Annu. Rev. Immunol. 15, 297–322. Croft, M. (2003). Costimulation of T cells by OX40, 4-1BB, and CD27. Cytokine Growth Factor Rev. 14, 265–273. Le Douarin, N. M., and Jotereau, F. V. (1975). Tracing of cells of the avian thymus through embryonic life in interspecific chimeras. J. Exp. Med. 142, 17–40. Donskoy, E., and Goldschneider, I. (2003). Two developmentally distinct populations of dendritic cells inhabit the adult mouse thymus: Demonstration by differential importation of hematogenous precursors under steady state conditions. J. Immunol. 170, 3514–3521. Eisenbarth, S. C., Piggott, D. A., and Bottomly, K. (2003). The master regulators of allergic inflammation: Dendritic cells in Th2 sensitization. Curr. Opin. Immunol. 15, 620–626. Fontenot, J. D., Rasmussen, J. P., Williams, L. M., Dooley, J. L., Farr, A. G., and Rudensky, A. Y. (2005). Regulatory T cell lineage specification by the forkhead transcription factor Foxp3. Immunity 22, 329–341. Fontaine-Perus, J. C., Calman, F. M., Kaplan, C., and Le Douarin, N. M. (1981). Seeding of the 10-day mouse embryo thymic rudiment by lymphocyte precursors in vitro. J. Immunol. 126, 2310–2316. Friend, S. L., Hosier, S., Nelson, A., Foxworthe, D., Williams, D. E., and Farr, A. (1994). A thymic stromal cell line supports in vitro development of surface IgM+ B cells and produces a novel growth factor affecting B and T lineage cells. Exp. Hematol. 22, 321–328. Fujio, K., Nosaka, T., Kojima, T., Kawashima, T., Yahata, T., et al. (2000). Molecular cloning of a novel type 1 cytokine receptor similar to the common gamma chain. Blood 95, 2204–2210. Ge, Q., Hu, H., Eisen, H. N., and Chen, J. (2002). Naive to memory T-cell differentiation during homeostasis-driven proliferation. Microbes Infect. 4, 555–558. Giliani, S., Mori, L., de Saint Basile, G., Le Deist, F., Rodriguez-Perez, C., et al. (2005). Interleukin-7 receptor a (IL-7Ra) deficiency: Cellular and molecular bases. Analysis of clinical, immunological, and molecular features in 16 novel patients. Immunol. Rev. 203, 110–126. Goldschneider, I., and Cone, R. E. (2003). A central role for peripheral dendritic cells in the induction of acquired thymic tolerance. Trends Immunol. 24, 77–81. Good, M. F., Pyke, K. W., and Nossal, G. J. (1983). Functional clonal deletion of cytotoxic T-lymphocyte precursors in chimeric thymus produced in vitro from embryonic Anlagen. Proc. Natl. Acad. Sci. USA 80, 3045–3049. Guillemot, F. P., Oliver, P. D., Peault, B. M., and Le Douarin, N. M. (1984). Cells expressing Ia antigens in the avian thymus. J. Exp. Med. 160, 1803–1819. Hassall, A. H. (1849). The Microscopic Anatomy of the Human Body in Health and Disease. Samuel Highly, London. Hiroyama, T., Iwama, A., Morita, Y., Nakamura, Y., Shibuya, A., and Nakauchi, H. (2000). Molecular cloning and characterization of CRLM-2, a novel type I cytokine receptor preferentially expressed in hematopoietic cells. Biochem. Biophys. Res. Commun. 272, 224–229. Hofmeister, R., Khaled, A. R., Benbernou, N., Rajnavolgyi, E., Muegge, K., and Durum, S. K. (1999). Interleukin-7: Physiological roles and mechanisms of action. Cytokine Growth Factor Rev. 10, 41–60. Hogquist, K. A., Baldwin, T. A., and Jameson, S. C. (2005). Central tolerance: Learning selfcontrol in the thymus. Nat. Rev. Immunol. 5, 772–782.
22
Yong-Jun Liu
Houssaint, E., Torano, A., and Ivanyi, J. (1986). Split tolerance induced by chick embryo thymic epithelium allografted to embryonic recipients. J. Immunol. 136, 3155–3159. Hsieh, C. S., Liang, Y., Tyznik, A. J., Self, S. G., Liggitt, D., and Rudensky, A. Y. (2004). Recognition of the peripheral self by naturally arising CD25+ CD4+ T cell receptors. Immunity 21, 267–277. Isaksen, D. E., Baumann, H., Trobridge, P. A., Farr, A. G., Levin, S. D., and Ziegler, S. F. (1999). Requirement for Stat5 in thymic stromal lymphopoietin-mediated signal transduction. J. Immunol. 163, 5971–5977. Isaksen, D. E., Baumann, H., Zhou, B., Nivollet, S., Farr, A. G., et al. (2002). Uncoupling of proliferation and Stat5 activation in thymic stromal lymphopoietin-mediated signal transduction. J. Immunol. 168, 3288–3294. Ito, T., Wang, Y. H., Duramad, O., Hori, T., Delespesse, G. J., et al. (2005). TSLP-activated dendritic cells induce an inflammatory T helper type 2 cell response through OX40 ligand. J. Exp. Med. 202, 1213–1223. Jiang, Q., Su, H., Knudsen, G., Helms, W., and Su, L. (2006). Delayed functional maturation of natural regulatory T cells in the medulla of postnatal thymus: Role of TSLP. BMC Immunol. 7, 6. de Jong, E. C., Vieira, P. L., Kalinski, P., and Kapsenberg, M. L. (1999). Corticosteroids inhibit the production of inflammatory mediators in immature monocyte-derived DC and induce the development of tolerogenic DC3. J. Leukoc. Biol. 66, 201–204. Jordan, M. S., Boesteanu, A., Reed, A. J., Petrone, A. L., Holenbeck, A. E., et al. (2001). Thymic selection of CD4+CD25+ regulatory T cells induced by an agonist self-peptide. Nat. Immunol. 2, 301–306. Kalinski, P., Hilkens, C. M., Wierenga, E. A., and Kapsenberg, M. L. (1999). T-cell priming by type-1 and type-2 polarized dendritic cells: The concept of a third signal. Immunol. Today 20, 561–567. Kapsenberg, M. L. (2003). Dendritic-cell control of pathogen-driven T-cell polarization. Nat. Rev. Immunol. 3, 984–993. Kondo, T., Cortese, I., Markovic-Plese, S., Wandinger, K. P., Carter, C., et al. (2001). Dendritic cells signal T cells in the absence of exogenous antigen. Nat. Immunol. 2, 932–938. Laufer, T. M., Fan, L., and Glimcher, L. H. (1999). Self-reactive T cells selected on thymic cortical epithelium are polyclonal and are pathogenic in vivo. J. Immunol. 162, 5078–5084. Laufer, T. M., DeKoning, J., Markowitz, J. S., Lo, D., and Glimcher, L. H. (1996). Unopposed positive selection and autoreactivity in mice expressing class II MHC only on thymic cortex. Nature 383, 81–85. Levin, S. D., Koelling, R. M., Friend, S. L., Isaksen, D. E., Ziegler, S. F., et al. (1999). Thymic stromal lymphopoietin: A cytokine that promotes the development of IgM+ B cells in vitro and signals via a novel mechanism. J. Immunol. 162, 677–683. Le, P. T., Lazorick, S., Whichard, L. P., Haynes, B. F., and Singer, K. H. (1991). Regulation of cytokine production in the human thymus: Epidermal growth factor and transforming growth factor a regulate mRNA levels of interleukin 1a (IL-1a), IL-1b, and IL-6 in human thymic epithelial cells at a post-transcriptional level. J. Exp. Med. 174, 1147–1157. Lee, J. Y., Lim, Y. M., Park, M. J., Min, S. Y., Cho, M. L., Sung, Y. C., Park, S. H., Kim, H. Y., and Cho, Y. G. (2008). Immunol. Cell. Biol. 86, 206. Liu, Y. J. (2001). Dendritic cell subsets and lineages, and their functions in innate and adaptive immunity. Cell 106, 259–262. Li, M., Messaddeq, N., Teletin, M., Pasquali, J. L., Metzger, D., and Chambon, P. (2005). Retinoid X receptor ablation in adult mouse keratinocytes generates an atopic dermatitis triggered by thymic stromal lymphopoietin. Proc. Natl. Acad. Sci. USA 102, 14795–14800. Marrack, P., Lo, D., Brinster, R., Palmiter, R., Burkly, L., et al. (1988). The effect of thymus environment on T cell development and tolerance. Cell 53, 627–634.
TSLP in Epithelial Cell and Dendritic Cell Cross Talk
23
Matzinger, P., and Guerder, S. (1989). Does T-cell tolerance require a dedicated antigenpresenting cell. Nature 338, 74–76. Mazzucchelli, R., Hixon, J. A., Spolski, R., Chen, X., Li, W. Q., Hall, V. L., Willette-Brown, J., Hurwitz, A. A., Leonard, W. J., and Durum, S. K. (2008). Development of regulatory T cells requires IL-7Ralpha stimulation by IL-7 or TSLP. Blood 112(8), 3283–3292. Epub 2008 Jul 29. Modigliani, Y., Coutinho, A., Pereira, P., Le Douarin, N., Thomas-Vaslin, V., et al. (1996). Establishment of tissue-specific tolerance is driven by regulatory T cells selected by thymic epithelium. Eur. J. Immunol. 26, 1807–1815. Modigliani, Y., Thomas-Vaslin, V., Bandeira, A., Coltey, M., Le Douarin, N. M., et al. (1995). Lymphocytes selected in allogeneic thymic epithelium mediate dominant tolerance toward tissue grafts of the thymic epithelium haplotype. Proc. Natl. Acad. Sci. USA 92, 7555–7559. Mosmann, T. R., and Coffman, R. L. (1989). Th1 and Th2 cells: Different patterns of lymphokine secretion lead to different functional properties. Annu. Rev. Immunol. 7, 145–173. Moffatt, M. F., and Cookson, W. O. (1997). Tumour necrosis factor haplotypes and asthma. Hum. Mol. Genet. 6, 551–554. Moser, M., and Murphy, K. M. (2000). Dendritic cell regulation of Th1-Th2 development. Nat. Immunol. 1, 199–205. Murphy, K. M., and Reiner, S. L. (2002). The lineage decisions of helper T cells. Nat. Rev. Immunol. 2, 933–944. Nishizuka, Y., and Sakakura, T. (1969). Thymus and reproduction: Sex-linked dysgenesia of the gonad after neonatal thymectomy in mice. Science 166, 753–755. Nishio, H., Matsui, K., Tsuji, H., Tamura, A., and Suzuki, K. (2001). Immunolocalization of the mitogen-activated protein kinase signaling pathway in Hassall’s corpuscles of the human thymus. Acta Histochem. 103, 89–98. Nossal, G. J. (1994). Negative selection of lymphocytes. Cell 76, 229–239. Nussenzweig, M. C., Steinman, R. M., Gutchinov, B., and Cohn, Z. A. (1980). Dendritic cells are accessory cells for the development of antitrinitrophenyl cytotoxic T lymphocytes. J. Exp. Med. 152, 1070–1084. O’Garra, A. (1998). Cytokines induce the development of functionally heterogeneous T helper cell subsets. Immunity 8, 275–283. Oh, J. W., Seroogy, C. M., Meyer, E. H., Akbari, O., Berry, G., et al. (2002). CD4 T-helper cells engineered to produce IL-10 prevent allergen-induced airway hyperreactivity and inflammation. J. Allergy Clin. Immunol. 110, 460–468. Pandey, A., Ozaki, K., Baumann, H., Levin, S. D., Puel, A., et al. (2000). Cloning of a receptor subunit required for signaling by thymic stromal lymphopoietin. Nat. Immunol. 1, 59–64. Park, L. S., Martin, U., Garka, K., Gliniak, B., Di Santo, J. P., et al. (2000). Cloning of the murine thymic stromal lymphopoietin (TSLP) receptor: Formation of a functional heteromeric complex requires interleukin 7 receptor. J. Exp. Med. 192, 659–670. Puel, A., Ziegler, S. F., Buckley, R. H., and Leonard, W. J. (1998). Defective IL7R expression in T–B+NK+ severe combined immunodeficiency. Nat. Genet. 20, 394–397. Pulendran, B., Palucka, K., and Banchereau, J. (2001). Sensing pathogens and tuning immune responses. Science 293, 253–256. Quentmeier, H., Drexler, H. G., Fleckenstein, D., Zaborski, M., Armstrong, A., et al. (2001). Cloning of human thymic stromal lymphopoietin (TSLP) and signaling mechanisms leading to proliferation. Leukemia 15, 1286–1292. Ray, R. J., Furlonger, C., Williams, D. E., and Paige, C. J. (1996). Characterization of thymic stromal-derived lymphopoietin (TSLP) in murine B cell development in vitro. Eur. J. Immunol. 26, 10–16. Ramsdell, F., Lantz, T., and Fowlkes, B. J. (1989). A nondeletional mechanism of thymic self tolerance. Science 246, 1038–1041.
24
Yong-Jun Liu
Reche, P. A., Soumelis, V., Gorman, D. M., Clifford, T., Liu, M., et al. (2001). Human thymic stromal lymphopoietin preferentially stimulates myeloid cells. J. Immunol. 167, 336–343. Rimoldi, M., Chieppa, M., Salucci, V., Avogadri, F., Sonzogni, A., et al. (2005). Intestinal immune homeostasis is regulated by the crosstalk between epithelial cells and dendritic cells. Nat. Immunol. 6, 507–514. Romagnani, P., Annunziato, F., Manetti, R., Mavilia, C., Lasagni, L., et al. (1998). High CD30 ligand expression by epithelial cells and Hassal’s corpuscles in the medulla of human thymus. Blood 91, 3323–3332. Sakaguchi, S. (2004). Naturally arising CD4+ regulatory T cells for immunologic self-tolerance and negative control of immune responses. Annu. Rev. Immunol. 22, 531–562. Sakaguchi, S., Takahashi, T., and Nishizuka, Y. (1982). Study on cellular events in postthymectomy autoimmune oophoritis in mice. II. Requirement of Lyt-1 cells in normal female mice for the prevention of oophoritis. J. Exp. Med. 156, 1577–1586. Salaun, J., Bandeira, A., Khazaal, I., Calman, F., Coltey, M., et al. (1990). Thymic epithelium tolerizes for histocompatibility antigens. Science 247, 1471–1474. Salomon, B., Lenschow, D. J., Rhee, L., Ashourian, N., Singh, B., et al. (2000). B7/CD28 costimulation is essential for the homeostasis of the CD4+CD25+ immunoregulatory T cells that control autoimmune diabetes. Immunity 12, 431–440. Senelar, R., Escola, M. J., Escola, R., Serrou, B., and Serre, A. (1976). Relationship between Hassall’s corpuscles and thymocytes fate in guinea-pig fetus. Biomedicine 24, 112–122. Sher, A., Pearce, E., and Kaye, P. (2003). Shaping the immune response to parasites: Role of dendritic cells. Curr. Opin. Immunol. 15, 421–429. Shevach, E. M., McHugh, R. S., Piccirillo, C. A., and Thornton, A. M. (2001). Control of T-cell activation by CD4+ CD25+ suppressor T cells. Immunol. Rev. 182, 58–67. Sprent, J., Lo, D., Gao, E. K., and Ron, Y. (1988). T cell selection in the thymus. Immunol. Rev. 101, 173–190. Sims, J. E., Williams, D. E., Morrissey, P. J., Garka, K., Foxworthe, D., et al. (2000). Molecular cloning and biological characterization of a novel murine lymphoid growth factor. J. Exp. Med. 192, 671–680. Soumelis, V., Reche, P. A., Kanzler, H., Yuan, W., Edward, G., et al. (2002). Human epithelial cells trigger dendritic cell mediated allergic inflammation by producing TSLP. Nat. Immunol. 3, 673–680. So, T., Song, J., Sugie, K., Altman, A., and Croft, M. (2006). Signals from OX40 regulate nuclear factor of activated T cells c1 and T cell helper 2 lineage commitment. Proc. Natl. Acad. Sci. USA 103, 3740–3745. Starr, T. K., Jameson, S. C., and Hogquist, K. A. (2003). Positive and negative selection of T cells. Annu. Rev. Immunol. 21, 139–176. Vosshenrich, C. A., Cumano, A., Muller, W., Di Santo, J. P., and Vieira, P. (2004). Pre-B cell receptor expression is necessary for thymic stromal lymphopoietin responsiveness in the bone marrow but not in the liver environment. Proc. Natl. Acad. Sci. USA 101, 11070–11075. Vosshenrich, C. A., Cumano, A., Muller, W., Di Santo, J. P., and Vieira, P. (2003). Thymic stromal-derived lymphopoietin distinguishes fetal from adult B cell development. Nat. Immunol. 4, 773–779. Wang, Y., Goldschneider, I., Foss, D., Wu, D. Y., O’Rourke, J., and Cone, R. E. (1997). Direct thymic involvement in anterior chamber-associated immune deviation: Evidence for a nondeletional mechanism of centrally induced tolerance to extrathymic antigens in adult mice. J. Immunol. 158, 2150–2155. Wang, Y., Goldschneider, I., O’Rourke, J., and Cone, R. E. (2001). Blood mononuclear cells induce regulatory NK T thymocytes in anterior chamber-associated immune deviation. J. Leukoc. Biol. 69, 741–746.
TSLP in Epithelial Cell and Dendritic Cell Cross Talk
25
Watanabe, N., Wang, Y. H., Lee, H. K., Ito, T., Cao, W., and Liu, Y. J. (2005). Hassall’s corpuscles instruct dendritic cells to induce CD4+CD25+ regulatory T cells in human thymus. Nature 436, 1181–1185. Watanabe, N., Hanabuchi, S., Soumelis, V., Yuan, W., Ho, S., et al. (2004). Human thymic stromal lymphopoietin promotes dendritic cell-mediated CD4+ T cell homeostatic expansion. Nat. Immunol. 5, 426–434. Wu, L., and Shortman, K. (2005). Heterogeneity of thymic dendritic cells. Semin. Immunol. 17, 304–312. Yasutomo, K., Lucas, B., and Germain, R. N. (2000). TCR signaling for initiation and completion of thymocyte positive selection has distinct requirements for ligand quality and presenting cell type. J. Immunol. 165, 3015–3022. Ying, S., O’Connor, B., Ratoff, J., Meng, Q., Mallett, K., et al. (2005). Thymic stromal lymphopoietin expression is increased in asthmatic airways and correlates with expression of Th2-attracting chemokines and disease severity. J. Immunol. 174, 8183–8190. Yoo, J., Omori, M., Gyarmati, D., Zhou, B., Aye, T., et al. (2005). Spontaneous atopic dermatitis in mice expressing an inducible thymic stromal lymphopoietin transgene specifically in the skin. J. Exp. Med. 202, 541–549. Zaitseva, M., Kawamura, T., Loomis, R., Goldstein, H., Blauvelt, A., and Golding, H. (2002). Stromal-derived factor 1 expression in the human thymus. J. Immunol. 168, 2609–2617. Zhou, B., Comeau, M. R., De Smedt, T., Liggitt, H. D., Dahl, M. E., et al. (2005). Thymic stromal lymphopoietin as a key initiator of allergic airway inflammation in mice. Nat. Immunol. 6, 1047–1053.
CHAPTER
2 Natural Killer Cell Tolerance: Licensing and Other Mechanisms A. Helena Jonsson*,‡ and Wayne M. Yokoyama†,‡
Contents
1. 2. 3. 4.
Introduction: Natural Killer Cells and ‘‘Missing Self’’ NK Cell Receptors: The KIR and Ly49 Families Early Models of NK Cell Self-Tolerance NK Cell Licensing 4.1. Licensing of murine NK cells 4.2. Licensing of human NK cells 4.3. MHC class I gene dosage and affinity in NK cell licensing 4.4. The self-MHC-specific receptor directly signals licensing 4.5. Models of NK cell licensing by the self-MHC-specific receptor 4.6. Signaling events mediated by the self-MHC-specific receptor 4.7. Where, when, and with whom does licensing occur? 4.8. Cis versus trans interactions of Ly49 and other receptors 4.9. Cis engagements of Ly49 receptors: A role in NK cell licensing? 4.10. Transfer of MHC class I molecules to the NK cell membrane 4.11. Self-tolerance of functional NK cell subsets
29 29 31 34 34 38 38 40 40 44 46 47 50 51 52
* Medical Scientist Training Program, Washington University School of Medicine, St. Louis, Missouri 63110 { {
Howard Hughes Medical Institute, Washington University School of Medicine, St. Louis, Missouri 63110 Rheumatology Division, Departments of Medicine, Pathology, and Immunology, Washington University School of Medicine, St. Louis, Missouri 63110
Advances in Immunology, Volume 101 ISSN 0065-2776, DOI: 10.1016/S0065-2776(08)01002-X
#
2009 Elsevier Inc. All rights reserved.
27
28
A. Helena Jonsson and Wayne M. Yokoyama
5. NK Cell Tolerance in MHC Class I Chimeric and Mosaic Mice 5.1. Studies of MHC class I chimeric and mosaic mice 5.2. New interpretations of tolerance in MHC chimeric and mosaic mice 6. Other Safeguards of NK Cell Tolerance to Self 6.1. Cytokine stimulation enhances NK cell potency 6.2. Non-MHC-specific inhibitory receptors 6.3. Activation receptor cooperation and synergy 6.4. Accessory cells in NK cell activation 6.5. Modulation of NK cell activity by regulatory cells 7. NK Cell Tolerance Mechanisms in the Clinic 7.1. KIR-HLA disease associations and NK cell licensing 7.2. Hematopoietic stem cell transplantation 7.3. Tumor immunotherapy 7.4. Autoimmune disease 7.5. NK cells in fetal tolerance 8. Concluding Remarks Acknowledgments References
Abstract
53 54 56 57 57 59 60 61 62 63 63 63 64 65 65 66 67 67
Armed with potent cytotoxic and immunostimulatory effector functions, natural killer (NK) cells have the potential to cause significant damage to normal self cells unless controlled by self-tolerance mechanisms. NK cells identify and attack target cells based on integration of signals from activation and inhibitory receptors, whose ligands exhibit complex expression and/or binding patterns. Preservation of NK cell self-tolerance must therefore go beyond mere engagement of inhibitory receptors during effector functions. Herein, we review recent work that has uncovered a number of mechanisms to ensure self-tolerance of NK cells. For example, licensing of NK cells allows only NK cells that can engage self-MHC to become functionally competent, or licensed. The molecular mechanism of this phenomenon appears to require signaling by receptors that were originally identified in effector inhibition. However, the nature of the signaling event has not yet been defined, but new interpretations of several published experiments provide valuable clues. In addition, several other cell-intrinsic and -extrinsic mechanisms of NK cell tolerance are discussed, including activation receptor cooperation and synergy, cytokine stimulation, and the opposing roles of accessory and regulatory cells. Finally, NK cell tolerance is discussed as it relates to the clinic, such as KIR–HLA disease associations, tumor immunotherapy, and fetal tolerance.
Natural Killer Cell Tolerance
29
1. INTRODUCTION: NATURAL KILLER CELLS AND ‘‘MISSING SELF’’ Natural killer (NK) cells were first defined by their ability to kill tumor cells without prior immunization, a characteristic that clearly distinguished them from T lymphocytes (Lanier et al., 1986). How NK cells could identify and kill tumor cells while sparing normal cells a priori remained a mystery until the late 1980s, when Klas Ka¨rre proposed the ‘‘missing self’’ hypothesis. This hypothesis states that NK cells react when target cells lack expression of major histocompatibility complex (MHC) class I, which could be indicative of a pathological event, such as tumorigenesis or viral infection (Karre et al., 1986; Ljunggren and Karre, 1990). As MHC class I is normally ubiquitously expressed, this hypothesis also provided a framework for considering NK cell tolerance to self. In the two decades since this first step towards understanding NK cell activation and self-tolerance, much has been learned, including the discovery of inhibitory receptors for MHC class I as the molecular basis of the missing-self hypothesis (Colonna and Samaridis, 1995; Karlhofer et al., 1992; Wagtmann et al., 1995). However, many questions remain because MHC class I-deficient hosts do not display the NK cell auto-reactivity predicted by the ‘‘missing self’’ hypothesis. In this review, we will discuss an NK cell tolerance process, termed licensing, and its possible molecular mechanisms, as well as other cell-intrinsic and -extrinsic barriers to NK cell auto-reactivity. Finally, we will discuss NK cell self-tolerance as it relates to the clinic.
2. NK CELL RECEPTORS: THE KIR AND Ly49 FAMILIES NK cells are ontologically related to B and T lymphocytes but lack rearranged antigen-specific receptors, for example, B or T cell receptors. Instead, NK cells rely on germline-encoded receptors belonging to several families that often include both inhibitory and activation members. In humans, the predominant NK cell receptors are the killer-cell immunoglobulin (Ig)-like receptors (KIRs), type I integral membrane proteins that form a polymorphic family within the immunoglobulin superfamily (Bashirova et al., 2006; Gardiner, 2008). In mice, the major NK cell receptors are type II integral membrane, C-type lectin-like molecules belonging to the Ly49 family (Lanier, 2005; Raulet et al., 2001). Both human and mouse NK cells also express a conserved lectin-like heterodimeric receptor, CD94 coupled with members of the NKG2 family. The inhibitory receptors have an immunoreceptor tyrosine-based inhibitory motif (ITIM) in their cytoplasmic tails that predominantly associates with the cytoplasmic tyrosine phosphatase, SHP-1, though
30
A. Helena Jonsson and Wayne M. Yokoyama
the ITIM may potentially recruit other signaling molecules (Lanier, 2005; Long, 1999; Vivier et al., 2004). Most MHC-specific inhibitory NK cell receptors recognize MHC class Ia molecules or, in the case of NKG2/ CD94, the MHC class Ib molecule Qa-1 (in humans, HLA-E), which presents signal peptides from MHC class Ia molecules and thereby provides an indirect measure of MHC class Ia expression (Kumar and McNerney, 2005; Lanier, 2005). Ligands of MHC-specific inhibitory receptors tend to be constitutively expressed on healthy cells but are often downregulated in instances of viral infection or cellular transformation (Alcami and Koszinowski, 2000; Algarra et al., 2004). Notably, several viruses have developed decoy MHC class I-like receptors in an attempt to avoid NK cell activation, an evolutionary indication of the importance of the antiviral activities of NK cells (Lodoen and Lanier, 2006). Although inhibitory human KIRs and mouse Ly49s are strikingly different in their structure and membrane topology, they share many other features (Yokoyama, 2008a), including: (1) Constitutive and selective expression on naı¨ve, unstimulated NK cells (with exceptions for rare populations of T cells). (2) Stochastic expression on overlapping subsets of NK cells. A recent flow cytometric study of human NK cell receptor repertoires detected every possible combination of KIRs and CD94/NKG2A in a single donor (Yawata et al., 2008). (3) Simultaneous, apparently stable, expression of one or more inhibitory receptors by an individual NK cell, with each individual NK cell expressing an average of two or three inhibitory receptors (Pascal et al., 2006; Rouhi et al., 2006). (4) Germ-line encoded by small families of genes that are clustered in the genome. (5) Impressive polymorphism, in terms of both gene number and alleles for each gene (Bashirova et al., 2006; Makrigiannis et al., 2002; Wilhelm et al., 2002). (6) Intermediate affinity for MHC class I (KD ¼ 2–10 mM). (7) Promiscuous binding to a subset of MHC class I molecules. Ly49A, for example, binds H2Dd, Dk, and Dp, but not H2Db or any known H2K or H2L allele (Chung et al., 2000; Deng and Mariuzza, 2006). Similarly, KIR3DL1 binds HLA-B alleles of the Bw4 group but not of the Bw6 group (Cella et al., 1994; Gumperz et al., 1995). (8) Modest, if any, effect of MHC-bound peptides on recognition. (9) Inhibition mediated by cytoplasmic ITIMs (Long, 1999). (10) Close homology of sequence and structure with molecules that lack ITIMs and instead are activation receptors. Together, these data indicate that the mouse Ly49 receptors and human KIRs are functionally analogous receptors. This is a striking
Natural Killer Cell Tolerance
31
example of convergent evolution, in which mice and humans have evolved independent genetic solutions to achieve MHC-dependent inhibition of NK cell effector function (Barten et al., 2001; Gumperz and Parham, 1995; Kelley et al., 2005). Therefore, it is likely that if these receptors are involved in NK cell tolerance beyond self-MHC recognition during effector responses, they should have similar functional attributes. The activating KIRs and Ly49 receptors are structurally related to their inhibitory counterparts but lack cytoplasmic ITIMs. Instead, they have short cytoplasmic tails and associate via charged transmembrane residues with DAP12 or other immunoreceptor tyrosine-based activation motif (ITAM)-containing signaling chains for normal expression and signal transduction (Lanier, 2005; Yokoyama and Plougastel, 2003). Ligands of activation receptors include both MHC class I-like molecules and unrelated proteins, though the ligands of many activation receptors remain undetermined. For NKG2D, some ligands are constitutively expressed at low levels on healthy cells and are upregulated in response to cellular stress and other stimuli (Gasser and Raulet, 2006, Groh et al., 1996). The upregulation of such ligands is termed ‘‘induced-self’’ and enhances activation of NK cells by diseased cells. During effector responses, NK cells may detect alterations in endogenous protein expression on target cells by integrating signals from a number of these germ line-encoded activation and inhibitory receptors (Oberg et al., 2004; Yu et al., 2007). The balance of signals mediated by these receptors determines the NK cell response to the target. In missingself detection, the inhibitory signal is decreased or absent, allowing the activation signal to dominate and trigger cytokine production and/or cytotoxic effector mechanisms. Conversely, high-level expression of an activating ligand on a target cell can lead to NK cell activation even in the context of normal MHC expression. However, the inhibitory receptor functions tend to dominate effector responses.
3. EARLY MODELS OF NK CELL SELF-TOLERANCE The ‘‘missing self’’ hypothesis was a prominent early model of NK cell function and self-tolerance. Klas Ka¨rre and colleagues discovered that NK cells preferentially kill target cells that lack MHC class I expression (Ka¨rre et al., 1986). Since virtually all normal cells express MHC class I, missingself appeared to adequately explain protection against NK cell autoaggression. The subsequent identification of inhibitory Ly49 receptors and KIRs provided a molecular basis for missing-self reactivity and tolerance to MHC-expressing, normal-self cells (Colonna and Samaridis, 1995; Karlhofer et al., 1992; Wagtmann et al., 1995). However, two observations suggested that NK cell tolerance was more complicated. First, NK
32
A. Helena Jonsson and Wayne M. Yokoyama
cells from MHC-deficient mice were hyporesponsive (Liao et al., 1991), not hyperactive as predicted by the missing-self hypothesis. Second, inhibitory Ly49 receptors and KIRs exhibited selective MHC binding, such that some of these receptors lacked a ligand even in an MHCsufficient host. Thus, the missing-self hypothesis appeared to have some caveats. Indeed, one important aspect of NK cell self-tolerance concerns the appropriate pairing of NK cell receptors and their MHC ligands. As mentioned above, Ly49 receptors and KIRs are highly polymorphic, as are their MHC ligands, and each inhibitory receptor binds only a small subset of MHC class I alleles. Moreover, the Ly49 and KIR loci are not genetically linked to the MHC locus. The Ly49s are encoded in the NK gene complex (NKC) on distal mouse chromosome 6 whereas the KIRs are encoded in the leukocyte receptor complex (LRC) on human chromosome 19q13.4 (Kelley et al., 2005, Yokoyama and Plougastel, 2003). On the other hand, the MHC region is on mouse chromosome 17 and human chromosome 6p21, respectively. In other words, the genes for the NK cell receptors and MHC ligands segregate independently, necessitating mechanisms to result in the appropriate pairing of receptors and ligands. This ensures self-tolerance for each NK cell for at least two levels of heterogeneity, the individual NK cell in the heterogeneous pool of NK cells in any given host, and for the host in the heterogeneous population of individual hosts. One early model proposed that all NK cells express at least one receptor specific for self-MHC, initially based on the finding that NK cell clones established from two normal human donors all appeared to express at least one self-specific inhibitory receptor (Valiante et al., 1997). Several studies in mice also appeared to support this hypothesis. First, expression of Ly49 and KIR alleles during development is sequential and once established, appears to be fixed for each NK cell (Dorfman and Raulet, 1998; Yu et al., 2007). Second, the frequency of cells expressing a given Ly49 is affected by the host MHC haplotype. For example, mice that express an MHC class I ligand for Ly49A (e.g., H2Dd) have a lower frequency of Ly49Aþ NK cells than MHC-congenic mice that lack a ligand for Ly49A (e.g., H2b) or MHC-deficient mice (Held et al., 1996; Salcedo et al., 1997). Together, these data suggested that NK cells accumulate additional inhibitory receptors until they are able to engage self-MHC and are consistent with the ‘‘at least one’’ hypothesis. Recent work, however, has shown that a significant fraction of the NK cell population of both mice and humans lacks any known receptor for self-MHC (Anfossi et al., 2006, Fernandez et al., 2005, Kim et al., 2005). These ‘‘self-blind’’ cells exhibit a relative inability to kill MHC class I-deficient targets relative to NK cells expressing self-MHC-specific inhibitory receptors, a condition described as ‘‘hyporesponsiveness.’’
Natural Killer Cell Tolerance
33
That these cells are functionally inert suggests that they have a form of self-tolerance that may be distinct from that of NK cells with known selfMHC-specific receptors. However, it cannot be formally excluded that these cells express as yet unidentified inhibitory receptor(s) for self, and the cause of their deficiency in target killing could be related to expression (or lack thereof) of undefined target cell ligands for either inhibitory or activation receptors. Another model for tolerance, the receptor calibration model, focuses on differences in Ly49 expression levels on individual NK cells from mice with different MHC haplotypes (Karlhofer et al., 1994; Olsson et al., 1995; Sentman et al., 1995). Ly49 surface staining is significantly lower on NK cells from hosts with self-MHC that can bind the given Ly49 than on NK cells from mice that lack self-MHC. For example, Ly49Aþ NK cells from mice expressing self-MHC (e.g., H2Dd) have lower levels of surface Ly49A than Ly49Aþ NK cells from mice lacking self-MHC (e.g., H2b or b2m/) (Held et al., 1996, Karlhofer et al., 1994, Kase et al., 1998). Recent studies in humans indicate a similar trend of decreased surface inhibitory KIR levels in individuals who express the cognate human leukocyte antigen (HLA) ligand (Yawata et al., 2006). Thus, expression levels of NK cell receptors for MHC are altered in hosts with the cognate MHC ligand. According to the postulated kinetics of receptor engagement and signaling in the receptor calibration model, an NK cell with a lower level of expression of an inhibitory receptor would require a higher level of ligand expression in order to achieve engagement sufficient to reach the threshold for inhibitory signaling (Sentman et al., 1995). Because of this, Ly49Alow NK cells were postulated to be more sensitive to changes in ligand availability than Ly49Ahi NK cells (Hoglund et al., 1997). In mice, the Ly49Alow NK cells were better able to kill tumor targets expressing reduced H2Dd than Ly49Ahigh NK cells isolated from a mouse lacking self-MHC, which were completely inhibited (Olsson-Alheim et al., 1997). Interestingly, in a H2b MHC class I mosaic mouse, where MHC class I is expressed on some cells but not others, Ly49C levels were reduced on both MHC-deficient and MHC-sufficient NK cells (Andersson et al., 1998). Culture in interleukin (IL)-2 for 4 days restored normal (i.e., elevated) Ly49C surface expression on MHC-deficient cells, indicating that the surface expression level is reversible depending on environmental conditions. Recent findings propose a new interpretation for the data used to support the receptor calibration model: the MHC-dependent reduction in apparent surface expression of Ly49 receptors on NK cells can be explained by cis interactions between Ly49 and MHC class I molecules expressed on the same NK cell (Doucey et al., 2004; Held and Mariuzza, 2008), as discussed in greater detail below. Regardless, the receptor calibration model fails to explain why MHC class I-deficient NK cells
34
A. Helena Jonsson and Wayne M. Yokoyama
respond so poorly to MHC class I-deficient target cells, which are readily killed by wild-type NK cells (Liao et al., 1991). In this situation, there is little or no engagement of the self-specific inhibitory receptor, yet the b2m/ NK cells remain relatively inert. Similar results are found for NK cells from TAP-1 knockout mice, another MHC-deficient strain (Ljunggren et al., 1994). In addition, MHC class I-deficient mouse NK cells are poor responders to plate-bound anti-activation receptor antibody cross-linking, which is entirely independent of engagement of the Ly49 receptors or other as yet undefined receptors that may be involved in target recognition (Kim et al., 2005). Thus, these older models of NK cell tolerance do not account for observed NK cell functions, particularly in MHC-deficient hosts.
4. NK CELL LICENSING 4.1. Licensing of murine NK cells The NK cell licensing hypothesis proposes that an NK cell must engage self-MHC in order to be responsive to subsequent stimuli received via their activation receptors, a state termed ‘‘licensed’’ (Fig. 2.1) (Kim et al., 2005; Yokoyama and Kim, 2006a,b). NK cells that fail to engage self-MHC are unlicensed. Licensing occurs via the MHC-specific Ly49 receptors that were first identified as inhibitory receptors in effector responses, providing a second function for these receptors that may, ironically, be activating. NK cell licensing thus produces two types of self-tolerant NK cells with regard to self-MHC: Licensed NK cells, which maintain selftolerance by direct inhibition by self-MHC through the same receptor that conferred licensing; and unlicensed NK cells, which cannot engage selfMHC and are tolerant because they are highly resistant to stimulation received through their activation receptors. Missing-self stimuli (e.g., Concanavalin A (ConA)-treated b2m/ blasts) are not enough to activate unlicensed cells, and hence the cells also remain inert to functionally MHC-deficient normal host cells. The licensing model arose from studies examining the responses of freshly isolated NK cells to target cell-free antibody cross-linking. Prior studies of NK cell tolerance predominantly examined cultured NK cell killing of target cells, a strategy that was useful in dissecting NK cell receptor specificity (Karlhofer et al., 1992), but which could be problematic if culture conditions affected functional attributes of otherwise naı¨ve NK cells. Furthermore, despite major advances, the entire repertoire of NK cell receptors and ligands involved in target recognition is incompletely understood. To minimize these potential confounding effects, Kim et al. used freshly explanted, naı¨ve NK cells that were stimulated with
Natural Killer Cell Tolerance
35
FIGURE 2.1 NK cell licensing. For an NK cell to become licensed, it must express an inhibitory receptor capable of binding self-MHC (indicated by matching black Ly49 and MHC class I molecules). NK cells that lack inhibitory receptors to engage self-MHC remain (or become) unlicensed. (A) Under the ‘‘arming’’ or ‘‘stimulatory’’ model of NK cell licensing, the Ly49–MHC class I interaction itself signals NK cell licensing, with the traditionally ‘‘inhibitory’’ receptor thus having a ‘‘positive’’ effect. (B) According to the ‘‘disarming’’ or ‘‘inhibitory’’ model, an NK cell must receive balanced activation and inhibitory signals in order to become licensed. Constitutive activation in the absence of inhibitory counter-signaling gives rise to an anergic (unlicensed) NK cell.
plate-bound antibodies against NK cell activation receptors such as NK1.1 (Nkrp1c), which is expressed on all immature and mature NK cells in C57BL/6 (H2b) mice. They then stained for intracellular interferon g (IFNg) as an index of NK cell activation, which, in conjunction with surface staining for lineage markers and Ly49 receptors, allowed for the functional characterization of individual NK cells. These studies revealed that only NK cells expressing an inhibitory receptor specific for self-MHC produced IFNg upon ex vivo plate-bound antibody stimulation (Kim et al., 2005). For example, Ly49Aþ NK cells
36
A. Helena Jonsson and Wayne M. Yokoyama
from MHC-congenic or transgenic (Tg) mice expressing H2Dd, a known ligand for Ly49A, produced abundant IFNg upon stimulation. Ly49Aþ NK cells derived from mice lacking an MHC ligand for Ly49A, such as the H2b haplotype, produced significantly less IFNg. In other words, Ly49Aþ NK cells were licensed in mice expressing H2Dd. Importantly, IFNg production in response to PMA þ ionomycin stimulation was the same for both licensed and unlicensed NK cells, indicating that unlicensed cells are equipped to produce IFNg. Moreover, these findings were recapitulated with antibodies to other NK cell activation receptors, including those with different associated ITAM-containing signaling chains. In addition, production of other cytokines showed similar patterns, and the responsiveness of licensed NK cells was also extended to target killing. Interestingly, CD94/NKG2A expression did not clearly correlate with the licensed phenotype. Taken together, these findings strongly suggested that a receptor specific for self-MHC must be engaged in order for the NK cell to become functionally competent for triggering through an activation receptor; that is, NK cells are licensed by engagement of self-MHC-specific receptors. The requirement of the Ly49–MHC interaction in producing functionally competent cells was conclusively demonstrated using a mouse (produced by the Hansen Lab, Washington University, St. Louis, MO) transgenic for a H2Kb-ovalbumin (ova) peptide single chain MHC class I trimer (SCT) on an otherwise MHC class I-deficient background (Kb/ Db/ b2m/) (Yu et al., 2002). The H2Kb-ova SCT is the only expressed MHC class I molecule in these mice, and it is exclusively recognized by Ly49C, as indicated by SCT-tetramer staining of primary NK cells from b2m-deficient mice (Kim et al., 2005). SCT-tetramer staining was completely blocked by preincubation with an antibody monospecific for Ly49C, establishing that the SCT is only recognized by Ly49C. As predicted by the licensing model, Ly49Cþ NK cells from these mice produced IFNg upon plate-bound antiNK1.1 stimulation, but NK cells lacking Ly49C expression did not. Thus, a self-MHC-specific receptor is required for licensing, and individual NK cells are separately licensed, depending on their expressed receptors. That individual NK cells are licensed separately based upon their expressed inhibitory receptors provides an explanation for hybrid resistance, a phenomenon that contradicts the classic laws of tissue transplantation. It has long been observed that while F1 hybrid mice can accept skin grafts from either inbred parental strain, a T cell-dependent process, they reject parental bone marrow (BM) transplants (Cudkowicz and Stimpfling, 1964; Murphy et al., 1987). Recipient NK cells are responsible for this BM rejection, and it is dependent on the MHC environment of the recipient (Ohlen et al., 1989; Suzue et al., 2001). In terms of licensing, some NK cells may be licensed to recognize only MHC class I molecules inherited from the mother, while others may be licensed only by MHC class I molecules inherited from the father. Yet another NK cell
Natural Killer Cell Tolerance
37
population may express one or a combination of inhibitory receptors that recognize MHC class I molecules from both parents and thereby is licensed by both parental molecules. Since MHC class I molecules are codominantly expressed, each of these three licensed NK cell populations can recognize F1 hybrid cells as self. Upon infusion of maternal BM cells, however, those NK cells that were only licensed by paternal MHC class I molecules may recognize the BM cells as ‘‘missing self’’ and initiate rejection of these cells. Similarly, upon exposure to paternal BM, the NK cells solely licensed by maternal MHC class I molecules may reject the paternal cells. Thus, licensing provides a satisfying explanation for how NK cells can determine if a cell expresses the full complement of selfMHC molecules, as in hybrid resistance.
4.1.1. Characteristics of unlicensed NK cells Importantly, unlicensed NK cells are present even among NK cells from wild-type mice. Fernandez et al. identified a population of NK cells in wildtype mice that lack all known self-MHC-specific inhibitory receptors (i.e., Ly49C I NKG2 on a H2b background) (Fernandez et al., 2005). Representing 10% of all NK cells, these NK cells responded poorly to stimulation with tumor cells or plate-bound antibody but produced IFNg at similar frequencies to self-MHC-specific NK cells upon stimulation with PMA þ ionomycin. Importantly, there was no apparent difference in developmental markers between Ly49C I NKG2 NK cells and their self-MHC specific counterparts, further indicating that these unlicensed cells are not simply immature. More definitive results were obtained with MHCcongenic and Tg mice, including the SCT-Kb Tg TKO mouse, as described above (Kim et al., 2005). Thus, an important facet of the licensing hypothesis is the presence of NK cells that are apparently mature but are much less functionally competent to be triggered through their activation receptors. Notably, unlicensed NK cells did produce IFNg in response to high doses of plate-bound activating antibodies (Kim et al., 2005), indicating that they are not completely inert to stimulation. However, their IFNg production was always lower than that of licensed NK cells at any given stimulation dose. Interestingly, in vivo poly(I:C) (polyinosinic-polycytidylic acid) treatment or in vitro culture in IL-2 circumvented the effect of licensing as it primed even unlicensed populations to respond to stimulation (Kim et al., 2005). Fernandez et al. found that IL-2 stimulation in vitro but not poly(I:C) treatment in vivo could break the hyporesponsiveness of these cells, but these differences with poly(I:C) may be dose-dependent, as the former group used twice the dose of the latter (Fernandez et al., 2005; Kim et al., 2005). While it cannot be ruled out that unlicensed NK cells express an as yet undiscovered selfspecific inhibitory receptor, this possibility seems unlikely as this cell population exhibited impaired responses even in cell-free stimulation assays using plate-bound activating antibodies (Fernandez et al., 2005;
38
A. Helena Jonsson and Wayne M. Yokoyama
Kim et al., 2005). Regardless, cytokine treatment was able to reverse the functional incompetence of unlicensed NK cells. The ability of in vitro cytokine stimulation to overcome the hyporesponsiveness of unlicensed NK cells may mimic the response of unlicensed NK cells to viral infections. This issue is discussed in greater detail below with regard to cytokine stimulation of NK cell potency.
4.2. Licensing of human NK cells Several observations suggest that licensing also applies to human NK cells. A sizeable percentage (10%) of human CD56dim NK cells lack KIRs for self-MHC as well as NKG2A (Anfossi et al., 2006). These KIRNKG2A NK cells exhibit reduced cytokine production and cytotoxicity in response to tumor cell stimulation as well as anti-CD16 crosslinking and antibody-dependent cell-mediated cytotoxicity (ADCC) compared with self-specific NK cells, consistent with an unlicensed state. Protein levels of perforin and granzyme were normal in this population, and as seen in the murine system, the cells responded strongly to PMA þ ionomycin, indicating that they are capable of executing effector functions. In vitro stimulation with IL-15 or IL-12 þ IL-18 for 24 h did not improve the function of unlicensed cells. A small number of representative individuals were examined whose NK cells expressed a KIR with a cognate self-MHC ligand; these cells were capable of being triggered through their activation receptors, suggesting the necessity of KIR– MHC interactions for the functional competency of human NK cells. As human donors are genetically disparate, larger numbers of subjects must be examined to conclusively relate NK cell function to KIR and HLA genotypes. Recently, our group examined IFNg production by KIR3DL1þ NK cells from a much larger panel of unrelated normal donors that either express or lack its cognate ligand, HLA-Bw4. Thirty-six of 39 donors were informative; three donors either lacked either the KIR3DL1 gene or expression on the cell surface. KIR3DL1þ NK cells make abundant IFNg in response to MHC-deficient tumor stimulation when taken from donors homozygous for its cognate ligand (HLA-Bw4) but not from donors who lack this ligand (i.e., HLA-Bw6/Bw6) (Kim et al., 2008). In homozygous HLA-Bw4 donors, the KIR3DL1þ NK cells produced more IFNg than the KIR3DL1 NK cells. Taken together, these data provide strong correlative data supporting a role for licensing of human NK cells.
4.3. MHC class I gene dosage and affinity in NK cell licensing The role of gene dosage of MHC class I alleles in NK cell education remains unclear. In several human disease association studies, homozygosity for cognate HLA allele ligand for a KIR was required for protection from
Natural Killer Cell Tolerance
39
infectious diseases, whereas in others, one HLA allele was sufficient for protection (discussed in the following sections) (Carrington et al., 2005, Jones et al., 2006, Khakoo et al., 2004, Martin et al., 2007). However, licensing effects on KIR3DL1þ NK cells were only seen in donors homozygous for the HLA ligand for KIR3DL1 (Kim et al., 2008). This contrasts with data presented by others in which a single copy of the HLA ligand for KIR2DL1 or KIR2DL2 (i.e., HLA-C2 and HLA-C1, respectively) was enough to induce licensing of the corresponding NK cell populations (Anfossi et al., 2006; Yu et al., 2007). Conversely, human NK cells that express two self-MHCspecific inhibitory KIRs respond more potently to HLA class-I deficient tumor cells and CD16 cross-linking (Yu et al., 2007). Thus, there is conflicting information with regard to HLA gene dosage effects in human NK cell licensing. Emerging data point to a role for strength of interaction between inhibitory NK cell receptors and their cognate MHC ligands in NK cell licensing. A new study by the Parham group investigated the effector responses and receptor repertoires of NK cells from 58 human subjects using multiparameter flow cytometry (Yawata et al., 2008). Consistent with other results described above (Kim et al., 2008), the authors found that self-MHC specific KIRþ populations responded more robustly to missing-self stimulation than the corresponding population from individuals that lacked the cognate HLA ligand. Moreover, in the same donor, NK cells with a given self-HLA-specific KIR responded better than NK cells without a self-specific KIR. NKG2Aþ NK cells from all donors responded better than NKG2A cells. Interestingly, NK cell receptor repertoires were found that are consistent with a state of ‘‘intermediate inhibition’’ of the NK cell population. Specifically, individuals with a single strong inhibitory KIR–HLA interaction exhibited a NK repertoire dominated by KIR expression. Individuals that lacked any KIR–HLA associations or had multiple strong KIR–HLA associations tended to have NK receptor repertoires dominated by NKG2A expression, which promotes intermediate functional enhancement. These data suggest that signal strength of receptor–ligand interaction may shape the NK cell receptor repertoire and their capacity to be inhibited in effector responses. Data from mouse models have also demonstrated that different Ly49– MHC combinations may give rise to effector functions of different potencies. For example, while expression of H2Ld alone can license NK cells to reject b2m/ BM, NK cells from mice that express H2Ld along with H2Kb and H2Db are unable to detect missing H2Ld (e.g., on H2KbDb BM) (Johansson et al., 2005). In sum, the role of MHC and receptor gene dosage on NK cell licensing needs further clarification but the strength (i.e., affinity and/or avidity) of the interaction may also determine the outcome.
40
A. Helena Jonsson and Wayne M. Yokoyama
4.4. The self-MHC-specific receptor directly signals licensing The previously summarized data strongly support the hypothesis that a self-MHC-specific receptor engages self-MHC in determining MHCdependent tolerance of NK cells in mice as well as humans. Several potential mechanisms can be considered to account for licensing. Among the indirect effects originally hypothesized was the possibility that the interaction could give rise to cross-linking of MHC, inducing a signaling event in the MHC-expressing cell and perhaps secretion of a cytokine or some other molecular message to induce licensing (Kim et al., 2005). Another possibility was that the binding of Ly49 or KIR with MHC class I could bring the NK cell and a host element into close proximity and thus enable a separate interaction that is directly responsible for licensing. However, these indirect possibilities have been ruled out by gene transfer studies. Specifically, gene transfer of intact and mutant Ly49A receptors into hematopoietic stem cells for BM reconstitution studies have shown that a functional ITIM is necessary for licensing (Kim et al., 2005). An intact Ly49A receptor was able to confer licensing, but only when the ligand (H2Dd) was present in the host. On the other hand, a mutant Ly49A with either a cytoplasmic tail deletion or a Y-to-F mutation in the ITIM was unable to mediate licensing (Kim et al., 2005). Taken together, these data strongly suggest that the self-MHC-specific receptor itself directly signals the licensing event in an ITIM-dependent manner.
4.5. Models of NK cell licensing by the self-MHC-specific receptor A consensus in the field has been reached in which many groups now agree that the self-MHC-specific receptor must engage self-MHC in order for licensing (or education) to occur (Parham, 2006; Raulet and Vance, 2006; Vivier et al., 2008; Yokoyama and Kim, 2006a). What is not clear, and has been vigorously discussed (including a debate at the 10th meeting of the Society for Natural Immunity in Cambridge, UK, 2007), is the mechanism by which engagement of the self-MHC-specific receptor leads to licensing. In other words, what is the nature of the signaling event provided by the engaged self-MHC-specific receptor? Two functional mechanisms have emerged as the current most likely candidates: (1) the ‘‘arming’’ or ‘‘stimulatory receptor’’ hypothesis; and (2) the ‘‘disarming’’ or ‘‘inhibitory receptor’’ hypothesis (Raulet and Vance, 2006; Yokoyama and Kim, 2006a). There are not yet any definitive data in favor of one mechanism over the other; nonetheless it is useful to review the models and analyze the existing data. The ‘‘arming’’ mechanism postulates that NK cell licensing is directly induced by the interaction of an inhibitory NK receptor with MHC class I
Natural Killer Cell Tolerance
41
(Fig. 2.1A). In essence, the self-MHC-specific receptor acts to initiate the licensing event, akin to a stimulatory receptor. In its strictest interpretation, the arming model implies that an NK cell that interacts with any MHC class I-expressing cell will be licensed, even if MHC class I-deficient cells are also present. The ITIM of inhibitory Ly49 receptors is required for licensing of murine NK cells (Kim et al., 2005), but the identities of the downstream signaling molecules involved in this cascade have not yet been identified. How an ‘‘inhibitory’’ receptor can induce a ‘‘positive’’ functional effect, such as licensing, may require a shift in our thinking, remembering that these receptors were initially described in terms of their function during an effector response. However, a different signaling milieu may exist during NK cell education as opposed to during effector responses, resulting in different outcomes after the same or similar receptor engagement. The ‘‘disarming’’ model proposes that self-MHC-specific NK cell receptors oppose constitutive activation signals to induce licensing (Fig. 2.1B). In other words, they act akin to their role in inhibiting effector responses by counteracting the signal of a postulated second receptor that presumably recognizes self and activates the NK cell. In the absence of an inhibitory signal from the self-MHC-specific receptor, the activation receptor would cause the NK cell to become (or remain) unlicensed. This model predicts that interactions of NK cells with a mix of MHC class I-deficient and -sufficient host cells would dominantly lead to an unlicensed phenotype due to an aggregate excess of activation signals. Implicit in the disarming model is the engagement of a self-specific activation receptor. Interestingly, no single activation receptor or signal chain is required for licensing as mice deficient in each of the signaling molecules, DAP10, DAP12, FcREIg, and CD3z, had intact licensing (Kim et al., 2005). A redundant role for these activation receptors cannot be excluded, however, as the studies only included single knockout mice for each of these proteins.
4.5.1. Activation receptors in NK cell licensing Self-specific NK cell activation receptors have not been convincingly described or studied in the context of licensing. Ly49Dþ NK cells appear to be defective in mice expressing H2Dd (George et al., 1999b), a putative ligand for Ly49D (George et al., 1999a; Nakamura et al., 1999). However, physical interaction between Ly49D and H2Dd has been difficult to detect (Mehta et al., 2001), suggesting that H2Dd may not be a Ly49D ligand or that other, as yet undefined, parameters affect H2Dd binding to Ly49D. In addition, H2Dd is recognized by several Ly49 inhibitory receptors (Hanke et al., 1999, Karlhofer et al., 1992), suggesting that its effect on Ly49Dþ NK cells could be due to, or at least modulated by, other
42
A. Helena Jonsson and Wayne M. Yokoyama
receptor–ligand interactions. Regardless, the role of Ly49D in the context of licensing has not been studied. Studies on the NKG2D activation receptor clearly show that it is specific for host ligands (and viral decoys). Most NKG2D ligands are poorly expressed on normal tissues and are upregulated on ‘‘stressed’’ cells, compatible with the induced-self model for the role of NKG2D in immune responses (Gasser et al., 2005), but some ligands appear to be constitutively expressed in certain compartments. Specifically, NKG2D ligands are expressed by several types of normal healthy cells, including B cells, granulocytes, monocytes, mesenchymal stem cells, and intestinal epithelium (Groh et al., 1996; Mistry and O’Callaghan, 2007; Nowbakht et al., 2005; Spaggiari et al., 2006). Interestingly, NKG2D ligands are also expressed by hematopoietic BM cells in vivo, and by in vitro cultured BM stromal cells (Ogasawara et al., 2005; Poggi et al., 2005). In addition, NKG2D ligands can be expressed as soluble forms that modulate NKG2D function (Groh et al., 2002). Thus, the induced-self model for NKG2D function does not completely account for the observed NKG2D ligand expression pattern, implying possible effects on NK cell tolerance. Studies of transgenic mice expressing ligands for the NKG2D activation receptor show that sustained expression of Rae-1e resulted in a defect in natural cytotoxicity to Rae1-expressing targets. There was also more general impairment in NK cell function, such as decreased reactivity against MHC class I-deficient targets (Oppenheim et al., 2005). Similarly, sustained expression of MICA, which binds avidly to mouse NKG2D, resulted in defects in NK cell cytotoxicity against MICA-expressing target cells (Wiemann et al., 2005). Thus, mice transgenic for NKG2D ligands provide evidence for NK cell tolerance due to sustained engagement of an activation receptor, but the role of MHC-dependent NK cell licensing in this context is not known. The NKG2D receptor–ligand system is also complex, and further interpretations of NKG2D-induced tolerance require consideration of these complexities. Mouse NKG2D is expressed on all NK cells in two different isoforms, depending on the activation state of the NK cell, although the latter observation is somewhat controversial (Diefenbach et al., 2002; Gilfillan et al., 2002; Rabinovich et al., 2006). Mouse NKG2D can potentially interact with two different signaling molecules (DAP12 and DAP10). Association with DAP12, an ITAM-containing signaling chain, allows NKG2D to provide primary activation receptor function, similar to Ly49H. By contrast, DAP10 contains recruitment sites for phosphatidylinositol 3-kinase (PI-3K), apparently then allowing NKG2D to provide costimulatory function to other NK cell activation receptors, analogous to CD28 on T cells (Ho et al., 2002). Furthermore, mouse NKG2D has multiple endogenous ligands (Carayannopoulos et al., 2002, Cerwenka et al., 2000, Diefenbach et al., 2000). Finally, NKG2D itself is expressed on non-NK cell populations, such as T cells (Raulet, 2003).
Natural Killer Cell Tolerance
43
The contribution of endogenous NKG2D ligands, soluble NKG2D ligands, DAP12 versus DAP10 signaling chains, and non-NK cell populations require additional study. Thus, analysis of NK cell receptors other than NKG2D is required to better understand the role of activation receptors in NK cell tolerance. Of note, new data from our own group provide some evidence against the disarming theory (Tripathy et al., 2008). We studied a transgenic C57BL/6 mouse that ubiquitously expresses m157, the murine cytomegalovirus (MCMV)-encoded ligand for the Ly49H NK cell activation receptor. Unlike the NKG2D-based systems described above, m157 does not bind any other NK cell receptor in C57BL/6 mice, and Ly49H has no other known ligand (Arase et al., 2002; Smith et al., 2002). The m157 transgenic mice were more susceptible to MCMV infection and were unable to reject m157-transgenic BM, suggesting defects in Ly49Hþ NK cells (Tripathy et al., 2008). These defects could not be attributed to decreased Ly49H expression or fraction of Ly49Hþ NK cells. Interestingly, Ly49Hþ NK cells were hyporesponsive to both Ly49H-dependent and Ly49H-independent stimuli in vitro. Continuous Ly49H-m157 interaction was necessary for the functional defects. Similar results were obtained from the Lanier group using retroviral gene transduction of m157 into hematopoietic stem cells for BM reconstitution (Sun and Lanier, 2008). We further found that functional defects occurred when mature wild-type NK cells were adoptively transferred to m157-Tg mice, suggesting mature NK cells can acquire hyporesponsiveness (Tripathy et al., 2008). Thus, continuous engagement of an activation receptor results in hyporesponsiveness. Importantly, NK cell tolerance due to Ly49H-m157 interaction was similar in Ly49Hþ NK cells regardless of expression of Ly49C, an inhibitory receptor specific for a self-MHC allele in C57BL/6 mice (Kim et al., 2005; Tripathy et al., 2008). Thus, in this mouse model, NK cell licensing could not override the hyporesponsiveness caused by the constitutive m157-Ly49H activation signal. In other words, engagement of selfspecific activation receptors in vivo induces an NK cell tolerance effect that is not affected by self-MHC-specific inhibitory receptors. It is possible that the m157-Tg mice do not provide a definitive test of the disarming hypothesis because the affinity of Ly49H for m157 is too high. Licensing could have theoretically overcome the activation receptorinduced hyporesponsive state if the interactions between the activation receptor and its ligand, or between the relevant inhibitory receptor and MHC class I, were either decreased or increased, respectively. However, arguing against this possibility are recent biophysical studies indicating that the affinity of Ly49H for m157 approximates that of Ly49 receptors for MHC class I ligands (Kd ¼ 1 mM) (Adams et al., 2007). Alternatively, it is possible that the expression levels of the relevant receptors and ligands could affect avidity, or the simultaneous participation of several
44
A. Helena Jonsson and Wayne M. Yokoyama
different receptors on an individual NK cell may be relevant. Yet, the current data suggest that hyporesponsiveness induced by a self-specific activation receptor may be difficult to overcome by engagement of a selfMHC class I-specific inhibitory receptor (i.e., licensing). Thus, the data from the m157-Tg system do not support the ‘‘disarming’’ model, and hyporesponsiveness due to constitutive activation receptor signaling appears entirely separate from licensing. Clearly, more studies are needed to clarify the mechanism(s) of licensing. Experiments that distinguish the arming and disarming models will not be simple to design or execute, particularly since it is currently only possible to distinguish a licensed from an unlicensed NK cell using a functional assay. (Although licensed NK cells do express a self-MHCspecific receptor, not all such cells can be stimulated through their activation receptors (Kim et al., 2005), suggesting that not all NK cells that express a self-MHC-specific receptor are in fact licensed.) As the field searches for a conclusive result about the mechanism of licensing, we must remember to keep an open mind to new potential models and mechanisms (Yokoyama, 2008b).
4.6. Signaling events mediated by the self-MHC-specific receptor Regardless of the arming or disarming models, or models yet to come, NK licensing appears to require the ITIM of the self-MHC-specific receptor, based on gene transfer of mutant Ly49A receptors lacking the cytoplasmic domain or containing a Y-to-F mutation in the ITIM (Kim et al., 2005). However, how the ITIM mediates licensing remains unknown. The best studied molecule recruited to the ITIM is the intracellular tyrosine phosphatase, SHP-1, which is involved in signaling by inhibitory Ly49 receptors during effector responses (Long, 1999; Nakamura et al., 1997) but does not appear to be required for licensing (Kim et al., 2005). However, a role for SHP-1 cannot be formally excluded because these experiments used a hypomorphic mutant of SHP-1 (me-v). In addition, SHP-1-deficient (me) mice have pleiotropic effects including profound inflammation (Shultz, 1988) that may affect the MHC-dependent licensing status of NK cells. Furthermore, studies of mice expressing a transgene for SHP-1 lacking the catalytic domain indicated that NK cells displayed a mixed phenotype of abnormal function (Lowin-Kropf et al., 2000). They showed near-normal rejection of MHC-deficient BM but reduced reactivity against MHC-deficient tumor cells. The latter results would be unexpected if the transgenic SHP-1 was acting solely at the effector level where decreased SHP-1 activity should have led to enhanced responses. While it should be noted that these mice had significant residual SHP-1 activity as well as altered Ly49 expression profiles on
Natural Killer Cell Tolerance
45
NK cells, the transgenic SHP-1 should act as a dominant negative molecule that is recruited to the ITIM and could thereby block licensing. In this regard, it is difficult to establish in these experiments whether the putative dominant negative SHP-1 is acting on the Ly49s directly as opposed to other receptors with ITIMs. Moreover, the data do not establish that SHP-1 itself is involved in the functional effects because a putative dominant negative SHP-1 probably blocks ITIM-dependent recruitment of other signaling molecules. Regardless, the data do provide additional support for the involvement of the ITIM in licensing. There are at least three other intracellular molecules that have been reported to bind to ITIMs, including SHP-2, SHIP, and p85a of PI-3K (Marti et al., 1998; Wang et al., 2002b; Yusa and Campbell, 2003). SHP-2 knockout mice have not been examined in licensing because they are embryonic lethal before hematopoiesis occurs (Qu et al., 2001). Preliminary studies of knockout mice by our group suggest that neither SHIP nor p85a of PI-3K is involved in licensing (Kim et al., 2005). Other published studies found that SHIP/ NK cells do or do not reject b2m/ BM depending on the genetic background of the knockout mouse (Wang et al., 2002a; Wahle et al., 2006). Thus, it has been challenging to further decipher the role of the ITIM in licensing by using mice deficient in molecules known to bind the ITIM. Another point to consider about the role of the ITIM in licensing is that its function has been historically defined in terms of effector inhibition. However, it is possible that the ITIM may exert a ‘‘positive’’ effect on cellular processes. Notably, a recent study indicates that SHP-1 can lead to net positive functions of an immune cell: SHP-1 increases type I IFN production and decreases proinflammatory cytokine secretion in dendritic cells (DCs) in response to Toll-like receptor (TLR)-3 or -4 stimulation (An et al., 2008). Curiously, the phosphatase domain of SHP-1 does not seem to be necessary for this effect. These findings suggest that categorizing receptors and signaling molecules as ‘‘inhibitory’’ or ‘‘activating’’ may not reflect the true complexity of their biology. Interestingly, another recent study indicates that unengaged inhibitory KIRs can enhance the signal of another receptor, such as the T cell receptor on CD4þ T cells (Fourmentraux-Neves et al., 2008). Unengaged KIRs enhanced T cell responses and recruited SHP-2 but not SHP-1, and also induced phosphorylation of PKCy, whereas KIRs bound to cognate HLA ligand inhibited T cell responses and recruited both SHP-1 and SHP-2. Notably, SHP-2 can be a positive regulator of the ERK pathway (Agazie and Hayman, 2003; Zhang et al., 2004). Thus, KIRs may induce different, and potentially opposing, signal transduction pathways based upon their ligand binding status. Another caveat to the role of the ITIM is that the ITIM-recruited molecule itself might not signal the licensing event. This notion is
46
A. Helena Jonsson and Wayne M. Yokoyama
suggested by recently presented studies from Eric Long’s group (American Association of Immunologists annual meeting, San Diego, CA, April, 2008). They have uncovered evidence of a macromolecular signaling complex associated with effector inhibition by KIRs. These studies also provide a potential explanation for the enhanced TLR responses by SHP-1, for which SHP-1 phosphatase activity was not required (An et al., 2008), suggesting that SHP-1 may have another function, such as acting as a scaffold for other signaling molecules. Moreover, a recent report suggests that b-arrestin 2 recruits SHP-1 and SHP-2 to the phosphorylated KIR ITIM (Yu et al., 2008). Thus, ITIM-dependent signaling may be much more complicated because licensing events may differ from effector inhibition by the nature of such macromolecular complexes. Taken together, emerging data suggest the possibilities that ITIMs could function to either ‘‘activate’’ or inhibit signaling pathways, potentially by differential direct recruitment of molecules (e.g., SHP-1 versus SHP-2), or different macromolecular signaling complexes. These are just a few models for which there are some available data. Perhaps other models will arise as more information becomes available on whether these possibilities are related to licensing.
4.7. Where, when, and with whom does licensing occur? NK cell licensing dictates that there must be a physical interaction between inhibitory NK receptors and MHC class I to produce a functional NK cell. The details of when, where, and with the assistance of what (if any) accessory cell this occurs remain a mystery. Several pieces of circumstantial evidence suggest that NK cell licensing might take place during maturation in the BM, where complete NK cell development is assumed to occur. First, inhibitory receptors are expressed relatively early in NK cell development (Kim et al., 2002; Yokoyama et al., 2004), and their expression coincides with the acquisition of functional capabilities (Dorfman and Raulet, 1998; Grzywacz et al., 2006). Second, in ontogeny, these inhibitory receptors appear to be acquired sequentially in an MHCdependent manner, meaning that an NK cell that can engage self-MHC is less likely to express additional inhibitory receptors than an NK cell that cannot (yet) engage self-MHC (Dorfman and Raulet, 1998; Held et al., 1996; Roth et al., 2000; Salcedo et al., 1997; Yu et al., 2007). Finally, in vivo studies demonstrate that BM NK cells undergo proliferation before reaching full developmental maturity (Kim et al., 2002). NK cells that have selfMHC-specific receptors proliferate at a higher rate than NK cells that lacking such receptors (Kim et al., 2005). Thus, licensing likely occurs during development in the BM. Is there a particular cell type that must display MHC class I to NK cells for the purpose of licensing? Current data would suggest that there is no
Natural Killer Cell Tolerance
47
single cell type responsible for licensing of NK cells. Fetal liver and BM chimera experiments have shown that both hematopoietic and nonhematopoietic compartments play a role (Ioannidis et al., 2001; Wu and Raulet, 1997). Also, transgenic expression of H2Dd in liver, testis, and intestine, with very low expression levels in thymus, spleen, and kidney, did not induce NK cell licensing, thereby ruling out an exclusive role for at least the first three organs in NK cell licensing (Johansson et al., 2000). In vitro developmental studies suggest that a stromal cell is required for expression of the Ly49 receptors, apparently in an MHC-dependent manner (Roth et al., 2000; Williams et al., 2000). Furthermore, interaction of Tyro3 receptor tyrosine kinases on the NK cell with Tyro3 ligands on BM stromal cells (Caraux et al., 2006) is required for NK cell development in vitro and in vivo. Therefore, licensing most likely occurs concurrently with NK cell development in the BM and requires stromal elements, although conclusive data on licensing per se are lacking and recent studies have indicated that a subset of NK cells can also mature elsewhere, such as the thymus (see below). Moreover, it is possible that the MHC-specific receptor interacts with self-MHC on the NK cell itself.
4.8. Cis versus trans interactions of Ly49 and other receptors Recently, the Ly49 receptors were found to have a curious characteristic: They are able to engage their MHC ligand in cis, where Ly49 and MHC class I are expressed on the same cell (Doucey et al., 2004). While this was initially surprising, perhaps it should not have been unexpected since NK cells constitutively express MHC class I molecules. Cis engagement of a Ly49 receptor with its cognate MHC class I ligand can partially block detection of Ly49 by some monoclonal antibodies and markedly inhibit cognate MHC class I tetramer binding, thereby making surface expression levels appear artificially lower as compared to NK cells from mice lacking the cognate MHC ligand (Fig. 2.2A). Accordingly, a brief incubation in acid buffer, which denatures MHC class I molecules, restored antibodyand tetramer-detected Ly49 molecules to levels seen with NK cells lacking the MHC class I ligand in cis (Doucey et al., 2004). Importantly, as the cis and trans binding sites of Ly49 receptors are the same (‘‘site 2’’; Tormo et al., 1999; Matsumoto et al., 2001; Wang et al., 2002a), cis engagement by Ly49 prevents the receptor from interacting with MHC class I in trans (Doucey et al., 2004). Indeed, a recent study has shown that cis interactions of Ly49 with MHC class I are stable and not displaced by MHC class I presented in trans (Back et al., 2007). Curiously, cis interactions of Ly49 with MHC class I molecules reduce the ability of NK cells to receive inhibitory signals from target cells. NK cells that expressed both Ly49A and its cognate ligand H2Dd were able to kill H2Dd-expressing tumor cells whereas Ly49Aþ NK cells lacking H2Dd, and therefore lacking cis
48
A. Helena Jonsson and Wayne M. Yokoyama
FIGURE 2.2 Functional properties of cis versus trans engagement of Ly49 and MHC class I. (A) Cis engagement of Ly49 receptors and MHC class I blocks binding by certain anti-Ly49 monoclonal antibodies (left), thereby giving the appearance of lower Ly49 surface expression than on NK cells that lack an MHC ligand (right). (B) MHC class I molecules expressed by target cells engage cognate Ly49 receptors on NK cells and thus inhibit NK cell activation. Cis interactions between Ly49 receptors and MHC class I molecules on the NK cell prevent the Ly49 receptors from engaging target cell ligands in trans, thereby reducing the NK cell’s ability to receive inhibitory signals. An NK cell with Ly49 receptors engaged in cis (top) is thus more potent at killing target cells that express the cognate MHC ligand than an NK cell whose Ly49 receptors are not engaged in cis (bottom). Consequently, NK cells with Ly49 receptors engaged in cis are more sensitive to partial reductions in class I expression by target cells. (C) Cis interactions may play a role in NK licensing. In the ‘‘arming’’ model (left), cis interactions between Ly49 and MHC class I may be able to induce the signal necessary for licensing. Under the ‘‘disarming’’ model (right), cis interactions between Ly49 and MHC class I may be able to ameliorate constitutive stimulation to produce a licensed NK cell. However, it should be noted that there is as yet no evidence that Ly49 receptors engaged in cis are able to transduce signals. (D) NK cells can acquire MHC class I molecules from other cells. NK cells must express a Ly49 receptor specific for the MHC class I molecule in order for MHC class I transfer to occur. As noted in the text, this MHC class I transfer could potentially lead to licensing of the NK cell; thus, this phenomenon may play an important role in MHC class I chimera and mosaic studies.
interactions, were inhibited from killing (Fig. 2.2B) (Doucey et al., 2004). This finding is difficult to understand in the context of missing-self alone and will be discussed further below.
Natural Killer Cell Tolerance
49
Structural studies by the Mariuzza and Margulies groups suggest that the homodimeric Ly49 receptors have two conformations, termed open and closed (Dam et al., 2006; Deng and Mariuzza, 2006). The open conformation, seen in the Ly49C crystal structure (Dam et al., 2003), is symmetric and can bind two MHC class I molecules. The closed conformation, seen in the Ly49A crystal structure (Tormo et al., 1999), is asymmetric and can bind only one MHC class I molecule. NMR studies have shown that Ly49 molecules can shift from one conformation to the other, suggesting that the closed state mediates cis interactions while the open state mediates trans interactions and that the engagement of one versus two MHC class I molecules could thereby have consequences for signaling (Dam et al., 2006). This hypothesis has not yet been tested experimentally. There has been some debate regarding the roles of cis engagement and true decrease in Ly49 receptor surface expression in producing the observed downregulation of receptors detectable by flow cytometry. Andersson et al. reported that acid treatment of NK cells restores Ly49A expression to 43% of levels on NK cells lacking cis ligand, and they ascribe the remaining 57% decrease to true downregulation of surface expression (Andersson et al., 2007). This is in contrast to data presented by Doucey et al. which showed almost complete recovery of Ly49 levels with acid treatment (Doucey et al., 2004). Notably, in similar experiments, we have found that cis engagement between Ly49 and MHC class I protects the MHC class I molecule from denaturation (AHJ and WMY, unpublished observations). The extent of cis binding may, therefore, be underestimated in calculations based on the acid stripping technique. Nonetheless, it is possible that mechanisms in addition to cis engagements may induce the downregulation of surface Ly49 receptors. Further studies are required to discover the details of these potential alternate mechanisms. Interestingly, other cis interactions of NK cell receptors have also been reported. Siglec-7 is an inhibitory sialic acid receptor expressed by human NK cells. Siglec-7 is normally masked on NK cell surfaces due to cis engagement with a2,8-linked disialic acids, its relatively uncommon preferred ligand (Nicoll et al., 2003). Recent studies have demonstrated that NK cells, but not B or T cells, express the enzymes necessary to produce these carbohydrate ligands and express them on their surface (Avril et al., 2006). Only after digestion of disialic acids is Siglec-7 on NK cells able to mediate signaling (Nicoll et al., 2003). Cis interactions have also been documented to occur between other, non-NK cell receptors, and their cognate ligands (reviewed in Held and Mariuzza, 2008). For example, the Ig-like receptor PIR-B on mast cells can interact in cis with its ligand, MHC class I (Masuda et al., 2007). Interestingly, unlike the Ly49 receptors, PIR-B engaged in cis inhibits mast cell function, since b2m-deficient mast cells are hyperresponsive. This is in contrast to b2m-deficient NK cells, which are hyporesponsive (Kim et al., 2005).
50
A. Helena Jonsson and Wayne M. Yokoyama
Notably, phosphorylated SHP-1 is associated with PIR-B when PIR-B is engaged in cis interactions (Masuda et al., 2007), indicating that it delivers inhibitory signals in this situation, unlike the inhibitory NK cell receptors. Another receptor documented to interact in cis is CD22 (Siglec-2) on B cells. Constitutive cis engagement of CD22 with the BCR increases the B cell activation threshold (Razi and Varki, 1998). In the absence of CD22, B cell activation is enhanced (O’Keefe et al., 1996). Thus, while there are other inhibitory receptors that can engage their ligands in cis, the functional effect appears to be ‘‘tonic inhibition,’’ apparently opposite the effect seen with NK cell receptors (Held and Mariuzza, 2008; Masuda et al., 2007; O’Keefe et al., 1996).
4.9. Cis engagements of Ly49 receptors: A role in NK cell licensing? How does cis engagement affect NK cell function? Cis engagement does not appear to cause tonic inhibition in NK cells, as unpublished data from the Held group indicates that cis engagement of Ly49A does not lead to ITIM phosphorylation (Held and Mariuzza, 2008). However, this observation is not conclusive because ITIM phosphorylation of Ly49A has not been demonstrated even following trans engagement of Ly49A (Nakamura et al., 1997). Regardless, a recent review proposes an alternative mechanism, involving receptor accessibility to the NK immunological synapse (Held and Mariuzza, 2008). Specifically, Held and Mariuzza postulate that cis engagement prevents efficient recruitment of Ly49A to the NK synapse. With reduced numbers of Ly49A receptors available to engage H2Dd on target cells (i.e., in trans), the NK cell is more resistant to inhibition by trans MHC. This model explains their earlier observation that NK cells with cis interactions are better able to kill target cells expressing the MHC allele than NK cells without the cis interaction (Doucey et al., 2004). Indeed, cis engagement can account for the Ly49 expression patterns observed in the earlier ‘‘receptor calibration’’ studies described above. While the true surface expression levels were not reduced, the amount of accessible surface Ly49 is lower on NK cells that coexpress self-MHC, giving the appearance of reduced protein levels (Fig. 2.2A). In light of the new data on cis engagements, this model might thus be better termed the ‘‘receptor sequestration’’ model, where cis binding, instead of an actual decrease in expression, modulates sensitivity to inhibition by self-MHC (Held and Mariuzza, 2008). However, despite this reformulation of the receptor calibration model, it still fails to explain why MHC class I-deficient NK cells cannot kill MHC class I-deficient cells or respond poorly to plate-bound antibody stimulation through the activation receptors.
Natural Killer Cell Tolerance
51
It is conceivable that cis interactions of Ly49 and MHC class I molecules can directly induce NK licensing (Fig. 2.2C). Studies to date have not determined whether the licensing interaction of Ly49 with cognate MHC takes place in cis or in trans, or both. A cis mechanism would require Ly49 engaged in cis to be able to transmit an ITIM-dependent signal, which has not yet been demonstrated. It is possible that cis interactions act in concert with trans interactions in licensing. Perhaps the sum total of both types of interactions contributes to the self-MHC receptor stimulation required for licensing to occur. This model would be consistent with the concept of signal strength due to receptor affinities or avidities for their ligands as discussed above. Finally, it is possible that cis versus trans interactions could differentially recruit SHP-2 or other intracellular signaling molecules, as suggested by recent studies (Fourmentraux-Neves et al., 2008). There is no evidence to date that the human KIRs can engage MHC class I molecules in cis. The question therefore arises of why cis engagement is such a prominent feature of Ly49 receptors when it is absent among their functional orthologs, the inhibitory KIRs. A recent study by Back et al. may provide some answers (Back et al., 2007). The authors find that trans engagement of Ly49 with MHC class I enhances adhesion between the two interacting cells. In contrast, KIR–HLA binding does not enhance adhesion (Burshtyn et al., 2000; Faure et al., 2003; Kaufman et al., 1995). Back et al. postulate that the purpose of cis interactions is to prevent NK cells from attaching too tightly to normal cells since this could impede efficient NK cell surveillance of normal tissues (Back et al., 2007). Since KIRs do not affect adhesion, they do not require HLA blockade in cis for optimal NK cell function. Interestingly, this theory implies that the sole purpose of receptor calibration is to modulate adhesion in favor of interactions with missing-self cells, not to maintain self-tolerance. Clearly, much more work needs to be done in order to fully understand the role of cis interactions in NK cell licensing.
4.10. Transfer of MHC class I molecules to the NK cell membrane Inhibitory Ly49 receptors can transfer (steal) MHC class I molecules from other cells onto their own cell membrane (Fig. 2.2D; Sjostrom et al., 2001; Zimmer et al., 2001). In fact, receptor transfer is a relatively common occurrence for immune cells (Davis, 2007). Ly49-mediated transfer happens within 20 min and occurs only for specific MHC ligands of the inhibitory receptor. Expression of cognate self-MHC ligands on the NK cell in cis blocks MHC class I transfer by Ly49 receptors on that cell (Zimmer et al., 2001). Levels of MHC class I can reach as high as 20% of levels found on the donor cells and leads to a concomitant reduction in accessible surface Ly49, implying that the Ly49 receptor then becomes
52
A. Helena Jonsson and Wayne M. Yokoyama
engaged in cis (Sjostrom et al., 2001). The functional outcomes of MHC class I transfer with regard to licensing are not clearly understood, but this phenomenon may be relevant to other experiments where such transfer may have occurred. Early experiments on the effect of chimeric MHC class I expression on Ly49 expression levels should be reevaluated as NK cells may have acquired MHC class I molecules from both hematopoietic and nonhematopoietic cells (Sykes et al., 1993). MHC class I transfer appears to occur more readily from hematopoietic cells, perhaps reflecting an increased frequency of interaction or expression of other factors (e.g., adhesion molecules) that enhance MHC class I transfer. Notably, culture in IL-2 overnight led to a loss of acquired MHC class I molecules (Sjostrom et al., 2001). A rat NK cell line transfected with Ly49A and preincubated with a H2Dd-expressing cell line (to allow transfer of H2Dd) showed reduced killing of a NK susceptible cell line, indicating that MHC class I transfer may indeed have functional consequences (Sjostrom et al., 2001). Curiously, these results are the direct opposite of data reported by Doucey et al., where coexpression of Ly49A and H2Dd on the same NK cell actually improved cytotoxicity against tumor cells (Doucey et al., 2004). However, there are two potentially important differences between these experiments. The experiment performed by Sjostrom et al. made use of RNK cell line transfectants, which may behave quite differently in terms of self-tolerance than IL-2-stimulated primary NK cells. Conversely, Doucey et al. used a genetic system in which NK cells developed in a Ly49A transgenic environment with H2Dd in which the Ly49Aþ NK cells were licensed by Dd. Regardless, cis interactions and MHC class I transfer may affect the licensing process. As yet, transfer of classical HLA class I molecules has not been observed for human NK cells. However, it has recently been found that human NK cells can acquire HLA-G from tumor cells (Caumartin et al., 2007). Interestingly, this transfer induces NK cells to lose their cytotoxic potential and instead adopt a suppressive phenotype. Moreover, NKG2Ddependent transfer of MICA from target cells onto NK cells leads to a reduction in NKG2D-dependent cytotoxicity, an interesting contrast to the functional outcomes of cis interactions of the NK cell inhibitory receptors with MHC class I (Held and Mariuzza, 2008; McCann et al., 2007; RodaNavarro et al., 2006). Thus, the role of cis interactions on NK and other immune effector functions requires further clarification.
4.11. Self-tolerance of functional NK cell subsets In recent years, an increasing number of more or less distinct NK cell functional subsets has been described. Perhaps the best established is the division of human NK cells into CD56dim and CD56bright populations (reviewed in Farag and Caligiuri, 2006). The CD56dim subset represents
Natural Killer Cell Tolerance
53
the majority (90%) of peripheral blood NK cells. These cells express high levels of KIRs and CD16 and have pronounced cytotoxic activity. CD56bright NK cells constitute 75–90% of NK cells in lymph nodes and 50% of NK cells in the spleen (Ferlazzo et al., 2002). They lack KIRs but express CD94/NKG2A and specialize in producing immunoregulatory cytokines (Cooper et al., 2001; Farag and Caligiuri, 2006). With such different receptor expression and effector function profiles, these subsets may have different mechanisms to maintain self-tolerance. Moreover, cytotoxic effector functions of NK cells target single cells in direct contact whereas cytokine production may have more wide-ranging, systemic effects, raising the additional possibility that there could be tolerance mechanisms specifically tailored to each effector function, regardless of NK cell subtype. Single-cell analysis of cytokine production and cytotoxicity indicates that while some NK cells are both cytotoxic and cytokine producers, most NK cells perform one or the other effector function (Anfossi et al., 2006). The signaling mechanisms driving cytokine production versus cytotoxicity are at least partially distinct (e.g., Malarkannan et al., 2007), providing a molecular opportunity for separate tolerance mechanisms. The lack of inhibitory KIRs on CD56bright NK cells is especially intriguing. Clearly these cells are potent cytokine producers despite being unable to undergo conventional NK cell licensing, suggesting other mechanisms guard against autoreactivity of these cells. Interestingly, CD56bright NK cells may develop outside the BM, in either lymph nodes or the thymus (Farag and Caligiuri, 2006), areas that could shape their self-tolerance. On the other hand, recent studies have demonstrated that CD56bright NK cells can differentiate into CD56dim NK cells in vitro and in vivo (Chan et al., 2007; Cooley et al., 2007). This could affect their selftolerance mechanisms, including NK cell licensing, because the NK cell would then upregulate inhibitory KIRs for the (presumably) first time. Recent studies in mice have identified a thymus-dependent NK cell subset that shares several features with human CD56bright NK cells (Vosshenrich et al., 2006). Like CD56bright NK cells, murine thymic NK cells do not express CD16 or inhibitory Ly49s, but they express abundant CD94 and CD127 (IL-7Ra). These cells exhibit potent cytokine production but poor cytotoxic activity upon stimulation, like their proposed human counterparts. However, how these cells maintain self-tolerance is as yet a mystery.
5. NK CELL TOLERANCE IN MHC CLASS I CHIMERIC AND MOSAIC MICE In this section, we will discuss several older studies of NK cell tolerance in MHC class I chimeric and mosaic mice which have been interpreted as supporting the disarming hypothesis. However, other interpretations are now possible in light of the more recent findings described above.
54
A. Helena Jonsson and Wayne M. Yokoyama
5.1. Studies of MHC class I chimeric and mosaic mice One of the most intriguing, but also most difficult to interpret, studies used fetal liver chimeras to address questions of NK cell tolerance to self-MHC (Wu and Raulet, 1997). This study aimed to test the influence of a limited number of MHC-deficient cells on the activity of the NK cell population as a whole, as measured by the ability to reject b2m/ BM in vivo. In these experiments, wild-type or b2m/ fetal liver cells, or a mixture of both, were used to reconstitute lethally irradiated MHC-sufficient (wild-type B6) or -deficient (b2m/) mice. Chimeras with b2m/ hematopoietic cells and wild-type host cells (i.e., b2m/ ! B6) partially rejected MHC class I-deficient BM, indicating that the MHC-deficient NK cells were more functionally competent than their MHC-deficient counterparts from b2m/ ! b2m/ mice. In other words, MHC I-deficient NK cells that mature in an environment where MHC class I molecules are present on peripheral cells are able to acquire some, but not all, of the functional competency of fully licensed NK cells. Interestingly, rejection of b2m/ fetal liver cells was more robust than rejection of b2m/ BM, perhaps reflecting differences in expression of activation ligands. A separate but similar study examined b2m/ ! B6 BM chimeras and the ability of in vivo tilorone-treated NK cells to kill b2m/ Con A blasts and YAC-1 tumor cells in vitro (Hoglund et al., 1991). In these experiments, the b2m/ ! B6 NK cells did not kill b2m/ blasts but retained near-normal reactivity to YAC-1 cells. The slight discrepancy in results between these studies may be explained by the use of in vivo versus in vitro cytotoxicity assays and the difference in NK cell priming protocols (tilorone treatment versus irradiation). Results are also available from mixed fetal liver chimeras. When a mixture of b2m/ and B6 (b2mþ/þ) fetal liver cells was used to reconstitute b2m/ mice (mix ! b2m/), there was no rejection of a subsequent b2m/ BM challenge (Wu and Raulet, 1997). The results were similar to the B6 ! b2m/ situation. In contrast, when MHC-sufficient mice were reconstituted with the same mixture of fetal liver cells (mix ! B6), the resulting NK cells were capable of some rejection of b2m/ BM, although the degree of rejection was apparently variable from experiment to experiment. This mixed fetal liver chimera (mix ! B6) would be expected to behave roughly like the b2m/ ! B6 mice, though with somewhat improved NK cell function due to the presence of b2mþ/þ NK cells. The observed variability may be due to the dose of b2m/ BM: NK cell rejection of BM can be overcome by administration of a BM dose that overwhelms the responding NK cell population (Oberg et al., 2004). In this mixed fetal liver chimera, there were only half as many b2mþ/þ NK cells as in a wild-type mouse, yet the challenge dose was the same. Titrations of the dose of BM may therefore be informative regarding the self-tolerance of these mice.
Natural Killer Cell Tolerance
55
Tolerance to endogenous missing self was also observed in a more recent study of B6 (H2b) mice reconstituted with BALB/c (H2d) BM (Zhao et al., 2003). These mice, which had NK cells with the H2d haplotype, were unable to reject B6 BM or control the growth of RMA (H2b) tumor cells despite being able to efficiently reject b2m/ BM. Interestingly, daily administration of 50,000 units of IL-2 for 3 days prior to BM challenge did not break this tolerance to B6 BM. These results are consistent with the B6 ! b2m/ fetal liver chimera data described above. Other groups have used mice with mosaic MHC class I expression. The DL6-transgenic mouse line expresses a fusion protein composed of the a1 and a2 domains of H2Dd and the a3 domain of H2Ld in a mosaic fashion on 10%–80% of splenocytes, including the NK cell compartment (Johansson et al., 1997). DL6 mice are tolerant to both B6 BM (i.e., lacking H2Dd) and H2Dd-transgenic BM, although they can reject b2m/ BM with normal kinetics. Similar results were obtained in two H2Dd-mosaic mouse models created using Cre-lox systems (Ioannidis et al., 2001). However, administration of type I interferon inducers or estrogen receptor antagonists were required to induce mosaicism, and these agents may affect licensing. Notably, tolerance to H2Dd-deficient cells was also observed in vitro, but this tolerance of DL6 NK cells to B6 lymphoblasts was reversed by separating H2Ddþ and H2Dd NK cells for 24 h after incubation together (or apart) in IL-2 for 4 days. This result suggests that continuous exposure to tolerizing cells is needed to maintain tolerance. However, it is possible that MHC class I molecules were transferred to NK cells in vivo and were subsequently lost during 24 h of culture in IL-2 (Sjostrom et al., 2001). Also, it is important to note that IL-2 stimulation can greatly affect NK cell function (Fernandez et al., 2005; Kim et al., 2005). Thus, there may be other effects on NK cells from mosaic MHC class I mice that confound interpretations of these experiments. To investigate whether even very low frequencies of cells lacking a particular MHC class I molecule can induce NK cell tolerance, mixed BM chimeras were made in which less than 20% of the infused BM cells were from B6 mice and the rest from H2Dd-transgenic B6 mice (Johansson and Hoglund, 2004). The resulting mice therefore had only a very small population that lacks H2Dd. The low frequency H2Dd-negative BM chimeras exhibited intermediate reactivity in assays of in vivo rejection of H2Dd-negative tumor cells and in vitro killing of ConA blasts. However, the NK cells were unable to kill normal B6 cells, since the fraction of B6 hematopoietic cells remained constant over time. The results of these experiments agree with the earlier mosaic H2Dd transgene studies, but make especially clear the extreme sensitivity of NK cell tolerance. Overall, the currently available data from the fetal liver and BM chimeric mice do not provide conclusive evidence with regard to resolving the arming versus disarming hypotheses because of several
56
A. Helena Jonsson and Wayne M. Yokoyama
caveats in the experiments. In addition, other interpretations are possible in view of other recent developments.
5.2. New interpretations of tolerance in MHC chimeric and mosaic mice Some have applied the data from these experiments as tests of the arming and disarming theories and concluded that the data unequivocally support the disarming hypothesis because the presence of H2Dd-deficient cells dominantly induces tolerance of NK cells (Raulet, 2006). Indeed, the arming and disarming models do appear to predict different outcomes. The arming theory predicts that b2m/ NK cells will become licensed by interacting with MHC-sufficient host cells. The disarming theory predicts that NK cell interaction with MHC-deficient cells would lead to an unlicensed phenotype. However, many of the observed effects were intermediate and could be interpreted as being either acquisition of functional competence or failure to acquire competence. Moreover, both of these predictions assume that (1) all cell types are equally capable of inducing licensing of NK cells and (2) licensing interactions must occur in trans. Neither of these assumptions is based on experimental evidence. The rejection of these assumptions opens up new potential explanations. For the arming hypothesis, it is possible that only certain cell types are able to deliver the arming signal because of the need for secondary factors, such as adhesion molecules, to correctly arm the NK cell. Radio-resistant cells may thus be poor inducers of licensing and hence lead to only weak licensing of the NK cells. Alternatively, cis binding could be necessary but insufficient for licensing. It is also possible that the MHC class I-deficient NK cell may acquire MHC molecules from other cells and thereby become licensed in cis. The observed partial phenotype in mixed BM chimeras (Wu and Raulet, 1997) may thus be caused by weak induction of licensing either because cis interactions are unable to induce full licensing, regardless of MHC class I levels (see below), or because the low levels of transferred MHC class I molecules (Sjostrom et al., 2001) are insufficient to reach the threshold required for complete licensing. Thus, the arming hypothesis cannot be discounted. Under the disarming theory, NK cell interactions with both MHCsufficient and -deficient cells result in a failure to achieve full functional competence because the cumulative net excess of activation receptor signals results in tolerance that cannot be overcome by the self-MHCspecific inhibitory receptor. Implicit in this postulate is that activation receptor-induced tolerance should dominate the phenotype; however, only a partial phenotype was observed. When b2m/ mice were reconstituted with wild-type fetal liver cells (i.e., B6 ! b2m/), the resulting b2mþ/þ NK cells were only partially able to reject b2m/ BM (Wu and
Natural Killer Cell Tolerance
57
Raulet, 1997). While these results are still formally consistent with the disarming theory, the data may alternatively indicate that cell-intrinsic MHC class I expression is insufficient for NK cell licensing. That is, cis interactions of Ly49 receptors with MHC class I molecules may not be enough to induce licensing. A radio-resistant cell type therefore appears to be necessary, yet only leads to a partial restoration of licensing. Thus, the chimeric data are consistent with other possible interpretations and do not necessarily support only the disarming hypothesis. As with experiments using fetal liver and BM chimeras, the results obtained from MHC class I mosaic mice must also be considered in light of cis interactions which could influence licensing. Moreover, MHC class I transfer needs to be considered. Ly49Aþ H2Dd NK cells in BM chimeric or mosaic mice could have received H2Dd from other cells onto their own membrane. Indeed, NK cells stained positive for H2Dd expression at a higher frequency than other hematopoietic cells (Johansson et al., 1997). Such transfer onto NK cells could have functional consequences. Until the functional implications of cis interactions between Ly49 and its MHC class I ligand are fully established, it may be difficult to explain the results of the BM chimeric or mosaic MHC mice.
6. OTHER SAFEGUARDS OF NK CELL TOLERANCE TO SELF Beyond NK cell licensing, NK cells have a number of safeguards against autoreactivity. These mechanisms may help explain how NK cells maintain self-tolerance despite the heterogeneous expression of inhibitory and activating ligands on cells throughout the body.
6.1. Cytokine stimulation enhances NK cell potency A well-studied safeguard is that of cytokine stimulation of NK cells (Fig. 2.3A). Unstimulated naı¨ve NK cells are much less potent killers and cytokine producers than NK cells cultured in vitro in high-dose IL-2 (Grimm et al., 1982). (These activated NK cells constitute the majority of cells derived from human peripheral blood or mouse spleen that were initially called lymphokine-activated killer cells (LAKs). A sizeable fraction includes activated T cells, if not purified or derived from scid or RAG-deficient mice (Yokoyama, 2008a).) One explanation for this phenomenon is that resting NK cells lack granzyme B and perforin, two essential components of cytotoxic granules (Fehniger et al., 2007). These proteins are rapidly translated from preexisting mRNA pools upon in vitro cytokine stimulation. Similar effects are observed upon in vivo poly(I:C) treatment or viral infection. Moreover, cytokine stimulation also increases expression of activation receptors, such as NKG2D and CD69 (Dann et al., 2005; Karlhofer and
58
A. Helena Jonsson and Wayne M. Yokoyama
FIGURE 2.3 Other safeguards of NK cell tolerance. (A) Cytokines such as IL-2 and IFNa/b can prime naı¨ve NK cells to become more potent effector cells. (B) Non-MHC-specific inhibitory receptors such as Nkrp1d provide another system for recognizing self, independent of MHC class I inhibition and NK cell licensing. (C) NK cells must receive stimuli through at least two separate activation receptors, such as NK1.1 and Ly49D, in order to become activated. (D) In in vivo models of infection, accessory cells are necessary for optimal NK cell responses. One mechanism for this effect is trans-presentation of IL-15 by dendritic cells to NK cells. (E) Some cells have a suppressive effect on NK cell function. For example, regulatory T cells express membrane-bound TGFb that decreases cytotoxicity of NK cells.
Yokoyama, 1991; North et al., 2007; Zhang et al., 2008a,b), which may augment subsequent activation. Notably, cytokine treatment of NK cells can partially overcome the hyporesponsive state of unlicensed NK cells (Fernandez et al., 2005; Kim et al., 2005). This observation may explain why b2m/ mice, which have uniformly unlicensed NK cells, are able to fight off MCMV infection as well as wild-type mice (Tay et al., 1995), because even in wild-type mice, NK cells are nonspecifically activated (Dokun et al., 2001). For example, during the first days following MCMV infection, NK cells can produce cytokines and proliferate, regardless of whether they express the Ly49H activation receptor responsible for specific recognition of infected cells (Dokun et al., 2001; Yokoyama et al., 2004). Only later on, apparently due
Natural Killer Cell Tolerance
59
to decreased cytokine levels, do Ly49Hþ NK cell populations have a survival advantage (French et al., 2006). The early effect is not virusspecific since vaccinia virus and LCMV also induce nonspecific NK cell effects, such as proliferation and enhanced cytotoxicity, even of b2m/ NK cells (Dokun et al., 2001, Tay et al., 1995). Similarly, both licensed and unlicensed cells produce IFNg at equal frequencies in response to in vivo infection with Listeria monocytogenes (Fernandez et al., 2005). During infections, a plethora of cytokines, such as type I interferons and IL-15, is often produced that can stimulate NK cells (Biron et al., 1999). Moreover, in MCMV infection, NK cells are not effective if the host lacks type I interferons or TLR9, or its signaling chain, MyD88, even if the NK cells express the Ly49H activation receptor that is responsible for genetic resistance to MCMV (Krug et al., 2004). In certain bacterial infections, recent studies reveal a special role for IL-15 presented in trans by DCs, which can ‘‘prime’’ NK cells to become more potent effector cells (Lucas et al., 2007). This priming requires type I interferons and is necessary for effective NK cell effector responses during infection with Listeria. Thus, NK cell stimulation by cytokines occurs during infection and is required for efficient NK cell effector responses. These observations support the concept that unlicensed NK cells may be stimulated during the course of an infection to become functionally competent in an MHC-independent manner. Although this may break tolerance conferred by MHC-dependent licensing, and thus possibly allow the activated NK cell to display activity against MHC-expressing cells, perhaps this may not be detrimental in the disease state. At least in part, the MHC-independent activation appears to require cell contact with DCs that should serve to provide NK cell activation only in the diseased microenvironment. In this pathological situation, perhaps destruction of a small number of normal cells is preferable to the hyporesponsiveness of unlicensed NK cells that do not assist in host defense.
6.2. Non-MHC-specific inhibitory receptors A large number of inhibitory receptors have been discovered on NK and other cells, often by virtue of gene discovery approaches that have identified cytoplasmic ITIMs. While many of these molecules remain orphan receptors because their ligands are unknown, invariably the presence of a consensus ITIM confers inhibitory function when tested in assays for effector functions triggered by activation receptors (Fig. 2.3B). Ligands for several of these putative inhibitory receptors have been characterized, and surprisingly, a number are not related to MHC molecules (for recent review, see Kumar and McNerney, 2005). For example, Nkrp1d is a C-type lectin-like receptor encoded in the NKC. It is expressed on all NK cells and recognizes another C-type lectin-like
60
A. Helena Jonsson and Wayne M. Yokoyama
molecule, Clrb, that is encoded by a neighboring gene in the NKC (Carlyle et al., 2004; Iizuka et al., 2003; Plougastel et al., 2001). Interestingly, there is evidence for recombinational suppression within this region of the NKC, suggesting genetic protection to keep the pair together during evolution. These features appear related to self-incompatibility loci in plants, which are involved in preventing self-fertilization, in essence a form of selfrecognition (Nasrallah, 2002). The plant loci encode a ligand expressed on pollen that binds a receptor on the pistil. When interaction occurs, fertilization is inhibited. Thus, while the Nkrp1d-Clrb interaction may represent another genetic example of self-recognition, its role and indeed the role of other non-MHC-specific inhibitory NK cell receptors, such as gp49, 2B4, Klrg1, CEACAM1, LAIR-1, and Siglecs (Yokoyama, 2008a), in NK cell tolerance are incompletely understood.
6.3. Activation receptor cooperation and synergy Another safeguard for NK cell tolerance is the apparent requirement for target cell engagement of multiple activation receptors for full NK cell stimulation (Fig. 2.3C). In this manner, NK cells are activated only in response to multiple stimuli presented simultaneously, which may be important since activation receptor ligands may be constitutively expressed on certain cell types. For example, studies of murine NK cells have shown that antibody cross-linking of several individual activation receptors, associated with each ITAM-containing signaling chain on NK cells (DAP12, FceRIg, CD3z), cannot stimulate NK cell effector responses without concomitant cross-linking of NKG2D (Ho et al., 2002). This may be akin to CD28 costimulation of the TCR, probably as a result of recruitment of PI-3-kinase by both CD28 and NKG2D (by virtue of DAP10). On human NK cells, the only receptor able to activate NK cells on its own is CD16 (FcgRIII) (Bryceson et al., 2006a,b). The ability of CD16 in particular to activate NK cells without additional stimulation is especially interesting with regard to tolerance: CD16 binds ligand via soluble IgG antibody, and the production of antigen-specific IgG requires a previously activated B and T cell response, both of which are governed by multiple mechanisms that prevent autoreactivity. Moreover, some NK cell activation pathways have built-in negative feed-back loops that limit NK cell activation. For example, inhibitory receptors or signaling components may be upregulated, as seen upon activation of NK cells by in vitro culture in IL-2 or in vivo MCMV infection, which results in de novo expression of the inhibitory receptor gp49B (Wang et al., 2000). Other receptors modulate their own expression and activity. Stimulation of NKG2D, for instance, induces endocytosis and degradation of this receptor (Groh et al., 2002). In addition, sustained NKG2D stimulation can induce cross-tolerance of other NK cell activation
Natural Killer Cell Tolerance
61
pathways (Coudert et al., 2008), an effect also seen with continuous stimulation of Ly49H (Tripathy et al., 2008). This effect is only temporary, as culture in IL-2 for 18 h can restore activation receptor function as long as the ligand is absent. Interestingly, missing-self recognition remains impaired for a longer period of time than other effector functions. Only after 42 h of culture in IL-2 are the NK cells again able to kill MHCdeficient targets (Coudert et al., 2008). Further exploration of these findings may provide clues as to how self-tolerance is maintained during and after infection and other states of NK cell activation.
6.4. Accessory cells in NK cell activation An additional barrier against self-reactivity is the activation of NK cells by accessory cells, often DCs (Fig. 2.3D). Most NK cell assays, especially those that utilize freshly isolated naı¨ve NK cells, are carried out using mixed cell populations, such as whole splenocytes or peripheral blood mononuclear cells (PBMCs). Other assays use cytokine-activated NK cells. Recent studies show that pure naı¨ve NK cell populations do not respond in these same assays, indicating that bystander cells are required for NK cell activation (reviewed in Newman and Riley, 2007). Coculture experiments of both human and murine cells have also demonstrated that DCs and macrophages can activate NK cells in vitro (Cooper et al., 2001; Ferlazzo et al., 2002; Fernandez et al., 1999; Gerosa et al., 2002). Furthermore, injection of mature DCs in vivo results in recruitment and activation of NK cells in the draining lymph node, in a CXCR3-dependent manner (Martin-Fontecha et al., 2004). DCs injected directly into tumors can activate NK cells to control tumor growth (Fernandez et al., 1999). NK–DC interactions are also necessary for proper in vivo responses to malaria and viral infection or poly(I:C) treatment (Andoniou et al., 2005; Kim et al., 2007; Krug et al., 2004; Newman et al., 2006). A number of these responses may be due to the presentation of IL-15 in trans by the DC to the NK cell (Lucas et al., 2007). Thus, there is abundant evidence for meaningful interactions between NK cells and DCs. Less well studied but also apparent in vivo is the activation of NK cells by NKT cells (Carnaud et al., 1999). Specific activation of NKT cells with agalactosylceramide in vivo leads to NK cell cytokine production through an IFNg-dependent mechanism. Cross-talk between NK cells and DCs or NKT cells takes advantage of tolerance mechanisms of both non-NK cell types as an added safeguard against autoreactivity. This is a strategy widely used by the adaptive immune system, where most B and T cells require costimulatory signals from accessory cells for full activation. However, cross-talk also poses certain dangers. Because the potential mutual activation of NK cells, DCs, and NKT cells may initiate highly potent immune reactions, interactions
62
A. Helena Jonsson and Wayne M. Yokoyama
of even mildly autoreactive cells could have dire consequences as NK cellderived cytokines such as IFNg and the lymphocyte-stimulating capabilities of mature DCs and NKT cells could instigate a full-blown autoimmune attack. However, the mechanisms imposing tolerance on immune cell cross-talk involving NK cells are essentially unexplored.
6.5. Modulation of NK cell activity by regulatory cells Recent studies have revealed several cell-extrinsic mechanisms of NK cell tolerance. Regulatory T cells (Tregs), for example, can suppress NK cell activation in a contact-dependent manner (Fig. 2.3E). Coculture of fresh or formaldehyde-fixed human Tregs with human NK cells suppressed NK cell cytotoxicity against several tumor cell lines, suggesting that a surfacebound molecule of Tregs influences NK cell function (Ghiringhelli et al., 2006). Similarly, in vivo depletion of Tregs with anti-CD25 antibody enhances NK cell-mediated BM rejection (Barao et al., 2006). Neutralizing antibodies against TGFb produced a similar result, suggesting that this cytokine mediates the effects of Tregs on NK cells. Indeed, Tregs express membrane-bound TGFb, and NK cell contact with membrane-bound TGFb on Tregs leads to a decrease in NKG2D expression on the NK cells (Ghiringhelli et al., 2005). Curiously, T cells, not just Tregs, are also able to temper NK cell responses. In the absence of T cells (i.e., Rag1/ or nude mice), NK cells respond so vigorously to poly(I:C) treatment and viral infection that the mice die due to cytokine storm (Kim et al., 2007). However, as NK cell tolerance appears normal in Rag1/ mice and in NKG2D-deficient NK cells (Guerra et al., 2008; Kim et al., 2005), T cells (including Tregs) are clearly not the main players in self-tolerance of NK cells. Interestingly, NK cells themselves may have regulatory activity. A recent report indicates that humans have an NK cell subset capable of producing IL-10, IL-13, and IFNg as well as inhibiting T cell proliferation (Deniz et al., 2008). During pregnancy, 3% of human decidual NK cells belong to a HLA-Gþ IL10þ NK cell subset (Giuliani et al., 2008). Similar cells derived in vitro could release IL-10, IL-21, and soluble HLA-G, reverse the maturation of DCs, and inhibit IFNg production and cytotoxic granule release by other NK cells. NK cells can also acquire HLA-G1 from target cells (Caumartin et al., 2007). Upon acquiring HLA-G1, NK cells stopped proliferating and lost their cytotoxic functions. Furthermore, they gained suppressive functions and were able to inhibit cytotoxicity by other NK cells. Notably, this effect was local and temporary. Finally, the 2B4 molecule plays a role in preventing ‘‘fratricide,’’ the killing of NK cells by other NK cells (Taniguchi et al., 2007). However, the role of NK cell suppression of other NK cells is incompletely understood.
Natural Killer Cell Tolerance
63
7. NK CELL TOLERANCE MECHANISMS IN THE CLINIC 7.1. KIR-HLA disease associations and NK cell licensing A large number of studies have demonstrated a link between specific inhibitory KIR–HLA ligand pairs and protection against progression or poor outcome of disease (reviewed in Kulkarni et al., 2008). For example, individuals homozygous for the genes for KIR2DL3 and its cognate ligand, HLA-C1, have improved resolution of hepatitis C (Khakoo et al., 2004). KIR3DL1 expressed with HLA-Bw4 slows progression to AIDS (Martin et al., 2007). The presence of either KIR3DL1 with HLA-Bw4 or KIR2DL1 with a HLA-Cw group 2 allele reduces the risk of cervical cancer secondary to human papillomavirus infection (Carrington et al., 2005). Thus, there is epidemiological evidence for a productive interaction between KIRs and their HLA ligands in terms of protection from disease. At first glance, these studies appeared counterintuitive when considered only in the context of the effect of inhibitory receptors and ligands in the effector response alone, as an inhibitory NK cell receptor–ligand interaction would be expected to reduce NK cell activity and thereby impede the immune response. However, NK cell licensing may now provide an explanation for these clinical observations, as the licensing interaction of an inhibitory NK cell receptor with its cognate MHC ligand produces a more potent NK cell in both mice and humans (Kim et al., 2005, 2008). The KIR–HLA haplotypes of human individuals thereby determine the potency of their NK cells, with strong licensing interactions providing for vigorous NK cell responses to infections.
7.2. Hematopoietic stem cell transplantation Hematopoietic stem cell transplantation (HSCT) can be curative for a number of hematological malignancies, such as leukemia, but successful transplantation depends on avoidance of graft rejection, graft versus host disease (GVHD), and infection. Although these outcomes may be avoided by complete HLA-matching of donor and recipient, most patients do not have an HLA-identical donor and require intensive conditioning regimens to destroy their T cells (to avoid graft rejection). Additionally, the donor marrow is treated to eliminate donor T cells that may cause GVHD. Interestingly, graft failure due to the effects modeled by hybrid resistance in mice (recipient NK cells rejecting donor BM (Cudkowicz and Stimpfling, 1964)) appear to be a relatively minor clinical concern in human HSCT (Ruggeri et al., 1999). On the other hand, HLA incompatibility may provide a beneficial graft versus leukemia (GVL) effect. Thus, in recent years, considerable effort has been focused on understanding the balance between GVL and GVHD effects in clinical HSCT.
64
A. Helena Jonsson and Wayne M. Yokoyama
Interestingly, in HSCT with T cell-depleted donor marrow, donor NK cells may be able to mediate GVL without causing GVHD (Ruggeri et al., 2002). In the clinic, the GVL effect of NK cells, manifested as decreased relapse rate, appeared to correlate with a ‘‘KIR ligand incompatibility,’’ in which donor NK cells have KIRs for HLA ligands absent in the recipient. However, the clinical results have not been consistent (reviewed in Verheyden and Demanet, 2008). While it is possible that differences could be related to clinical transplantation protocols, another reason may be that current KIR–HLA mismatch analyses do not take NK cell licensing into account. If donor HLA alleles allow licensing of only selected donor NK cells via their KIRs, then they should attack recipient leukemic cells if the recipient lacks HLA alleles that are recognized by the donor’s licensed NK cells. This would then provide a donor NK celldependent GVL effect. On the other hand, donor KIRs that do not recognize self-HLA should not allow licensing and NK cells expressing these KIRs without other self-HLA-specific KIRs should be unlicensed. These unlicensed NK cells may not be relevant to the GVL effect, that is, even if the donor expresses KIRs whose ligands are absent in the recipient, there may not be any GVL effect from the donor NK cells. Alternatively, it is possible that HLA-independent effects may result in functional NK cells, due to cytokine stimulation, for example. Thus, new trials or even retrospective reanalysis of KIR–HLA mismatched HSCT may reveal whether NK cell licensing may be useful in enhancing the clinical GVL effect of donor NK cells in HSCT.
7.3. Tumor immunotherapy Since NK cells were first discovered to have anti-tumor effects, hopes have been high for their use as therapeutic agents. Potential strategies have been recently reviewed elsewhere (Sentman et al., 2006), so this discussion will be limited to the cancer immunotherapies that manipulate NK cell tolerance mechanisms. One such strategy is to infuse anti-KIR antibodies that block inhibitory receptors signaling (Ljunggren and Malmberg, 2007, Sentman et al., 2006, Sheridan, 2006). Such antibodies would in theory shift the balance toward NK cell activation and allow previously unresponsive NK cells to recognize and attack tumor cells. Indeed, in murine models, blockade of inhibitory Ly49 receptors decreased growth of hematological malignancies, but not solid tumors (Barber et al., 2008; Koh et al., 2001). However, one concern is that many cancers have already downregulated MHC class I and hence do not rely upon engagement of inhibitory KIRs to avoid immune attack by NK cells. Such tumor cells may be resistant to antiKIR antibody treatment, as they have developed other ways of evading missing-self-based NK cell activation.
Natural Killer Cell Tolerance
65
A related treatment strategy is infusion of activated allogeneic (i.e., KIR–ligand mismatch) NK cells. Interestingly, KIR-mismatched NK cell adoptive immunotherapy has shown the most promising results against leukemia, melanoma, and renal cell carcinoma (Igarashi et al., 2004; Leung et al., 2004; Lundqvist et al., 2007; Ruggeri et al., 2002), three types of cancer that have relatively low rates of HLA downregulation (Chang et al., 2005). As mentioned above, HLA-deficient tumor cells may already have robust mechanisms for evading NK cell attack, and these mechanisms may also be relevant to HLA-expressing tumors.
7.4. Autoimmune disease There is not yet any clear role for NK cells in the precipitation or prevention of autoimmunity (reviewed in French and Yokoyama, 2004; Perricone et al., 2008). This may be an indication of the strength of the barriers to NK cell autoreactivity. The tight regulation of expression of activating ligands, the ubiquitous expression of inhibitory ligands, and the requirements for accessory cell help in mounting full-strength immune responses all likely play a role. Nevertheless, it is too early to discount entirely a role for NK cells in initiating and propagating autoimmune disease. On the other hand, there is plenty of circumstantial evidence of NK cell involvement in autoimmune disease, but future studies must verify whether the observed differences are cause or effect, destructive or protective. For example, patients with systemic lupus erythematosus (SLE) have an abnormally elevated number of CD56bright NK cells in their blood, which could be either a cause or an effect of the coexistent elevated cytokine levels (Schepis et al., 2008). Thus, as the mechanisms of NK cell tolerance become clearer, it may be possible to determine if they play a direct role in autoimmune disorders.
7.5. NK cells in fetal tolerance The fetus is in essence a graft of foreign genetic material that survives for a long period of time in the mother’s body without being rejected. Missingself and hybrid resistance predict that NK cells should detect and reject fetal cells as foreign, since the fetus only carries half of the mother’s MHC molecules and hence may be recognized as missing self. However, in normal pregnancies, no such rejection occurs, despite the significant accumulation of NK cells in the decidua (reviewed in Moffett and Loke, 2006; Riley and Yokoyama, 2008). In fact, uterine NK cells, which are the most abundant lymphocyte in the pregnant uterus (Bulmer et al., 1991), appear to enable proper invasion of placental trophoblast cells and decidual vascularization (Ashkar et al., 2000; Hanna et al., 2006). In humans,
66
A. Helena Jonsson and Wayne M. Yokoyama
uterine NK (uNK) cells have a unique surface receptor phenotype in that they are CD56bright yet express KIRs, unlike peripheral blood CD56bright cells, which usually lack KIRs (Jacobs et al., 2001). This is a particularly interesting feature of uNKs because fetal trophoblasts are allogeneic and furthermore do not express surface HLA-A or -B molecules. Early in pregnancy, uNKs have an increased frequency and level of expression of activating and inhibitory KIRs specific for HLA-C, the only classical MHC class I molecule expressed by trophoblasts (Sharkey et al., 2008). Trophoblasts also express abundant HLA-G and HLA-E, which can engage the inhibitory CD94/NKG2A receptor on uNKs. Like conventional CD56bright NK cells, uNK cells are poorly cytotoxic and produce abundant cytokines, including angiogenic and vascular growth factors. These observations suggest that uNK cells may be involved in abnormal pregnancy outcomes. Indeed, emerging epidemiological data support the concept that maternal KIR and paternal HLA-C genotypes expressed by the fetal trophoblast are intimately involved in pathological pregnancies. In particular, preeclampsia, a human disorder in which there is inadequate placental perfusion, is associated with specific KIR and HLA alleles (Hiby et al., 2004). Interestingly, mothers were at higher risk if they lacked activating forms of the KIRs and the fetus had genotypes for HLA-C2 alleles. Thus, NK cell receptors involved in detecting HLA alleles may play a role in abnormal pregnancies.
8. CONCLUDING REMARKS As lymphocytes of the innate immune system, NK cells have a unique position in immune responses. Lacking a specific antigen receptor, NK cells rely upon activation and inhibitory receptors whose ligands are largely endogenous, that is, encoded by host genes. Meanwhile, NK cells are armed with powerful cytotoxic and immunostimulatory effector functions similar to those of cytotoxic T cells. Taken together with the complex expression patterns and binding specificities of NK cell activation and inhibitory receptors, there is potential for disaster. Not surprisingly, multiple levels of tolerance mechanisms keep these potent NK cells in check. NK cell licensing confers the ability to react to missing-self only upon those NK cells able to engage self-MHC. Moreover, NK cells are poorly activated unless simultaneously stimulated through multiple activation receptors and/or assisted by external cytokines or accessory cells. Regulatory cells and non-MHC-specific inhibitory receptors provide additional safeguards. Overall, the system of NK cell tolerance appears quite effective, as further demonstrated by the lack of extensive involvement of NK cells in autoimmune diseases. Emerging
Natural Killer Cell Tolerance
67
data suggest that NK cell tolerance mechanisms may be involved in a broad range of medically relevant problems from successful outcomes in infectious diseases, HSCT transplantation and pregnancies, to tumor therapies. Therefore, further study of NK cell tolerance mechanisms promise to yield both scientific and clinical insights.
ACKNOWLEDGMENTS We thank members of the Yokoyama laboratory, past and present, who have contributed to our understanding of NK cell tolerance, and Megan Cooper, Julie Elliott, Joseph Wahle, and Sandeep Tripathy for their comments on this manuscript. We appreciate the contributions from the Hansen laboratory (Washington University) in studies of licensing. Research in the Yokoyama laboratory is supported by the Howard Hughes Medical Institute and grants from the National Institutes of Health.
REFERENCES Adams, E. J., Juo, Z. S., Venook, R. T., Boulanger, M. J., Arase, H., Lanier, L. L., and Garcia, K. C. (2007). Structural elucidation of the m157 mouse cytomegalovirus ligand for Ly49 natural killer cell receptors. Proc. Natl. Acad. Sci. USA 104, 10128–10133. Agazie, Y. M., and Hayman, M. J. (2003). Molecular mechanism for a role of SHP2 in epidermal growth factor receptor signaling. Mol. Cell Biol. 23, 7875–7886. Alcami, A., and Koszinowski, U. H. (2000). Viral mechanisms of immune evasion. Immunol. Today 21, 447–455. Algarra, I., Garcia-Lora, A., Cabrera, T., Ruiz-Cabello, F., and Garrido, F. (2004). The selection of tumor variants with altered expression of classical and nonclassical MHC class I molecules: Implications for tumor immune escape. Cancer Immunol. Immunother. 53, 904–910. An, H., Hou, J., Zhou, J., Zhao, W., Xu, H., Zheng, Y., Yu, Y., Liu, S., and Cao, X. (2008). Phosphatase SHP-1 promotes TLR- and RIG-I-activated production of type I interferon by inhibiting the kinase IRAK1. Nat. Immunol. 9, 542–550. Andersson, K. E., Williams, G. S., Davis, D. M., and Hoglund, P. (2007). Quantifying the reduction in accessibility of the inhibitory NK cell receptor Ly49A caused by binding MHC class I proteins in cis. Eur. J. Immunol. 37, 516–527. Andersson, M., Freland, S., Johansson, M. H., Wallin, R., Sandberg, J. K., Chambers, B. J., Christensson, B., Lendahl, U., Lemieux, S., Salcedo, M., and Ljunggren, H. G. (1998). MHC class I mosaic mice reveal insights into control of Ly49C inhibitory receptor expression in NK cells. J. Immunol. 161, 6475–6479. Andoniou, C. E., van Dommelen, S. L., Voigt, V., Andrews, D. M., Brizard, G., AsselinPaturel, C., Delale, T., Stacey, K. J., Trinchieri, G., and Degli-Esposti, M. A. (2005). Interaction between conventional dendritic cells and natural killer cells is integral to the activation of effective antiviral immunity. Nat. Immunol. 6, 1011–1019. Anfossi, N., Andre, P., Guia, S., Falk, C. S., Roetynck, S., Stewart, C. A., Breso, V., Frassati, C., Reviron, D., Middleton, D., Romagne, F., Ugolini, S., and Vivier, E. (2006). Human NK cell education by inhibitory receptors for MHC class I. Immunity 25, 331–342. Arase, H., Mocarski, E. S., Campbell, A. E., Hill, A. B., and Lanier, L. L. (2002). Direct recognition of cytomegalovirus by activating and inhibitory NK cell receptors. Science 296, 1323–1326.
68
A. Helena Jonsson and Wayne M. Yokoyama
Ashkar, A. A., Di Santo, J. P., and Croy, B. A. (2000). Interferon gamma contributes to initiation of uterine vascular modification, decidual integrity, and uterine natural killer cell maturation during normal murine pregnancy. J. Exp. Med. 192, 259–270. Avril, T., North, S. J., Haslam, S. M., Willison, H. J., and Crocker, P. R. (2006). Probing the cis interactions of the inhibitory receptor Siglec-7 with {alpha}2,8-disialylated ligands on natural killer cells and other leukocytes using glycan-specific antibodies and by analysis of {alpha}2,8-sialyltransferase gene expression. J. Leukoc. Biol. 80, 787–796. Back, J., Chalifour, A., Scarpellino, L., and Held, W. (2007). Stable masking by H-2Dd cis ligand limits Ly49A relocalization to the site of NK cell/target cell contact. Proc. Natl. Acad. Sci. USA 104, 3978–3983. Barao, I., Hanash, A. M., Hallett, W., Welniak, L. A., Sun, K., Redelman, D., Blazar, B. R., Levy, R. B., and Murphy, W. J. (2006). Suppression of natural killer cell-mediated bone marrow cell rejection by CD4+CD25+ regulatory T cells. Proc. Natl. Acad. Sci. USA 103, 5460–5465. Barber, M. A., Zhang, T., Gagne, B. A., Van Ginderachter, J. A., De Baetselier, P., and Sentman, C. L. (2008). Ly49G2 receptor blockade reduces tumor burden in a leukemia model but not in a solid tumor model. Cancer Immunol. Immunother. 57, 655–662. Barten, R., Torkar, M., Haude, A., Trowsdale, J., and Wilson, M. J. (2001). Divergent and convergent evolution of NK-cell receptors. Trends Immunol. 22, 52–57. Bashirova, A. A., Martin, M. P., McVicar, D. W., and Carrington, M. (2006). The killer immunoglobulin-like receptor gene cluster: Tuning the genome for defense. Annu. Rev. Genomics Hum. Genet. 7, 277–300. Biron, C. A., Nguyen, K. B., Pien, G. C., Cousens, L. P., and Salazar-Mather, T. P. (1999). Natural killer cells in antiviral defense: Function and regulation by innate cytokines. Annu. Rev. Immunol. 17, 189–220. Bryceson, Y. T., March, M. E., Ljunggren, H. G., and Long, E. O. (2006a). Activation, coactivation, and costimulation of resting human natural killer cells. Immunol. Rev. 214, 73–91. Bryceson, Y. T., March, M. E., Ljunggren, H. G., and Long, E. O. (2006b). Synergy among receptors on resting NK cells for the activation of natural cytotoxicity and cytokine secretion. Blood 107, 159–166. Bulmer, J. N., Morrison, L., Longfellow, M., Ritson, A., and Pace, D. (1991). Granulated lymphocytes in human endometrium: Histochemical and immunohistochemical studies. Hum. Reprod. 6, 791–798. Burshtyn, D. N., Shin, J., Stebbins, C., and Long, E. O. (2000). Adhesion to target cells is disrupted by the killer cell inhibitory receptor. Curr. Biol. 10, 777–780. Caraux, A., Lu, Q., Fernandez, N., Riou, S., Di Santo, J. P., Raulet, D. H., Lemke, G., and Roth, C. (2006). Natural killer cell differentiation driven by Tyro3 receptor tyrosine kinases. Nat. Immunol. 7, 747–754. Carayannopoulos, L. N., Naidenko, O. V., Kinder, J., Ho, E. L., Fremont, D. H., and Yokoyama, W. M. (2002). Ligands for murine NKG2D display heterogeneous binding behavior. Eur. J. Immunol. 32, 597–605. Carlyle, J. R., Jamieson, A. M., Gasser, S., Clingan, C. S., Arase, H., and Raulet, D. H. (2004). Missing self-recognition of Ocil/Clr-b by inhibitory NKR-P1 natural killer cell receptors. Proc. Natl. Acad. Sci. USA 101, 3527–3532. Carnaud, C., Lee, D., Donnars, O., Park, S. H., Beavis, A., Koezuka, Y., and Bendelac, A. (1999). Cutting edge: Cross-talk between cells of the innate immune system: NKT cells rapidly activate NK cells. J. Immunol. 163, 4647–4650. Carrington, M., Wang, S., Martin, M. P., Gao, X., Schiffman, M., Cheng, J., Herrero, R., Rodriguez, A. C., Kurman, R., Mortel, R., Schwartz, P., Glass, A., and Hildesheim, A. (2005). Hierarchy of resistance to cervical neoplasia mediated by combinations of killer immunoglobulin-like receptor and human leukocyte antigen loci. J. Exp. Med. 201, 1069–1075.
Natural Killer Cell Tolerance
69
Caumartin, J., Favier, B., Daouya, M., Guillard, C., Moreau, P., Carosella, E. D., and LeMaoult, J. (2007). Trogocytosis-based generation of suppressive NK cells. EMBO J. 26, 1423–1433. Cella, M., Longo, A., Ferrara, G. B., Strominger, J. L., and Colonna, M. (1994). NK3-specific natural killer cells are selectively inhibited by Bw4-positive HLA alleles with isoleucine 80. J. Exp. Med. 180, 1235–1242. Cerwenka, A., Bakker, A. B. H., McClanahan, T., Wagner, J., Wu, J., Phillips, J. H., and Lanier, L. L. (2000). Retinoic acid early inducible genes define a ligand family for the activating NKG2D receptor in mice. Immunity 12, 721–727. Chan, A., Hong, D. L., Atzberger, A., Kollnberger, S., Filer, A. D., Buckley, C. D., McMichael, A., Enver, T., and Bowness, P. (2007). CD56bright human NK cells differentiate into CD56dim cells: Role of contact with peripheral fibroblasts. J. Immunol. 179, 89–94. Chang, C. C., Campoli, M., and Ferrone, S. (2005). Classical and nonclassical HLA class I antigen and NK Cell-activating ligand changes in malignant cells: Current challenges and future directions. Adv. Cancer Res. 93, 189–234. Chung, D. H., Natarajan, K., Boyd, L. F., Tormo, J., Mariuzza, R. A., Yokoyama, W. M., and Margulies, D. H. (2000). Mapping the ligand of the NK inhibitory receptor Ly49A on living cells. J. Immunol. 165, 6922–6932. Colonna, M., and Samaridis, J. (1995). Cloning of immunoglobulin-superfamily members associated with HLA-C and HLA-B recognition by human natural killer cells. Science 268, 405–408. Cooley, S., Xiao, F., Pitt, M., Gleason, M., McCullar, V., Bergemann, T. L., McQueen, K. L., Guethlein, L. A., Parham, P., and Miller, J. S. (2007). A subpopulation of human peripheral blood NK cells that lacks inhibitory receptors for self-MHC is developmentally immature. Blood 110, 578–586. Cooper, M. A., Fehniger, T. A., Turner, S. C., Chen, K. S., Ghaheri, B. A., Ghayur, T., Carson, W. E., and Caligiuri, M. A. (2001). Human natural killer cells: A unique innate immunoregulatory role for the CD56(bright) subset. Blood 97, 3146–3151. Coudert, J. D., Scarpellino, L., Gros, F., Vivier, E., and Held, W. (2008). Sustained NKG2D engagement induces cross-tolerance of multiple distinct NK cell activation pathways. Blood 111, 3571–3578. Cudkowicz, G., and Stimpfling, J. H. (1964). Hybrid resistance to parental marrow grafts: Association with the K region of H-2. Science 144, 1339–1340. Dam, J., Baber, J., Grishaev, A., Malchiodi, E. L., Schuck, P., Bax, A., and Mariuzza, R. A. (2006). Variable dimerization of the Ly49A natural killer cell receptor results in differential engagement of its MHC class I ligand. J. Mol. Biol. 362, 102–113. Dam, J., Guan, R., Natarajan, K., Dimasi, N., Chlewicki, L. K., Kranz, D. M., Schuck, P., Margulies, D. H., and Mariuzza, R. A. (2003). Variable MHC class I engagement by Ly49 natural killer cell receptors demonstrated by the crystal structure of Ly49C bound to H-2K(b). Nat. Immunol. 4, 1213–1222. Dann, S. M., Wang, H. C., Gambarin, K. J., Actor, J. K., Robinson, P., Lewis, D. E., CaillatZucman, S., and White, A. C., Jr. (2005). Interleukin-15 activates human natural killer cells to clear the intestinal protozoan cryptosporidium. J. Infect. Dis. 192, 1294–1302. Davis, D. M. (2007). Intercellular transfer of cell-surface proteins is common and can affect many stages of an immune response. Nat. Rev. Immunol. 7, 238–243. Deng, L., and Mariuzza, R. A. (2006). Structural basis for recognition of MHC and MHC-like ligands by natural killer cell receptors. Semin. Immunol. 18, 159–166. Deniz, G., Erten, G., Kucuksezer, U. C., Kocacik, D., Karagiannidis, C., Aktas, E., Akdis, C. A., and Akdis, M. (2008). Regulatory NK cells suppress antigen-specific T cell responses. J. Immunol. 180, 850–857.
70
A. Helena Jonsson and Wayne M. Yokoyama
Diefenbach, A., Jamieson, A. M., Liu, S. D., Shastri, N., and Raulet, D. H. (2000). Ligands for the murine NKG2D receptor: Expression by tumor cells and activation of NK cells and macrophages. Nat. Immunol. 1, 119–126. Diefenbach, A., Tomasello, E., Lucas, M., Jamieson, A. M., Hsia, J. K., Vivier, E., and Raulet, D. H. (2002). Selective associations with signaling molecules determine stimulatory versus costimulatory activity of NKG2D. Nat. Immunol. 3, 1142–1149. Dokun, A. O., Kim, S., Smith, H. R., Kang, H. S., Chu, D. T., and Yokoyama, W. M. (2001). Specific and nonspecific NK cell activation during virus infection. Nat. Immunol. 2, 951–956. Dorfman, J. R., and Raulet, D. H. (1998). Acquisition of Ly49 receptor expression by developing natural killer cells. J. Exp. Med. 187, 609–618. Doucey, M. A., Scarpellino, L., Zimmer, J., Guillaume, P., Luescher, I. F., Bron, C., and Held, W. (2004). Cis association of Ly49A with MHC class I restricts natural killer cell inhibition. Nat. Immunol. 5, 328–336. Farag, S. S., and Caligiuri, M. A. (2006). Human natural killer cell development and biology. Blood Rev. 20, 123–137. Faure, M., Barber, D. F., Takahashi, S. M., Jin, T., and Long, E. O. (2003). Spontaneous clustering and tyrosine phosphorylation of NK cell inhibitory receptor induced by ligand binding. J. Immunol. 170, 6107–6114. Fehniger, T. A., Cai, S. F., Cao, X., Bredemeyer, A. J., Presti, R. M., French, A. R., and Ley, T. J. (2007). Acquisition of murine NK cell cytotoxicity requires the translation of a preexisting pool of granzyme B and perforin mRNAs. Immunity 26, 798–811. Ferlazzo, G., Tsang, M. L., Moretta, L., Melioli, G., Steinman, R. M., and Munz, C. (2002). Human dendritic cells activate resting natural killer (NK) cells and are recognized via the NKp30 receptor by activated NK cells. J. Exp. Med. 195, 343–351. Fernandez, N. C., Lozier, A., Flament, C., Ricciardi-Castagnoli, P., Bellet, D., Suter, M., Perricaudet, M., Tursz, T., Maraskovsky, E., and Zitvogel, L. (1999). Dendritic cells directly trigger NK cell functions: Cross-talk relevant in innate anti-tumor immune responses in vivo. Nat. Med. 5, 405–411. Fernandez, N. C., Treiner, E., Vance, R. E., Jamieson, A. M., Lemieux, S., and Raulet, D. H. (2005). A subset of natural killer cells achieves self-tolerance without expressing inhibitory receptors specific for self-MHC molecules. Blood 105, 4416–4423. Fourmentraux-Neves, E., Jalil, A., Da Rocha, S., Pichon, C., Chouaib, S., Bismuth, G., and Caignard, A. (2008). Two opposite signaling outputs are driven by the KIR2DL1 receptor in human CD4+ T cells. Blood 112, 2381–2389. French, A. R., Sjolin, H., Kim, S., Koka, R., Yang, L., Young, D. A., Cerboni, C., Tomasello, E., Ma, A., Vivier, E., Karre, K., and Yokoyama, W. M. (2006). DAP12 signaling directly augments proproliferative cytokine stimulation of NK Cells during viral infections. J. Immunol. 177, 4981–4990. French, A. R., and Yokoyama, W. M. (2004). Natural killer cells and autoimmunity. Arthritis Res. Ther. 6, 8–14. Gardiner, C. M. (2008). Killer cell immunoglobulin-like receptors on NK cells: The how, where and why. Int. J. Immunogenet. 35, 1–8. Gasser, S., Orsulic, S., Brown, E. J., and Raulet, D. H. (2005). The DNA damage pathway regulates innate immune system ligands of the NKG2D receptor. Nature 436, 1186–1190. Gasser, S., and Raulet, D. H. (2006). Activation and self-tolerance of natural killer cells. Immunol. Rev. 214, 130–142. George, T. C., Mason, L. H., Ortaldo, J. R., Kumar, V., and Bennett, M. (1999a). Positive recognition of MHC class I molecules by the Ly49D receptor of murine NK cells. J. Immunol. 162, 2035–2043.
Natural Killer Cell Tolerance
71
George, T. C., Ortaldo, J. R., Lemieux, S., Kumar, V., and Bennett, M. (1999b). Tolerance and alloreactivity of the Ly49D subset of murine NK cells. J. Immunol. 163, 1859–1867. Gerosa, F., Baldani-Guerra, B., Nisii, C., Marchesini, V., Carra, G., and Trinchieri, G. (2002). Reciprocal activating interaction between natural killer cells and dendritic cells. J. Exp. Med. 195, 327–333. Ghiringhelli, F., Menard, C., Martin, F., and Zitvogel, L. (2006). The role of regulatory T cells in the control of natural killer cells: Relevance during tumor progression. Immunol. Rev. 214, 229–238. Ghiringhelli, F., Menard, C., Terme, M., Flament, C., Taieb, J., Chaput, N., Puig, P. E., Novault, S., Escudier, B., Vivier, E., Lecesne, A., Robert, C., et al. (2005). CD4+CD25+ regulatory T cells inhibit natural killer cell functions in a transforming growth factorbeta-dependent manner. J. Exp. Med. 202, 1075–1085. Gilfillan, S., Ho, E. L., Cella, M., Yokoyama, W. M., and Colonna, M. (2002). NKG2D recruits two distinct adapters to trigger natural killer cell activation and costimulation. Nature Immunol. 3, 1150–1155. Giuliani, M., Giron-Michel, J., Negrini, S., Vacca, P., Durali, D., Caignard, A., Le BousseKerdiles, C., Chouaib, S., Devocelle, A., Bahri, R., Durrbach, A., Taoufik, Y., et al. (2008). Generation of a novel regulatory NK cell subset from peripheral blood CD34+ progenitors promoted by membrane-bound IL-15. PLoS ONE 3, e2241. Grimm, E. A., Mazumder, A., Zhang, H. Z., and Rosenberg, S. A. (1982). Lymphokineactivated killer cell phenomenon. Lysis of natural killer-resistant fresh solid tumor cells by interleukin 2-activated autologous human peripheral blood lymphocytes. J. Exp. Med. 155, 1823–1841. Groh, V., Bahram, S., Bauer, S., Herman, A., Beauchamp, M., and Spies, T. (1996). Cell stressregulated human major histocompatibility complex class I gene expressed in gastrointestinal epithelium. Proc. Natl. Acad. Sci. USA 93, 12445–12450. Groh, V., Wu, J., Yee, C., and Spies, T. (2002). Tumour-derived soluble MIC ligands impair expression of NKG2D and T-cell activation. Nature 419, 734–738. Grzywacz, B., Kataria, N., Sikora, M., Oostendorp, R. A., Dzierzak, E. A., Blazar, B. R., Miller, J. S., and Verneris, M. R. (2006). Coordinated acquisition of inhibitory and activating receptors and functional properties by developing human natural killer cells. Blood 108, 3824–3833. Guerra, N., Tan, Y. X., Joncker, N. T., Choy, A., Gallardo, F., Xiong, N., Knoblaugh, S., Cado, D., Greenberg, N. M., and Raulet, D. H. (2008). NKG2D-deficient mice are defective in tumor surveillance in models of spontaneous malignancy. Immunity 28, 571–580. Gumperz, J. E., Litwin, V., Phillips, J. H., Lanier, L. L., and Parham, P. (1995). The Bw4 public epitope of HLA-B molecules confers reactivity with natural killer cell clones that express NKB1, a putative HLA receptor. J. Exp. Med. 181, 1133–1144. Gumperz, J. E., and Parham, P. (1995). The enigma of the natural killer cell. Nature 378, 245–248. Hanke, T., Takizawa, H., McMahon, C. W., Busch, D. H., Pamer, E. G., Miller, J. D., Altman, J. D., Liu, Y., Cado, D., Lemonnier, F. A., Bjorkman, P. J., and Raulet, D. H. (1999). Direct assessment of MHC class I binding by seven Ly49 inhibitory NK cell receptors. Immunity 11, 67–77. Hanna, J., Goldman-Wohl, D., Hamani, Y., Avraham, I., Greenfield, C., Natanson-Yaron, S., Prus, D., Cohen-Daniel, L., Arnon, T. I., Manaster, I., Gazit, R., Yutkin, V., et al. (2006). Decidual NK cells regulate key developmental processes at the human fetal-maternal interface. Nat. Med. 12, 1065–1074. Held, W., Dorfman, J. R., Wu, M. F., and Raulet, D. H. (1996). Major histocompatibility complex class I dependent skewing of the natural killer cell LY49 receptor repertoire. Eur. J. Immunol. 26, 2286–2292.
72
A. Helena Jonsson and Wayne M. Yokoyama
Held, W., and Mariuzza, R. A. (2008). Cis interactions of immunoreceptors with MHC and non-MHC ligands. Nat. Rev. Immunol. 8, 269–278. Hiby, S. E., Walker, J. J., O’Shaughnessy, K, M., Redman, C. W., Carrington, M., Trowsdale, J., and Moffett, A. (2004). Combinations of maternal KIR and fetal HLA-C genes influence the risk of preeclampsia and reproductive success. J. Exp. Med. 200, 957–965. Ho, E. L., Carayannopoulos, L. N., Poursine-Laurent, J., Kinder, J., Plougastel, B., Smith, H. R. C., and Yokoyama, W. M. (2002). Co-stimulation of multiple NK cell activation receptors by NKG2D. J. Immunol. 169, 3667–3675. Hoglund, P., Ohlen, C., Carbone, E., Franksson, L., Ljunggren, H. G., Latour, A., Koller, B., and Ka¨rre, K. (1991). Recognition of beta 2-microglobulin- negative (beta 2m-) T-cell blasts by natural killer cells from normal but not from beta 2m- mice: Nonresponsiveness controlled by beta 2m- bone marrow in chimeric mice. Proc. Natl. Acad. Sci. USA 88, 10332–10336. Hoglund, P., Sundback, J., Olssonalheim, M. Y., Johansson, M., Salcedo, M., Ohlen, C., Ljunggren, H. G., Sentman, C. L., and Karre, K. (1997). Host MHC class I gene control of NK-cell specificity in the mouse. Immunol. Rev. 155, 11–28. Igarashi, T., Wynberg, J., Srinivasan, R., Becknell, B., McCoy, J. P., Jr., Takahashi, Y., Suffredini, D. A., Linehan, W. M., Caligiuri, M. A., and Childs, R. W. (2004). Enhanced cytotoxicity of allogeneic NK cells with killer immunoglobulin-like receptor ligand incompatibility against melanoma and renal cell carcinoma cells. Blood 104, 170–177. Iizuka, K., Naidenko, O. V., Plougastel, B. F., Fremont, D. H., and Yokoyama, W. M. (2003). Genetically linked C-type lectin-related ligands for the NKRP1 family of natural killer cell receptors. Nat. Immunol. 4, 801–807. Ioannidis, V., Zimmer, J., Beermann, F., and Held, W. (2001). Cre Recombinase-Mediated Inactivation of H-2D(d) Transgene expression: Evidence for partial missing self-recognition by Ly49A NK cells. J. Immunol. 167, 6256–6262. Jacobs, R., Hintzen, G., Kemper, A., Beul, K., Kempf, S., Behrens, G., Sykora, K. W., and Schmidt, R. E. (2001). CD56bright cells differ in their KIR repertoire and cytotoxic features from CD56dim NK cells. Eur. J. Immunol. 31, 3121–3127. Johansson, M. H., Bieberich, C., Jay, G., Karre, K., and Hoglund, P. (1997). Natural killer cell tolerance in mice with mosaic expression of major histocompatibility complex class I transgene. J. Exp. Med. 186, 353–364. Johansson, M. H., Bieberich, C., Kase-Sjostrom, A., Yoshioka, T., Hoglund, E., Christy, B. A., Scangos, G., Karre, K., Jay, G., and Hoglund, P. (2000). Differential effects on T cell and NK cell development by tissue-specific expression of H-2D(d) transgene. Eur. J. Immunol. 30, 525–533. Johansson, M. H., and Hoglund, P. (2004). Low number of H-2Dd-negative haematopoietic cells in mixed bone marrow chimeras convey in vivo tolerance to H-2Dd-negative cells but fail to prevent resistance to H-2Dd-negative leukaemia. Scand J. Immunol. 59, 71–78. Johansson, S., Johansson, M., Rosmaraki, E., Vahlne, G., Mehr, R., Salmon-Divon, M., Lemonnier, F., Karre, K., and Hoglund, P. (2005). Natural killer cell education in mice with single or multiple major histocompatibility complex class I molecules. J. Exp. Med. 201, 1145–1155. Jones, D. C., Edgar, R. S., Ahmad, T., Cummings, J. R., Jewell, D. P., Trowsdale, J., and Young, N. T. (2006). Killer Ig-like receptor (KIR) genotype and HLA ligand combinations in ulcerative colitis susceptibility. Genes. Immun. 7, 576–582. Karlhofer, F. M., Hunziker, R., Reichlin, A., Margulies, D. H., and Yokoyama, W. M. (1994). Host MHC class I molecules modulate in vivo expression of a NK cell receptor. J. Immunol. 153, 2407–2416.
Natural Killer Cell Tolerance
73
Karlhofer, F. M., Ribaudo, R. K., and Yokoyama, W. M. (1992). MHC class I alloantigen specificity of Ly-49+ IL-2-activated natural killer cells. Nature 358, 66–70. Karlhofer, F. M., and Yokoyama, W. M. (1991). Stimulation of murine natural killer (NK) cells by a monoclonal antibody specific for the NK1.1 antigen. IL-2-activated NK cells possess additional specific stimulation pathways. J. Immunol. 146, 3662–3673. Karre, K., Ljunggren, H.-G., Piontek, G., and Kiessling, R. (1986). Selective rejection of H-2deficient lymphoma variants suggests alternative immune defence strategy. Nature 319, 675–678. Ka¨rre, K., Ljunggren, H. G., Piontek, G., and Kiessling, R. (1986). Selective rejection of H-2deficient lymphoma variants suggests alternative immune defence strategy. Nature 319, 675–678. Kase, A., Johansson, M. H., Olsson-Alheim, M. Y., Karre, K., and Hoglund, P. (1998). External and internal calibration of the MHC class I-specific receptor Ly49A on murine natural killer cells. J. Immunol. 161, 6133–6138. Kaufman, D. S., Schoon, R. A., Robertson, M. J., and Leibson, P. J. (1995). Inhibition of selective signaling events in natural killer cells recognizing major histocompatibility complex class I. Proc. Nat. Acad. Sci. USA 92, 6484–6488. Kelley, J., Walter, L., and Trowsdale, J. (2005). Comparative genomics of natural killer cell receptor gene clusters. PLoS Genet. 1, 129–139. Khakoo, S. I., Thio, C. L., Martin, M. P., Brooks, C. R., Gao, X., Astemborski, J., Cheng, J., Goedert, J. J., Vlahov, D., Hilgartner, M., Cox, S., Little, A. M., et al. (2004). HLA and NK cell inhibitory receptor genes in resolving hepatitis C virus infection. Science 305, 872–874. Kim, K. D., Zhao, J., Auh, S., Yang, X., Du, P., Tang, H., and Fu, Y. X. (2007). Adaptive immune cells temper initial innate responses. Nat. Med. 13, 1248–1252. Kim, S., Iizuka, K., Kang, H. S., Dokun, A., French, A. R., Greco, S., and Yokoyama, W. M. (2002). In vivo developmental stages in murine natural killer cell maturation. Nature Immunol. 3, 523–528. Kim, S., Poursine-Laurent, J., Truscott, S. M., Lybarger, L., Song, Y. J., Yang, L., French, A. R., Sunwoo, J. B., Lemieux, S., Hansen, T. H., and Yokoyama, W. M. (2005). Licensing of natural killer cells by host major histocompatibility complex class I molecules. Nature 436, 709–713. Kim, S., Sunwoo, J. B., Yang, L., Choi, T., Song, Y. J., French, A. R., Vlahiotis, A., Piccirillo, J. F., Cella, M., Colonna, M., Mohanakumar, T., Hsu, K. C., et al. (2008). HLA alleles determine differences in human natural killer cell responsiveness and potency. Proc. Natl. Acad. Sci. USA 105, 3053–3058. Koh, C. Y., Blazar, B. R., George, T., Welniak, L. A., Capitini, C. M., Raziuddin, A., Murphy, W. J., and Bennett, M. (2001). Augmentation of antitumor effects by NK cell inhibitory receptor blockade in vitro and in vivo. Blood 97, 3132–3137. Krug, A., French, A. R., Barchet, W., Fischer, J. A. A., Dzionek, A., Pingel, J. T., Orihuela, M. M., Akira, S., Yokoyama, W. M., and Colonna, M. (2004). TLR9-dependent recognition of MCMV by IPC and DC generates coordinated cytokine responses that activate antiviral NK cell function. Immunity 21, 107–119. Kulkarni, S., Martin, M. P., and Carrington, M. (2008). The Yin and Yang of HLA and KIR in human disease. Semin. Immunol. Prepublished online July 15, 2008; DOI 10.1016/ j.smim.2008.06.003. Kumar, V., and McNerney, M. E. (2005). A new self: MHC-class-I-independent natural-killercell self-tolerance. Nat. Rev. Immunol. 5, 363–374. Lanier, L. L. (2005). NK cell recognition. Annu. Rev. Immunol. 23, 225–274. Lanier, L. L., Phillips, J. H., Hackett, J., Jr., Tutt, M., and Kumar, V. (1986). Natural killer cells: Definition of a cell type rather than a function. J. Immunol. 137, 2735–2739.
74
A. Helena Jonsson and Wayne M. Yokoyama
Leung, W., Iyengar, R., Turner, V., Lang, P., Bader, P., Conn, P., Niethammer, D., and Handgretinger, R. (2004). Determinants of antileukemia effects of allogeneic NK cells. J. Immunol. 172, 644–650. Liao, N. S., Bix, M., Zijlstra, M., Jaenisch, R., and Raulet, D. (1991). MHC class I deficiency: Susceptibility to natural killer (NK) cells and impaired NK activity. Science 253, 199–202. Ljunggren, H. G., and Karre, K. (1990). In search of the ‘missing self’: MHC molecules and NK cell recognition. Immunology Today 11, 237–244. Ljunggren, H. G., and Malmberg, K. J. (2007). Prospects for the use of NK cells in immunotherapy of human cancer. Nat. Rev. Immunol. 7, 329–339. Ljunggren, H. G., Van Kaer, L., Ploegh, H. L., and Tonegawa, S. (1994). Altered natural killer cell repertoire in Tap-1 mutant mice. Proc. Nat. Acad. Sci. USA 91, 6520–6524. Lodoen, M. B., and Lanier, L. L. (2006). Natural killer cells as an initial defense against pathogens. Curr. Opin. Immunol. 18, 391–398. Long, E. O. (1999). Regulation of immune responses through inhibitory receptors. Annu. Rev. Immunol. 17, 875–904. Lowin-Kropf, B., Kunz, B., Beermann, F., and Held, W. (2000). Impaired natural killing of MHC class I-deficient targets by NK cells expressing a catalytically inactive form of SHP-1. J. Immunol. 165, 1314–1321. Lucas, M., Schachterle, W., Oberle, K., Aichele, P., and Diefenbach, A. (2007). Dendritic cells prime natural killer cells by trans-presenting interleukin 15. Immunity 26, 503–517. Lundqvist, A., McCoy, J. P., Samsel, L., and Childs, R. (2007). Reduction of GVHD and enhanced antitumor effects after adoptive infusion of alloreactive Ly49-mismatched NK cells from MHC-matched donors. Blood 109, 3603–3606. Makrigiannis, A. P., Pau, A. T., Schwartzberg, P. L., McVicar, D. W., Beck, T. W., and Anderson, S. K. (2002). A BAC contig map of the Ly49 gene cluster in 129 mice reveals extensive differences in gene content relative to C57BL/6 mice. Genomics 79, 437–444. Malarkannan, S., Regunathan, J., Chu, H., Kutlesa, S., Chen, Y., Zeng, H., Wen, R., and Wang, D. (2007). Bcl10 plays a divergent role in NK cell-mediated cytotoxicity and cytokine generation. J. Immunol. 179, 3752–3762. Marti, F., Xu, C. W., Selvakumar, A., Brent, R., Dupont, B., and King, P. D. (1998). LCKphosphorylated human killer cell-inhibitory receptors recruit and activate phosphatidylinositol 3-kinase. Proc. Nat. Acad. Sci. USA 95, 11810–11815. Martin, M. P., Qi, Y., Gao, X., Yamada, E., Martin, J. N., Pereyra, F., Colombo, S., Brown, E. E., Shupert, W. L., Phair, J., Goedert, J. J., Buchbinder, S., et al. (2007). Innate partnership of HLA-B and KIR3DL1 subtypes against HIV-1. Nat. Genet. 39, 733–740. Martin-Fontecha, A., Thomsen, L. L., Brett, S., Gerard, C., Lipp, M., Lanzavecchia, A., and Sallusto, F. (2004). Induced recruitment of NK cells to lymph nodes provides IFNgamma for T(H)1 priming. Nat. Immunol. 5, 1260–1265. Masuda, A., Nakamura, A., Maeda, T., Sakamoto, Y., and Takai, T. (2007). Cis binding between inhibitory receptors and MHC class I can regulate mast cell activation. J. Exp. Med. 204, 907–920. Matsumoto, N., Yokoyama, W. M., Kojima, S., and Yamamoto, K. (2001). The NK cell MHC class I receptor Ly49A detects mutations on H-2D(d) inside and outside of the peptide binding groove. J. Immunol. 166, 4422–4428. McCann, F. E., Eissmann, P., Onfelt, B., Leung, R., and Davis, D. M. (2007). The activating NKG2D ligand MHC class I-related chain A transfers from target cells to NK cells in a manner that allows functional consequences. J. Immunol. 178, 3418–3426. Mehta, I. K., Smith, H. R. C., Wang, J., Margulies, D. H., and Yokoyama, W. M. (2001). A "chimeric" C57L-derived Ly49 inhibitory receptor resembling the Ly49D activation receptor. Cell Immunol. 209, 29–41.
Natural Killer Cell Tolerance
75
Mistry, A. R., and O’Callaghan, C. A. (2007). Regulation of ligands for the activating receptor NKG2D. Immunology 121, 439–447. Moffett, A., and Loke, C. (2006). Immunology of placentation in eutherian mammals. Nat. Rev. Immunol. 6, 584–594. Murphy, W. J., Kumar, V., and Bennett, M. (1987). Rejection of bone marrow allografts by mice with severe combined immune deficiency (SCID). Evidence that natural killer cells can mediate the specificity of marrow graft rejection. J. Exp. Med. 165, 1212–1217. Nakamura, M. C., Linnemeyer, P. A., Niemi, E. C., Mason, L. H., Ortaldo, J. R., Ryan, J. C., and Seaman, W. E. (1999). Mouse Ly-49D recognizes H-2Dd and activates natural killer cell cytotoxicity. J. Exp. Med. 189, 493–500. Nakamura, M. C., Niemi, E. C., Fisher, M. J., Shultz, L. D., Seaman, W. E., and Ryan, J. C. (1997). Mouse Ly-49A interrupts early signaling events in natural killer cell cytotoxicity and functionally associates with the Shp-1 tyrosine phosphatase. J. Exp. Med. 185, 673–684. Nasrallah, J. B. (2002). Recognition and rejection of self in plant reproduction. Science 296, 305–308. Newman, K. C., Korbel, D. S., Hafalla, J. C., and Riley, E. M. (2006). Cross-talk with myeloid accessory cells regulates human natural killer cell interferon-gamma responses to malaria. PLoS Pathog. 2, e118. Newman, K. C., and Riley, E. M. (2007). Whatever turns you on: Accessory-cell-dependent activation of NK cells by pathogens. Nat. Rev. Immunol. 7, 279–291. Nicoll, G., Avril, T., Lock, K., Furukawa, K., Bovin, N., and Crocker, P. R. (2003). Ganglioside GD3 expression on target cells can modulate NK cell cytotoxicity via siglec-7-dependent and -independent mechanisms. Eur. J. Immunol. 33, 1642–1648. North, J., Bakhsh, I., Marden, C., Pittman, H., Addison, E., Navarrete, C., Anderson, R., and Lowdell, M. W. (2007). Tumor-primed human natural killer cells lyse NK-resistant tumor targets: Evidence of a two-stage process in resting NK cell activation. J. Immunol. 178, 85–94. Nowbakht, P., Ionescu, M. C., Rohner, A., Kalberer, C. P., Rossy, E., Mori, L., Cosman, D., De Libero, G., and Wodnar-Filipowicz, A. (2005). Ligands for natural killer cell-activating receptors are expressed upon the maturation of normal myelomonocytic cells but at low levels in acute myeloid leukemias. Blood 105, 3615–3622. O’Keefe, T. L., Williams, G. T., Davies, S. L., and Neuberger, M. S. (1996). Hyperresponsive B cells in CD22-deficient mice. Science 274, 798–801. Oberg, L., Johansson, S., Michaelsson, J., Tomasello, E., Vivier, E., Karre, K., and Hoglund, P. (2004). Loss or mismatch of MHC class I is sufficient to trigger NK cell-mediated rejection of resting lymphocytes in vivo – role of KARAP/DAP12-dependent and -independent pathways. Eur. J. Immunol. 34, 1646–1653. Ogasawara, K., Benjamin, J., Takaki, R., Phillips, J. H., and Lanier, L. L. (2005). Function of NKG2D in natural killer cell-mediated rejection of mouse bone marrow grafts. Nat. Immunol. 6, 938–945. Ohlen, C., Kling, G., Hoglund, P., Hansson, M., Scangos, G., Bieberich, C., Jay, G., and Karre, K. (1989). Prevention of allogeneic bone marrow graft rejection by H-2 transgene in donor mice. Science 246, 666–668. Olsson, M. Y., Karre, K., and Sentman, C. L. (1995). Altered phenotype and function of natural killer cells expressing the major histocompatibility complex receptor Ly-49 in mice transgenic for its ligand. Proc. Nat. Acad. Sci. USA 92, 1649–1653. Olsson-Alheim, M. Y., Salcedo, M., Ljunggren, H. G., Karre, K., and Sentman, C. L. (1997). NK cell receptor calibration: Effects of MHC class I induction on killing by Ly49Ahigh and Ly49Alow NK cells. J. Immunol. 159, 3189–3194.
76
A. Helena Jonsson and Wayne M. Yokoyama
Oppenheim, D. E., Roberts, S. J., Clarke, S. L., Filler, R., Lewis, J. M., Tigelaar, R. E., Girardi, M., and Hayday, A. C. (2005). Sustained localized expression of ligand for the activating NKG2D receptor impairs natural cytotoxicity in vivo and reduces tumor immunosurveillance. Nat. Immunol. 6, 928–937. Parham, P. (2006). Taking license with natural killer cell maturation and repertoire development. Immunol. Rev. 214, 155–160. Pascal, V., Stulberg, M. J., and Anderson, S. K. (2006). Regulation of class I major histocompatibility complex receptor expression in natural killer cells: One promoter is not enough. Immunol. Rev. 214, 9–21. Perricone, R., Perricone, C., De Carolis, C., and Shoenfeld, Y. (2008). NK cells in autoimmunity: A two-edg’d weapon of the immune system. Autoimmun. Rev. 7, 384–390. Plougastel, B., Matsumoto, K., Dubbelde, C., and Yokoyama, W. M. (2001). Analysis of a 1-Mb BAC contig overlapping the mouse Nkrp1 cluster of genes: Cloning of three new Nkrp1 members, Nkrp1d, Nkrp1e, and Nkrp1f. Immunogenetics 53, 592–598. Poggi, A., Prevosto, C., Massaro, A. M., Negrini, S., Urbani, S., Pierri, I., Saccardi, R., Gobbi, M., and Zocchi, M. R. (2005). Interaction between human NK cells and bone marrow stromal cells induces NK cell triggering: Role of NKp30 and NKG2D receptors. J. Immunol. 175, 6352–6360. Qu, C. K., Nguyen, S., Chen, J., and Feng, G. S. (2001). Requirement of Shp-2 tyrosine phosphatase in lymphoid and hematopoietic cell development. Blood 97, 911–914. Rabinovich, B., Li, J., Wolfson, M., Lawrence, W., Beers, C., Chalupny, J., Hurren, R., Greenfield, B., Miller, R., and Cosman, D. (2006). NKG2D splice variants: A reexamination of adaptor molecule associations. Immunogenetics 58, 81–88. Raulet, D. H. (2003). Roles of the NKG2D immunoreceptor and its ligands. Nat. Rev. Immunol. 3, 781–790. Raulet, D. H. (2006). Missing self recognition and self tolerance of natural killer (NK) cells. Semin. Immunol. 18, 145–150. Raulet, D. H., and Vance, R. E. (2006). Self-tolerance of natural killer cells. Nat. Rev. Immunol. 6, 520–531. Raulet, D. H., Vance, R. E., and McMahon, C. W. (2001). Regulation of the natural killer cell receptor repertoire. Annu. Rev. Immunol. 19, 291–330. Razi, N., and Varki, A. (1998). Masking and unmasking of the sialic acid-binding lectin activity of CD22 (Siglec-2) on B lymphocytes. Proc. Natl. Acad. Sci. USA 95, 7469–7474. Riley, J. K., and Yokoyama, W. M. (2008). NK cell tolerance and the maternal-fetal interface. Am. J. Reprod. Immunol. 59, 371–387. Roda-Navarro, P., Vales-Gomez, M., Chisholm, S. E., and Reyburn, H. T. (2006). Transfer of NKG2D and MICB at the cytotoxic NK cell immune synapse correlates with a reduction in NK cell cytotoxic function. Proc. Natl. Acad. Sci. USA 103, 11258–11263. Roth, C., Carlyle, J. R., Takizawa, H., and Raulet, D. H. (2000). Clonal acquisition of inhibitory Ly49 receptors on developing NK cells is successively restricted and regulated by stromal class I MHC. Immunity 13, 143–153. Rouhi, A., Gagnier, L., Takei, F., and Mager, D. L. (2006). Evidence for epigenetic maintenance of Ly49a monoallelic gene expression. J. Immunol. 176, 2991–2999. Ruggeri, L., Capanni, M., Casucci, M., Volpi, I., Tosti, A., Perruccio, K., Urbani, E., Negrin, R. S., Martelli, M. F., and Velardi, A. (1999). Role of natural killer cell alloreactivity in HLA-mismatched hematopoietic stem cell transplantation. Blood 94, 333–339. Ruggeri, L., Capanni, M., Urbani, E., Perruccio, K., Shlomchik, W. D., Tosti, A., Posati, S., Rogaia, D., Frassoni, F., Aversa, F., Martelli, M. F., and Velardi, A. (2002). Effectiveness of donor natural killer cell alloreactivity in mismatched hematopoietic transplants. Science 295, 2097–2100.
Natural Killer Cell Tolerance
77
Salcedo, M., Diehl, A. D., Olsson-Alheim, M. Y., Sundback, J., Van Kaer, L., Karre, K., and Ljunggren, H. G. (1997). Altered expression of Ly49 inhibitory receptors on natural killer cells from MHC class I-deficient mice. J. Immunol. 158, 3174–3180. Schepis, D., Gunnarsson, I., Eloranta, M. L., Lampa, J., Jacobson, S. H., Karre, K., and Berg, L. (2008). Increased proportion of CD56(bright) natural killer cells in active and inactive systemic lupus erythematosus. Immunology. Prepublished online June 18, 2008; DOI 10.1111/j.1365-2567.2008.02887.x. Sentman, C. L., Barber, M. A., Barber, A., and Zhang, T. (2006). NK cell receptors as tools in cancer immunotherapy. Adv. Cancer Res. 95, 249–292. Sentman, C. L., Olsson, M. Y., and Karre, K. (1995). Missing self recognition by natural killer cells in MHC class I transgenic mice. A ‘receptor calibration’ model for how effector cells adapt to self. Seminars in Immunol. 7, 109–119. Sharkey, A. M., Gardner, L., Hiby, S., Farrell, L., Apps, R., Masters, L., Goodridge, J., Lathbury, L., Stewart, C. A., Verma, S., and Moffett, A. (2008). Killer Ig-like receptor expression in uterine NK cells is biased toward recognition of HLA-C and alters with gestational age. J. Immunol. 181, 39–46. Sheridan, C. (2006). First-in-class cancer therapeutic to stimulate natural killer cells. Nat. Biotechnol. 24, 597. Shultz, L. D. (1988). Pleiotropic effects of deleterious alleles at the "motheaten" locus. Curr. Top Microbiol. Immunol. 137, 216–222. Sjostrom, A., Eriksson, M., Cerboni, C., Johansson, M. H., Sentman, C. L., Karre, K., and Hoglund, P. (2001). Acquisition of external major histocompatibility complex class I molecules by natural killer cells expressing inhibitory ly49 receptors. J. Exp. Med. 194, 1519–1530. Smith, H. R., Heusel, J. W., Mehta, I. K., Kim, S., Dorner, B. G., Naidenko, O. V., Iizuka, K., Furukawa, H., Beckman, D. L., Pingel, J. T., Scalzo, A. A., Fremont, D. H., et al. (2002). Recognition of a virus-encoded ligand by a natural killer cell activation receptor. Proc. Natl. Acad. Sci. USA 99, 8826–8831. Spaggiari, G. M., Capobianco, A., Becchetti, S., Mingari, M. C., and Moretta, L. (2006). Mesenchymal stem cell-natural killer cell interactions: Evidence that activated NK cells are capable of killing MSCs, whereas MSCs can inhibit IL-2-induced NK-cell proliferation. Blood 107, 1484–1490. Sun, J. C., and Lanier, L. L. (2008). Tolerance of NK cells encountering their viral ligand during development. J. Exp. Med. 205, 1819–1828. Suzue, K., Reinherz, E. L., and Koyasu, S. (2001). Critical role of NK but not NKT cells in acute rejection of parental bone marrow cells in F1 hybrid mice. Eur. J. Immunol. 31, 3147–3152. Sykes, M., Harty, M. W., Karlhofer, F. M., Pearson, D. A., Szot, G., and Yokoyama, W. (1993). Hematopoietic cells and radioresistant host elements influence natural killer cell differentiation. J. Exp. Med. 178, 223–229. Taniguchi, R. T., Guzior, D., and Kumar, V. (2007). 2B4 inhibits NK-cell fratricide. Blood 110, 2020–2023. Tay, C. H., Welsh, R. M., and Brutkiewicz, R. R. (1995). NK cell response to viral infections in beta 2-microglobulin-deficient mice. J. Immunol. 154, 780–789. Tormo, J., Natarajan, K., Margulies, D. H., and Mariuzza, R. A. (1999). Crystal structure of a lectin-like natural killer cell receptor bound to its MHC class I ligand. Nature 402, 623–631. Tripathy, S. K., Keyel, P. A., Yang, L., Pingel, J. T., Cheng, T. P., Schneeberger, A., and Yokoyama, W. M. (2008). Continuous engagement of a self-specific activation receptor induces NK cell tolerance. J. Exp. Med. 205, 1829–1841. Valiante, N. M., Uhrberg, M., Shilling, H. G., Lienertweidenbach, K., Arnett, K. L., Dandrea, A., Phillips, J. H., Lanier, L. L., and Parham, P. (1997). Functionally and structurally distinct NK cell receptor repertoires in the peripheral blood of two human donors. Immunity 7, 739–751.
78
A. Helena Jonsson and Wayne M. Yokoyama
Verheyden, S., and Demanet, C. (2008). NK cell receptors and their ligands in leukemia. Leukemia 22, 249–257. Vivier, E., Nunes, J. A., and Vely, F. (2004). Natural killer cell signaling pathways. Science 306, 1517–1519. Vivier, E., Tomasello, E., Baratin, M., Walzer, T., and Ugolini, S. (2008). Functions of natural killer cells. Nat. Immunol. 9, 503–510. Vosshenrich, C. A., Garcia-Ojeda, M. E., Samson-Villeger, S. I., Pasqualetto, V., Enault, L., Richard-Le Goff, O., Corcuff, E., Guy-Grand, D., Rocha, B., Cumano, A., Rogge, L., Ezine, S., et al. (2006). A thymic pathway of mouse natural killer cell development characterized by expression of GATA-3 and CD127. Nat. Immunol. 7, 1217–1224. Wagtmann, N., Rajagopalan, S., Winter, C. C., Peruzzi, M., and Long, E. O. (1995). Killer cell inhibitory receptors specific for HLA-C and HLA-B identified by direct binding and by functional transfer. Immunity 3, 801–809. Wahle, J. A., Paraiso, K. H., Costello, A. L., Goll, E. L., Sentman, C. L., and Kerr, W. G. (2006). Cutting edge: Dominance by an MHC-independent inhibitory receptor compromises NK killing of complex targets. J. Immunol. 176, 7165–7169. Wang, J., Whitman, M. C., Natarajan, K., Tormo, J., Mariuzza, R. A., and Margulies, D. H. (2002a). Binding of the natural killer cell inhibitory receptor Ly49A to its major histocompatibility complex class I ligand. Crucial contacts include both H-2Dd and beta 2-microglobulin. J. Biol. Chem. 277, 1433–1442. Wang, J. W., Howson, J. M., Ghansah, T., Desponts, C., Ninos, J. M., May, S. L., Nguyen, K. H., Toyama-Sorimachi, N., and Kerr, W. G. (2002b). Influence of SHIP on the NK repertoire and allogeneic bone marrow transplantation. Science 295, 2094–2097. Wang, L. L., Chu, D. T., Dokun, A. O., and Yokoyama, W. M. (2000). Inducible expression of the gp49B inhibitory receptor on NK cells. J. Immunol. 164, 5215–5220. Wiemann, K., Mittrucker, H. W., Feger, U., Welte, S. A., Yokoyama, W. M., Spies, T., Rammensee, H. G., and Steinle, A. (2005). Systemic NKG2D down-regulation impairs NK and CD8 T cell responses in vivo. J. Immunol. 175, 720–729. Wilhelm, B. T., Gagnier, L., and Mager, D. L. (2002). Sequence analysis of the ly49 cluster in C57BL/6 mice: A rapidly evolving multigene family in the immune system. Genomics 80, 646–661. Williams, N. S., Kubota, A., Bennett, M., Kumar, V., and Takei, F. (2000). Clonal analysis of NK cell development from bone marrow progenitors in vitro: Orderly acquisition of receptor gene expression. Eur. J. Immunol. 30, 2074–2082. Wu, M. F., and Raulet, D. H. (1997). Class I-deficient hemopoietic cells and nonhemopoietic cells dominantly induce unresponsiveness of natural killer cells to class I-deficient bone marrow cell grafts. J. Immunol. 158, 1628–1633. Yawata, M., Yawata, N., Draghi, M., Little, A. M., Partheniou, F., and Parham, P. (2006). Roles for HLA and KIR polymorphisms in natural killer cell repertoire selection and modulation of effector function. J. Exp. Med. 203, 633–645. Yawata, M., Yawata, N., Draghi, M., Partheniou, F., Little, A. M., and Parham, P. (2008). MHC class I-specific inhibitory receptors and their ligands structure diverse human NK cell repertoires towards a balance of missing-self response. Blood 112, 2369–2380. Yokoyama, W. M. (2008a). "Fundamental Immunology" (W. E. Paul, Ed.), pp. 483–517. Lippincott-Raven, New York. Yokoyama, W. M. (2008b). Mistaken notions about natural killer cells. Nat. Immunol. 9, 481–485. Yokoyama, W. M., and Kim, S. (2006a). How do natural killer cells find self to achieve tolerance. Immunity 24, 249–257. Yokoyama, W. M., and Kim, S. (2006b). Licensing of natural killer cells by self-major histocompatibility complex class I. Immunol. Rev. 214, 143–154.
Natural Killer Cell Tolerance
79
Yokoyama, W. M., Kim, S., and French, A. R. (2004). The dynamic life of natural killer cells. Annu. Rev. Immunol. 22, 405–429. Yokoyama, W. M., and Plougastel, B. F. (2003). Immune functions encoded by the natural killer gene complex. Nat. Rev. Immunol. 3, 304–316. Yu, J., Heller, G., Chewning, J., Kim, S., Yokoyama, W. M., and Hsu, K. C. (2007). Hierarchy of the human natural killer cell response is determined by class and quantity of inhibitory receptors for self-HLA-B and HLA-C ligands. J. Immunol. 179, 5977–5989. Yu, M. C., Su, L. L., Zou, L., Liu, Y., Wu, N., Kong, L., Zhuang, Z. H., Sun, L., Liu, H. P., Hu, J. H., Li, D., Strominger, J. L., et al. (2008). An essential function for beta-arrestin 2 in the inhibitory signaling of natural killer cells. Nat. Immunol. 9, 898–907. Yu, Y. Y., Netuschil, N., Lybarger, L., Connolly, J. M., and Hansen, T. H. (2002). Cutting edge: Single-chain trimers of MHC class I molecules form stable structures that potently stimulate antigen-specific T cells and B cells. J. Immunol. 168, 3145–3149. Yusa, S., and Campbell, K. S. (2003). Src homology region 2-containing protein tyrosine phosphatase-2 (SHP-2) can play a direct role in the inhibitory function of killer cell Iglike receptors in human NK cells. J. Immunol. 170, 4539–4547. Zhang, C., Zhang, J., Niu, J., Zhang, J., and Tian, Z. (2008a). Interleukin-15 improves cytotoxicity of natural killer cells via up-regulating NKG2D and cytotoxic effector molecule expression as well as STAT1 and ERK1/2 phosphorylation. Cytokine 42, 128–136. Zhang, C., Zhang, J., Niu, J., Zhou, Z., Zhang, J., and Tian, Z. (2008b). Interleukin-12 improves cytotoxicity of natural killer cells via upregulated expression of NKG2D. Hum. Immunol. 69, 490–500. Zhang, S. Q., Yang, W., Kontaridis, M. I., Bivona, T. G., Wen, G., Araki, T., Luo, J., Thompson, J. A., Schraven, B. L., Philips, M. R., and Neel, B. G. (2004). Shp2 regulates SRC family kinase activity and Ras/Erk activation by controlling Csk recruitment. Mol. Cell 13, 341–355. Zhao, Y., Ohdan, H., Manilay, J. O., and Sykes, M. (2003). NK cell tolerance in mixed allogeneic chimeras. J. Immunol. 170, 5398–5405. Zimmer, J., Ioannidis, V., and Held, W. (2001). H-2D ligand expression by Ly49A+ natural killer (NK) cells precludes ligand uptake from environmental cells: Implications for NK cell function. J. Exp. Med. 194, 1531–1539.
CHAPTER
3 Biology of the Eosinophil Carine Blanchard and Marc E. Rothenberg
Contents
1. The Eosinophil: From a Hematopoietic Stem Cell to a Mature Eosinophil 1.1. Eosinophil differentiation 1.2. The mature eosinophil: A complex granulocyte 1.3. Eosinophil secretion/degranulation 1.4. Eosinophil DNA trap 1.5. Cytokine production 2. A Role for Eosinophils at Baseline 2.1. Eosinophils and reproduction 2.2. Thymic eosinophils 3. Eosinophils and Immune Regulation 3.1. Antigen presentation/T cell proliferation 3.2. Mast cell regulation 4. Eosinophil Trafficking 4.1. The cytokines 4.2. The chemokines 4.3. Adhesion molecules 4.4. Other molecules involved in eosinophil trafficking 4.5. Negative regulation of eosinophil trafficking 5. Role of Eosinophils in Disease 5.1. Infections 5.2. Role of eosinophils in asthma 5.3. Atopic dermatitis 5.4. GI disorders 5.5. Hyper eosinophilic diseases
82 82 85 87 88 88 88 88 89 90 90 91 91 91 93 94 95 96 96 96 99 101 102 104
Division of Allergy and Immunology, Department of Pediatrics, Cincinnati Children’s Hospital Medical Center, University of Cincinnati College of Medicine, Cincinnati, Ohio 45229-3039 Advances in Immunology, Volume 101 ISSN 0065-2776, DOI: 10.1016/S0065-2776(08)01003-1
#
2009 Elsevier Inc. All rights reserved.
81
82
Carine Blanchard and Marc E. Rothenberg
6. Antieosinophil Therapeutics 6.1. Therapeutics available 6.2. Therapeutics in development Acknowledgments References
Abstract
105 105 107 108 108
In this review, we aim to put in perspective the biology of a multifunctional leukocyte, the eosinophil, by placing it in the context of innate and adaptive immune responses. Eosinophils have a unique contribution in initiating inflammatory and adaptive responses, due to their bidirectional interactions with dendritic cells and T cells, as well as their large panel of secreted cytokines and soluble mediators. The mechanisms and consequences of eosinophil responses in experimental inflammatory models and human diseases are discussed.
1. THE EOSINOPHIL: FROM A HEMATOPOIETIC STEM CELL TO A MATURE EOSINOPHIL 1.1. Eosinophil differentiation Eosinophils are produced in the bone marrow from multipotent hematopoietic stem cells. Hematopoietic differentiation involves the commitment of multipotent progenitors to a given lineage, followed by the maturation of the committed cells. From these stem cells, the myeloid lineage allows the development of the myeloblast with shared properties of basophils and eosinophils, and then into a separate eosinophil lineage (Boyce et al., 1995). Each of the steps that ultimately lead to mature eosinophils is under the fine regulation of soluble mediators and transcription factors (Fig. 3.1).
1.1.1. Transcription factors Several transcription factors are involved in the eosinophilic lineage. Forced expression of the transcription C/EPB members (CCAAT/ enhancer-binding protein family) in progenitor cells induces myeloid and eosinophil differentiation (Nerlov et al., 1998). Conversely, dominant-negative versions of C/EBP inhibit myeloid differentiation (Nerlov et al., 1998). As such, C/EBP-induced eosinophil differentiation can be separated into two distinct events, lineage commitment and maturation. Indeed, a transient activation of a conditional C/EBP form in multipotent progenitors leads to the formation of immature eosinophils, whereas sustained activation produces mature eosinophils,
Biology of the Eosinophil
Transcription factors GATA-1 PU.1 C/EBP
Cytokines IL-3 GM-CSF IL-5
Stem cell Stimulation Parasitic infection Viral infection Fungal infection Bacterial infection Allergen Allograft Tumors
T cell communication Antigen presentation/T cell activation (MCH II, CD80, CD86) T cell polarization (KYN) Pulmonary T cell function (Th2 cytokine expression)
83
IL-5
Mast cell activation T cell communication Secretion
Tissue changes
Localization at baseline Thymus Uterus Mammary glands Gastrointestinal tract
Secretion Cytotoxic granule proteins (EPO, MBP, ECP, EDN) Cytokines (IL-2, IL-3, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12, IL-13, IL-16, IL-18, TGF, GMCSF, TNF, INFg) Chemokines (eotaxin-1, RANTES, MIP-1a) Lipid mediators (leukotrienes, platelet activating factor, eoxin) Neuromediators (substance P, NGF, VIP) DNA (mitochondrial DNA)
FIGURE 3.1 From the hematopoietic stem cell to the mature eosinophil. Eosinophils develop in the bone marrow. Transcription factor (such as Ddbl-GATA-1) and cytokines (such as IL-5, IL-3, and GM-CSF) are essential for their differentiation from an hematopoietic stem cell into the mature eosinophil. Once mature, IL-5 controls the eosinophil migration from the bone marrow to the blood. At baseline, eosinophils localize in the thymus, GI tract, uterus, and mammary gland. Eosinophils are able to express and to secrete, at baseline or upon stimulation, a large variety of mediators (cytokines, granule proteins, lipid mediators, etc.). Eosinophils are putative APC and play a role in mast cell activation, T cell communication, and function.
suggesting that C/EBP functions are required during eosinophil lineage commitment and maturation. PU.1, an ETS transcription factor family member, is only expressed in hematopoietic cells. At an early time point of the differentiation, PU.1 is involved in the switching between lymphoid and myeloid lineage. PU.1 expression level determines the fate of the cell. PU.1 gene-disrupted mice are devoid of B and dendritic cells (DCs), monocytes/macrophages, and mature neutrophils. PU.1 is necessary for dictating monocyte/macrophage and dendritic cell commitment and differentiation, and for neutrophil differentiation. On the other side, high levels of PU.1 lead to an increase myeloid differentiation (McNagny and Graf, 2002; Nerlov and Graf, 1998; Nerlov et al., 1998). In most cells, PU.1 antagonizes with GATA-1, but they have synergistic activity in regulating eosinophil lineage specification and eosinophil granule protein transcription (Du et al., 2002). The interferon consensus sequence binding protein
84
Carine Blanchard and Marc E. Rothenberg
(Icsbp) is also a key transcription factor for eosinophils as demonstrated by loss of eosinophils in Icsbp deficient mice (Milanovic et al., 2008). Of these transcription factors, GATA-1 is clearly the most important for eosinophil lineage specification. Located on the chromosome X in humans and mice, GATA-1 transcription factor was named by its ability to bind the promoter sequence composed of the bases GATA. The GATA-1 binding site is present as a palindromic sequence (double GATA site) in numerous eosinophil related genes (granule protein genes, CC-chemokine receptor 3, IL-5 receptor alpha chain) and in the GATA-1 gene itself (Du et al., 2002; Yu et al., 2002; Zimmermann et al., 2000a). The targeted mutation of the double GATA binding site present in the GATA-1 gene leads to the loss of the eosinophil lineage in mice (Yu et al., 2002). The critical role for GATA-1 in eosinophil lineage was also confirmed by in vitro experiments (Hirasawa et al., 2002; Iwasaki et al., 2005). While expressing GATA-1 in other myeloid cells; mast cells, megakaryocytes, and erythroid cells of the double GATA1 deficient mice, they do not appear to be affected by the mutation in the high affinity palindromic GATA site (Du et al., 2002).
1.1.2. Soluble mediators Cytokines are indispensable for hematopoietic cell development, differentiation and maturation. Located on chromosome 5 in position q31, IL-3, IL-5, and GM-CSF are particularly important in regulating eosinophil development (Lopez et al., 1986, 1988; Rothenberg et al., 1988; Takatsu et al., 1994). In addition to a close proximity on the chromosome and a relative homology of sequence, IL-3, IL-5, and GM-CSF also share the common b chain in their receptor in addition to the specific a chains (Vadas et al., 1994). IL-3 and GM-CSF also induce the differentiation of other myeloid cells such as the mast cell, but IL-3, GM-CSF, and IL-5 synergize toward the differentiation of eosinophils. Indeed, of these three cytokines, IL-5 is the most specific to the eosinophil lineage. In 1995, using a high systemic level of IL-5, after intravenous injection, Collins et al. have shown that mice developed blood eosinophilia and a depletion of bone marrow eosinophils, suggesting that IL-5 stimulates the release of eosinophils from the bone marrow into the peripheral circulation (Collins et al., 1995). But IL-5 is also responsible for selective differentiation of eosinophils and this has been clearly demonstrated in genetically modified animals (Sanderson, 1992). Mice overexpressing IL-5 under the promoter of CD2, have a profound eosinophilia in the blood and spleen but also in the bone marrow (Dent et al., 1990; Lee et al., 1997b; Mishra et al., 2002b; Tominaga et al., 1991). In contrast, IL-5 deficient animals show a marked reduction in eosinophil levels in the blood, and in the tissues in allergic models (Foster et al., 1996; Kopf et al., 1996; Mishra and Rothenberg, 2003).
Biology of the Eosinophil
85
1.2. The mature eosinophil: A complex granulocyte In 1879, Paul Ehrlich reported the avidity of a subtype of blood leukocytes for the acidic stain eosin and thus named these cell types ‘‘eosinophils.’’ The basic components when stained were then identified in the eosinophil granules as major basic protein (MBP), eosinophil cationic protein (ECP), eosinophil peroxidase (EPO), and eosinophil-derived neurotoxin (EDN) (Hamann et al., 1991). Eosinophil granules contain a crystalloid core composed of MBP-1 (and MBP-2), and a matrix composed of ECP, EDN, and EPO (Gleich and Adolphson, 1986). These granules are capable of inducing tissue damage and dysfunction (Gleich and Adolphson, 1986) since MBP, EPO, and ECP are toxic to a variety of tissues, including heart, brain, and bronchial epithelium (Frigas et al., 1980; Gleich et al., 1979; Tai et al., 1982; Venge et al., 1980).
1.2.1. Eosinophil cationic protein (ECP)
ECP was cloned in 1989 by Rosenberg et al. ECP is a small, basic protein found in the matrix of the eosinophil-specific granule that has cytotoxic, helminthotoxic, and ribonuclease activity. On molecular sizing, ECP displays marked heterogeneity, probably as a result of differential glycosylation, with a molecular weight ranging between 16–21.4 kDa. Two isoforms, ECP-1 and ECP-2, have been identified using heparin sepharose chromatography (Gleich and Adolphson, 1986). The cDNA sequence shows 89% sequence identity with that reported for the related granule protein, EDN. The amino acid sequence is 66% homologous to EDN and 31% homologous to human pancreatic ribonuclease including conservation of the essential structural cysteine and catalytic lysine and histidine residues. ECP does have ribonuclease activity but is 100 times less potent than EDN (Slifman et al., 1986). ECP has been shown to possess antiviral activity and causes voltage-insensitive, ion-selective toxic pores in the membranes of target cells, possibly facilitating the entry of other cytotoxic molecules (Gleich and Adolphson, 1986; Rosenberg and Domachowske, 2001; Slifman et al., 1986; Young et al., 1986). ECP also has a number of additional noncytotoxic activities including suppression of T cell proliferative responses, immunoglobulin synthesis by B cells, mast cell degranulation, stimulation of airway mucus secretion, and glycosaminoglycan production by human fibroblasts (Venge et al., 1999).
1.2.2. Major basic protein (MBP) MBP is expressed as two different homologs (MBP-1 and MBP-2) derived from two separate genes. MBP-1 is a small protein that consists of 117 amino acids, with a molecular weight of 13.8 kDa, and a high isoelectric point (>11) which cannot be measured accurately due to its extremely basic nature
86
Carine Blanchard and Marc E. Rothenberg
(Hamann et al., 1991). Mature eosinophils lose the ability to transcribe mRNA encoding MBP-1, indicating that all of the MBP-1 stored in crystalloid granules is synthesized during early eosinophil development prior to maturation (Popken-Harris et al., 1998; Voehringer et al., 2007). MBP2 is exclusively expressed by eosinophils, and may be a more specific marker for elevated eosinophils in patients with eosinophilia than MBP1 (Plager et al., 2006). The toxicity of MBP to helminthic worms has supported the role of eosinophils in host defense (Ackerman et al., 1985; Butterworth, 1984; Gleich, 1986; Gleich and Adolphson, 1986; O’Donnell et al., 1983). MBP has also been shown to be cytotoxic to airways and may be at least partly responsible for tissue damage associated with eosinophil infiltration in bronchial mucosa in asthma (Frigas et al., 1980; Furuta et al., 2005; Hisamatsu et al., 1990). The toxic effect of MBP is thought to result from increased membrane permeability through surface charge interactions leading to perturbation of the cell surface lipid bilayer (Wasmoen et al., 1988). MBP2 is two fold less positively charged than MBP1, and this difference may explain MBP2’s similar, but less potent, in vitro biological activities. While conservation of MBP2’s amino acid sequence (63% identity with MBP1) suggests a common function with MBP1, MBP2’s substantially reduced charge and the existence of the similar murine MBP2 argue for additional, unique functions for MBP2.
1.2.3. Eosinophil peroxidase (EPO) EPO, which has peroxidase activity, is localized in the matrix of the granule. It is composed of two subunits, a heavy chain of 50–57 kDa and a light chain of 11–15 kDa. EPO has 68% sequence identity to the neutrophil myeloperoxidase (MPO). Enzymatic reaction of EPO, but not MPO, is resistant to inhibition by potassium cyanide (Hamann et al., 1991; Ten et al., 1989). EPO constitutes 25% of the total protein mass of specific granules. EPO has been shown to catalyze the oxidation of halides, pseudohalides, and nitric oxide to form highly reactive oxygen species (hypohalous acids), reactive nitrogen metabolites (nitric dioxide), and perioxynitrate-like oxidants. These electrophil species oxidize nucleophil targets on proteins, promoting oxidative stress, and subsequent cell death by apoptosis and necrosis (Agosti et al., 1987; MacPherson et al., 2001; Wu et al., 1999).
1.2.4. Eosinophil-derived neurotoxin (EDN) EDN is an eosinophil granule-derived secretory protein with ribonuclease and antiviral activity. EDN has also been shown to induce the migration and maturation of DCs. Yang et al. (2008) recently reported that EDN is an endogenous ligand of Toll-like receptor (TLR)2 and can activate myeloid DCs by triggering the TLR2—myeloid differentiation factor 88 (Myd88) signaling pathway. In the same study, the authors have also shown that EDN enhanced antigen-specific T helper (Th)2-biased immune responses
Biology of the Eosinophil
87
(IL-5, IL-6, IL-10, and IL-13, and higher levels of IgG1 than IgG2a). EDN thus has the propensity to alert the adaptive immune system for preferential enhancement of antigen-specific Th2 immune responses. While these molecules share similarity in function, they demonstrate differences in their mode of action on helminthic worms. ECP is 8–10 times more potent than MBP. Purified ECP produces complete fragmentation and disruption of schistosomula, whereas MBP produces a distinctive ballooning and detachment of the tegumental membrane. In contrast, EDN is only marginally toxic at high concentrations and causes crinkling of the tegumental membrane (Ackerman et al., 1985). In a recent study, it has been shown that eosinophils, but not other cell types including neutrophils, contain nitrotyrosine-positive proteins in specific granules. Nitration of tyrosine residues has been observed during various acute and chronic inflammatory diseases. This recent study demonstrates that the human eosinophil toxins, EPO, MBP, EDN, ECP, and the respective murine toxins, are posttranslationally modified by nitration of the tyrosine residues during cell maturation. This mechanism depends on the presence of EPO and targets specific single nitration sites at Tyr-349 in EPO and Tyr-33 in both ECP and EDN. The study also suggests that the nitrated tyrosine residues in ECP, EDN, and EPO are surface exposed and occur in mature eosinophils independently of inflammation (Ulrich et al., 2008).
1.3. Eosinophil secretion/degranulation Most secretory cells hold a molecular system allowing docking and fusion of vesicles to the membrane. As such, regulated exocytosis occurs by the formation of a docking complex composed of soluble N-ethylmaleimidesensitive factor attachment protein receptors (SNAREs) located on the vesicle (v-SNAREs) and the target membrane (t-SNAREs). SNAREs are classified into two categories based upon the presence of a conserved amino acid (arginine (R) or glutamine (Q)). Human eosinophils have been shown to express the Q-SNAREs SNAP-23 and syntaxin 4, which are predominantly localized to the plasma membrane (Logan et al., 2002) and the R-SNARE VAMP-2, which is localized to cytoplasmic secretory vesicles. A recent study has shown the IkB kinase 2 phosphorylates SNAP-23 (in an NFKB-independent manner) regulates mast cell degranulation (Suzuki and Verma, 2008). Whether the same mechanism occurs in eosinophils is not known, and regulation of degranulation may follow other pathways. Interestingly, a recent study has shown that purified eosinophil granules express extracellular domains of the receptors for IFN-g and CCR3 and can respond upon stimulation and increase ECP release (Neves et al., 2007).
88
Carine Blanchard and Marc E. Rothenberg
1.4. Eosinophil DNA trap Yousefi et al. have recently demonstrated that eosinophils are able to generate extracellular traps. Previously described in neutrophils, DNA traps from neutrophils have anti-microbial activity, certainly due to the presence of histones. Interestingly, eosinophils rapidly release mitochondrial DNA in response to exposure to bacteria, C5a or CCR3 ligands. In contrast to neutrophils, eosinophils do not undergo cell death upon release of their DNA; in addition, this process requires free radical production via NADP oxidase. The traps contain the granule protein ECP and MBP, and display antimicrobial activity (Yousefi et al., 2008). This indicates that eosinophils may have a role in innate immunity against bacteria, using a unique mechanism.
1.5. Cytokine production Eosinophils have the propensity to synthesize numerous cytokines and growth factors that have implicated eosinophils in numerous homeostatic processes and inflammatory conditions. While usually produced in small amounts in the resting eosinophils, some cytokines are largely induced in inflammatory conditions and triggering of eosinophils by engagement of receptors for cytokines, immunoglobulins, and complement can lead to the secretion of a large variety of proinflammatory cytokines (IL-2, IL-4, IL-5, IL-10, IL-12, IL-13, IL-16, IL-18, and TGF-a/b), chemokines (RANTES and eotaxin-1), and lipid mediators (platelet activating factor and leukotriene (LT) C4). Eosinophils synthesize and release GM-CSF by a peptidyl-prolyl isomerase (PIN1)- dependent mechanism, and this has an autocrine cell survival function (Shen et al., 2005).
2. A ROLE FOR EOSINOPHILS AT BASELINE Some organs are rich in eosinophils, such as the gastrointestinal (GI) tract, spleen, lymph nodes, thymus, mammary glands, and uterus. Their presence in normal conditions suggests a role for eosinophils in some homeostatic processes.
2.1. Eosinophils and reproduction The uterus is home to a large number of eosinophils mainly localized to the endometrial stroma and at the endometrial–myometrial junction (Sferruzzi-Perri et al., 2003). While regulated by IL-5, their presence in the subepithelial stroma is not affected by IL-5 deficiency (Robertson et al., 2000). The infiltration in the uterus is correlated with the expression of eotaxin-1, RANTES, and MIP-1a whose expression is modified by steroid
Biology of the Eosinophil
89
hormones (Gouon-Evans and Pollard, 2001; Robertson et al., 1998; Zhang et al., 2000). Indeed, eotaxin-1 deficient mice have a deficiency of eosinophils in the uterus, and a delay in estrus onset (Gouon-Evans et al., 2002). These suggest a role for eosinophils in uterus maturation. While the role of eosinophils during implantation and pregnancy has yet to be proven, it is interesting to note that eosinophil MBP is ectopically expressed in the uterus by placental X and giant cells (Maddox et al., 1984) during pregnancy, and its production peaks 2–3 weeks before parturition but is not directly related to eosinophils (Wagner et al., 1994). In the mammary gland, increased expression of eotaxin-1 coincides with eosinophil infiltration into the head of the terminal end bud (Gouon-Evans et al., 2000). Using eotaxin-1 deficient mice, the presence of eosinophils in the mammary gland has been associated with the terminal end bud formation and the branching complexity of the ductal tree (Gouon-Evans et al., 2000). Eosinophil participation in mammary gland development might be due to the eosinophil secretion of TGF-b (Gouon-Evans et al., 2000).
2.2. Thymic eosinophils In a compelling study, Throsby et al. have analyzed murine eosinophils in the thymus. Indeed, thymic eosinophils are preferentially recruited during the neonatal period. In mice, the absolute numbers increased 10-fold between 7 and 14 days to reach parity with DCs before diminishing (Throsby et al., 2000). Eosinophils primarily localize to the corticomedullary region of the thymus and reach basal levels by 28 days of age. Subsequently, an increase in thymic eosinophil levels at 16 weeks of age corresponds to the commencement of thymic involution. Notably, eosinophils at this stage localize to the medullary region. Previous studies of eosinophil cytokine expression suggest that different combinations of cytokines may be linked to activation or disease states (Throsby et al., 2000). Thymic eosinophils express TGF-ß and IL-16 mRNA consistent with their wide distribution among leukocytes. Detectable mRNA levels of the proinflammatory cytokines, IL-1a, IL-6, and TNF-a are present in activated eosinophils (Throsby et al., 2000); the expression of eotaxin, IL-2, IL-3, IL-10, IL-12, IFN-g, GM-CSF, and IL-5 are undetectable. GM-CSF and IL-5 have been reported to act as autocrine survival and recruitment factors for activated eosinophils in inflammatory foci (Throsby et al., 2000). However, thymic eosinophils expressed mRNA for the closely related Th2 cytokines IL-4 and IL-13. Both are linked to eosinophil involvement in certain pathologies and are reported to aid recruitment, activation, and survival. Eosinophils can act as antigen presenting cells (APC) and express costimulatory molecules under activating conditions. Throsby et al. have
90
Carine Blanchard and Marc E. Rothenberg
shown that thymic eosinophils are CD11b/CD11c double-positive and express class II molecules and intermediate levels of class I molecules (Throsby et al., 2000). Low surface expression of the costimulatory molecules, CD86 (B7.2) and CD30L (CD153), suggest that thymic eosinophils may be able to present antigens. Matthews et al. demonstrated that the recruitment of eosinophils into the thymus is regulated by eotaxin-1, which is constitutively expressed in the thymus (Matthews et al., 1998). The recruitment of eosinophils and their anatomical localization within discrete compartments of the thymus coincides with negative selection of double positive thymocytes (Throsby et al., 2000). Thymic eosinophils are increased in models of acute negative selection. In addition, eosinophils are associated with clusters of apoptotic bodies suggesting eosinophil-mediated MHC-I-restricted thymocyte deletion. Of note, eosinophils express costimulatory molecules that are involved in clonal deletions such as CD30 ligand (CD153) and CD66 (Throsby et al., 2000) and may promote developing-thymocyte apoptosis since thymic eosinophils have a high level of free radicals due to high levels of NADPH oxidase activity (Throsby et al., 2000).
3. EOSINOPHILS AND IMMUNE REGULATION 3.1. Antigen presentation/T cell proliferation Early studies on the role of eosinophils in antigen presentation and T cell activation have raised controversy. Eosinophils can effectively present soluble antigens to CD4þ T cells, promoting T cell proliferation and polarization (Shi et al., 2000; van Rijt et al., 2003). But the ability of eosinophils to present antigen seems closely linked to the extraction methods. The use, in the lysis buffer, of amonium chloride, an inhibitor of lysosome acidification (needed for antigen presentation), negatively correlates with eosinophil antigen presentation activity (Shi et al., 2000; van Rijt et al., 2003; Wang et al., 2007), likely explaining the discrepancy in the results between studies. Eosinophils are capable of processing and presenting a variety of microbial, viral (human rhinovirus-16) (Handzel et al., 1998), and parasitic antigens, as well as superantigens (Staphylococcus enterotoxins A, B, and E) (Mawhorter et al., 1994) and allergen (MacKenzie et al., 2001) to promote T cell proliferation (Shi, 2004). Eosinophils secrete a panel of cytokines capable of promoting T cell proliferation and activation of Th1 or Th2 polarization (IL-2, IL-4, IL-6, IL-12, IL-10) (Kita, 1996; Lacy and Moqbel, 2000; MacKenzie et al., 2001; Shi et al., 2000). Furthermore, murine eosinophils promote IL-4, IL-5, and IL-13 secretion by CD4þ T cells (MacKenzie et al., 2001; Yang et al., 2008). The eosinophil mediates T cell proliferative and cytokine secretion
Biology of the Eosinophil
91
responses in a CD80, CD86, and CTLA-4-dependent manner (Bashir et al., 2004). Additionally, eosinophils are involved in T cell polarization via indoleamine 2,3-dioxygenase or IDO. IDO is an enzyme involved in oxidative metabolism of tryptophan by converting tryptophan to kynurenines that can regulate Th1 and Th2 imbalance by promoting Th1 cell apoptosis (Odemuyiwa et al., 2004). Fluorescent labeling studies have demonstrated that eosinophils traffic into the draining lymph nodes and localize to the T cell rich paracortical regions (Hogan et al., 2001; Korsgren et al., 1997; MacKenzie et al., 2001; Mishra et al., 2000; Shi et al., 2000). It has been proposed that eosinophils can only promote proliferation of effector T cells, but not naı¨ve T cells (van Rijt et al., 2003). Eosinophils may thus traffic to draining lymph nodes in order to recruit activated effector T cells and promote proliferation of effector T cells.
3.2. Mast cell regulation Eosinophils also have the propensity to regulate mast cell functions, notably through the release of granule protein and cytokines. Incubation of rat peritoneal mast cells with native MBP, EPO and ECP (but not EDN), results in concentration-dependent histamine release (Zheutlin et al., 1984). Human umbilical cord blood derived mast cells can be activated by MBP to release histamine, PGD-2, GM-CSF, TNFa, and IL-8 (Piliponsky et al., 2002). A cross talk exists between mast cells and eosinophils which is characterized by the fact that mast cells are also able to activate eosinophils; for example, the mast cell protease chymase promotes production of eosinophil derived stem cell factor; interestingly, this is a critical mast cell growth factor. Finally, the production by eosinophils of nerve growth factor (NGF) (Solomon et al., 1998), a cytokine involved in mast cell survival and activation (Bullock and Johnson, 1996; Horigome et al., 1994) is induced in an autocrine manner following activation by EPO (Solomon et al., 1998).
4. EOSINOPHIL TRAFFICKING The trafficking of eosinophils involves three interacting components: (1) cytokines that upregulate chemokines, (2) chemokines that activate eosinophils, and (3) adhesion molecules and other molecules (Fig. 3.2).
4.1. The cytokines In inflammatory conditions, a large number of cytokines have been shown to be involved in eosinophil trafficking (most notably the Th2 cell products IL-4, IL-5, and IL-13; Horie et al., 1997; Moser et al., 1992; Sher et al., 1990).
92
Carine Blanchard and Marc E. Rothenberg
Bone marrow
Blood
a mb 2 aLb2 ICAM-1
-1
axin
Eot
IL-5 a 4b1 a 4b7
At baseline Thymus Uterus Mammary glands Gastrointestinal tract
VCAM-1 MAdCAM-1
Endothelial cells
(EGID) Esophagus (EE) Small intestine and colon (EGE/EC)
Eotaxin-3 Eotaxin-1
Eotaxin-1 Eotaxin-2 Eotaxin-3 LTB4
Asthma Lung
TH2 cytokines IL-13/IL-4
FIGURE 3.2 Eosinophil trafficking. Once mature in the bone marrow, IL-5 controls the migration of eosinophils into the blood. At baseline, eotaxin-1 drives eosinophils in the thymus, uterus, mammary gland, and GI tract. Eosinophils express adhesion molecules (integrins) that allow attachment to the endothelial surface (VCAM-1, MadCAM-1, ICAM-1). Tissue chemokine expression allows the formation of a gradient chemotactic that guide the eosinophils in the tissue. In Th2 diseases, Th2 cytokines increase chemokine expression. In the asthmatic lung, eotaxin-1, 2, and 3 are increased and/or involved in chemotaxis of eosinophils, as well as other molecules such as LTB4. In the GI tract, eotaxin-3 is a key player in the eosinophilia observed in EE while eotaxin-1 has been shown to be involved in the lower GI eosinophilic diseases.
Using IL-5 injection, IL-5 neutralization, IL-5 transgenic mice, and IL-5 deficient mice, it has been shown that IL-5 is an essential signal for the expansion and mobilization of eosinophils from the bone marrow into the lung following allergen exposure (Collins et al., 1995; Foster et al., 1996; Hogan et al., 1997). However, antigen-induced tissue eosinophilia can occur independent of IL-5, as demonstrated by residual tissue eosinophils in trials using anti-IL-5 in patients with asthma (Flood-Page et al., 2003c) and IL-5-deficient mice (Foster et al., 1996; Hogan et al., 1997). The role of IL-4 and IL-13 in eosinophil trafficking is mainly indirect, due to their propensity to increase chemokine expression and more particularly eotaxins. Indeed, the IL-4/-13 induces eotaxins by a STAT6-dependent pathway and provides an integrated mechanism to explain the eosinophilia associated with Th2 responses (Zimmermann et al., 2003); however, recent results with IL-13Ra1 deficient mice, have
Biology of the Eosinophil
93
dissociated eosinophilia from IL-13 signaling in the lung (Munitz et al., 2008).
4.2. The chemokines Eotaxins, MCPs, and RANTES are the main chemokines involved in eosinophil trafficking. Three eotaxins have been identified in the human genome: Eotaxin-1, 2, and 3 ( Jose et al., 1994; Rankin et al., 2000; Rothenberg et al., 1995; Zimmermann et al., 2003). Eotaxin-2 and 3 are only distantly related to eotaxin-1 since they are only 30% identical in sequence and are located in a different chromosomal position (Shinkai et al., 1999; Zimmermann et al., 2000b). While not sharing marked sequence homology, their 3-dimensional structure allows the three chemokines to bind to the same receptor: CC chemokine receptor 3 (CCR3). CCR3 is a seven-transmembrane spanning, G-protein coupled receptor primarily expressed on eosinophils (Daugherty et al., 1996; Murphy, 1994; Ponath et al., 1996). Of further interest, CCR3 has been shown to deliver a powerful negative signal in eosinophils, depending on the ligand engaged. For example, pretreatment with the chemokine Mig inhibits eosinophil responses by a CCR3 and Rac2 dependent mechanism (Fulkerson et al., 2005). Genetic manipulation of eotaxin-1 expression and its receptor CCR3 has helped the understanding of their involvement in eosinophil infiltration in the GI tract at baseline, and in the Th2 inflammatory models such as asthma or eosinophilic esophagitis (EE) (Blanchard et al., 2006b). In an asthma model, using CCR3 deficient animals, the involvement of CCR3 in eosinophil accumulation in the lung has been shown to be modest or more marked depending on the sensitization route used (systemic or epicutaneous, respectively) (Humbles et al., 2002; Ma et al., 2002) or the origin of the mice (Pope et al., 2005). Studies suggest that tissue and cell specificity of the expression of eotaxin-1, 2, and 3, in addition to a different kinetic expression and affinity for CCR3, influences the course of asthma pathogenesis (Zimmermann et al., 2003). Indeed, using eotaxin-1 and 2 single and double gene-deficient mice or neutralizing antibodies, both chemokines, eotaxin-1 and 2, have been shown to have nonoverlapping roles in regulating the temporal and regional distribution of eosinophils in an allergic inflammatory site in asthma models (Gonzalo et al., 1998; Pope et al., 2005; Rothenberg et al., 1997). In humans, experimental induction of cutaneous, pulmonary, and intestinal responses have demonstrated that the eotaxin chemokines are produced by both tissue resident cells (e.g., respiratory epithelial cells and skin fibroblasts) and allergen-induced infiltrative cells (e.g., macrophages and eosinophils) (Ahrens et al., 2008). Finally, the time course of eotaxin
94
Carine Blanchard and Marc E. Rothenberg
expression in the lung is organized kinetically. Eotaxin-1 is induced early (6 h) and correlates with early eosinophil recruitment; in contrast, eotaxin2 and 3 correlate with eosinophil accumulation at 24 h (Zimmermann et al., 2003). Additionally, antibodies against RANTES, MCP-3, MCP-4, and eotaxin-1 are able to inhibit the chemotactic activity of the bronchoalveolar lavage fluid (Zimmermann et al., 2003). Finally, single nucleotide polymorphisms (SNPs) in the eotaxin-1, 2, and 3 genes have been associated with atopy, IgE levels, eosinophilia, improved lung function (e.g., FEV1), and EE, further supporting an important role for eotaxins in human allergic diseases (Blanchard et al., 2006b; Chae et al., 2005; Nakamura et al., 2001).
4.3. Adhesion molecules The involvement of adhesion molecules has been demonstrated mainly in inflammatory models and/or at baseline in the GI tract. Eosinophils express numerous adhesion molecules; some are highly expressed (Bochner and Schleimer, 1994).
4.3.1. The CD18 family of molecules or lymphocyte function antigen (LFA)-1 and Mac-1 Highly expressed by eosinophils, these molecules interact with endothelial cells via intercellular adhesion molecule (ICAM)-1. Indeed, despite the availability of alternate adhesion pathways in ICAM-1 deficient mice, the absence of ICAM-1 prevented eosinophils from entering the airways, although this reduction is due, in part, to the important role of ICAM-1 in ligand mediating T-cell proliferation in response to antigen.
4.3.2. Integrin a4b7
The a4b7 integrin interacts with the mucosal addressin cell adhesion molecule-1 (MAdCAM-1). MadCAM-1 is expressed by the vascular endothelium, more particularly in the intestinal tract. b7 gene targeted mice display a delay and reduced magnitude in the development of intestinal eosinophilia following Trichinella spiralis infection (Artis et al., 2000) and when the intestinal eotaxin-1 transgene is expressed. However, no changes in the baseline level of small intestine eosinophils are seen in b7 deficient mice (Mishra et al., 2002b).
4.3.3. The very late antigen (VLA)-4 molecules (b1-integrins) VLA-4 interacts with endothelial cells via vascular cell adhesion molecule (VCAM)-1 and fibronectin. Anti-b1 treated mice and VLA-4-deficient mice have demonstrated the critical participation of these integrin molecules in regulating eosinophil trafficking to the allergic lung (Gonzalo et al., 1996; Nakajima et al., 1994; Pretolani et al., 1994).
Biology of the Eosinophil
95
4.3.4. Periostin Finally, in asthma and EE models, it has recently been shown that the extracellular matrix protein periostin, an IL-13 induced gene that is highly overexpressed in EE patients compared to control biopsy samples, correlates with eosinophil numbers in the biopsies. Interestingly, in experimental asthma and EE, periostin-deficient mice have decreased eosinophil recruitment to the lung and the esophagus. A direct role of periostin on eosinophil adhesion was shown in vitro using spleen eosinophils from CD2-IL-5 transgenic mice. This study suggests that periostin facilitates eosinophil infiltration in the tissues (Blanchard et al., 2008).
4.4. Other molecules involved in eosinophil trafficking The arachidonic acid metabolites have been implicated in eosinophil trafficking. In particular, LTB4, the cysteinyl-LTs (LTC4, LTCD4, and LTE4), and prostaglandin (PG) D2 are thought to participate in eosinophilia. Indeed, cysteinyl LT-type-1-receptor antagonists have been shown to reduce blood and lung eosinophilia. Additionally, mice with the targeted deletion of the LTB4 receptor have markedly reduced allergeninduced lung eosinophilia (Tager et al., 2000). The high affinity PGD2 type 2 receptor or (chemoattractant receptor Th2 cells (CRTH2)) has been shown to mediate Th2 cell and eosinophil/basophil recruitment (Hirai et al., 2001). Eosinophils have also been shown to express high levels of the histamine receptor 4 (H4) that mediates eosinophil chemoattraction and activation in vitro (O’Reilly et al., 2002). Additionally, the induction of 15-lipoxygenase-1 (15-LO-1), an enzyme involved in the arachidonic pathway, has been observed in the airways of subjects with asthma. LOX15 is a Th2 induced gene and has been reported in several other Th2 mediated diseases, such as EE (Blanchard et al., 2006b). In a recent study, it has been shown that 12/15-LO knockout mice are protected from the development of mucosal allergic sensitization and airway inflammation but not against a systemic model involving IP sensitization. This suggested the presence of a lung-restricted protective role for 12/15LO deficiency that potentially accounts for activation of mucosal B cells and increased production of secretory IgA (Hajek et al., 2008). Eoxins (EXs) are new proinflammatory arachidonic acid metabolites produced via the 15-lipoxygenase pathway in human eosinophils and mast cells. These compounds were uncovered after incubation of eosinophils with exogenous arachidonic acid. Because eosinophils are such an abundant source of these metabolites and to avoid confusion with LTs, these new compounds were named EX-C4, D4, and E4. Interestingly, cord bloodderived mast cells and surgically removed nasal polyps from allergic subjects produce EXC4. Eosinophils produce EXC4 after challenge with the proinflammatory agents LTC4, PGD2, and IL-5, demonstrating that
96
Carine Blanchard and Marc E. Rothenberg
EXC4 can be synthesized from the endogenous reservoir of arachidonic acid. EXs can increase permeability of endothelial cell monolayer in vitro, a hallmark of inflammation. Interestingly, in this study, the authors also demonstrate that EXs are 100 times more potent than histamine and almost as potent as LTC4 and LTD4 (Feltenmark et al., 2008). Recent attention has been given to chitin, a polymer that provides structural rigidity to fungi, crustaceans, helminths, and insects. When given intranasally to mice, chitin induces the accumulation in tissue of eosinophils. This effect is reduced when the injected chitin was pretreated with the IL-4 and IL-13-inducible mammalian chitinase, or if the chitin was injected into mice that overexpressed AMCase. Indeed, chitin mediates the production of LTB4, which is required in this model for optimal eosinophil recruitment (Reese et al., 2007).
4.5. Negative regulation of eosinophil trafficking Leukocyte negative signaling is an important process involved in homeostatic, inflammatory, and repair responses, yet these processes have not yet been examined in eosinophils. A recent study has shown that the paired immunoglobulin-like receptor B (PIR-B), an inhibitory receptor of the Ig superfamily, is highly expressed by eosinophils. Notably, PIRB deficient mice have increased GI eosinophils and evidence that PIR-B directly negatively regulates eotaxin-dependent eosinophil chemotaxis in vivo and in vitro has been demonstrated (Munitz et al., 2008).
5. ROLE OF EOSINOPHILS IN DISEASE Eosinophils are multifunctional leukocytes implicated in the pathogenesis of numerous inflammatory processes (Fig. 3.3).
5.1. Infections 5.1.1. Helminth Eosinophil function has primarily been associated with its contribution in host defense against parasitic infection. Several studies using helminth infection models have evaluated the propensity of eosinophils to (1) mediate antibody (or complement) dependent cellular toxicity against helminths in vitro (Butterworth, 1977), (2) to aggregate, (3) to degranulate in the local vicinity of damaged parasites in vivo during helminthic infections, and (4) to be required in experimental parasite infected mice that have been depleted of eosinophils by IL-5 neutralization and/or gene targeting (Behm and Ovington, 2000). Humans and rodents do not share many common natural helminthic hosts making the studies difficult to
97
Biology of the Eosinophil
Beneficial
Pathological Aero allergen Helminthic worm Pollen
Allergy
Parasitic infection (No direct evidence of their involvement on parasitic burden using Δdbl-GATA-1 and PHIL)
Viral infection
Airway hyperreactivity (PHIL and Δdbl-GATA-1 C57Bl/6) Mucus production (PHIL and Δdbl-GATA-1) Th2 cytokine production (PHIL and Δdbl-GATA-1) Collagen deposition (Δdbl-GATA-1 BALB/c)
Virus
(Ribonuclease effective on RNA virus such as RSV, PVM)
Food allergen
EGID Possibly involved in tissue damage Fugus
Fungal infection (Beta 2 integrin adhere to the fungal wall component b-glucan) Bacteria
Bacterial infection
HES
4q
Involved in tissue damage
Chromosome mutation 4p (FIP1L1-PDGFRA)
(Mitochondrial DNA traps containing granule proteins in peritonitis have antimicrobial activity)
FIGURE 3.3 Eosinophil function. Eosinophils are believed to have a beneficial role in helminthic infection while no direct evidence was provided in the eosinophil depleted mice. Ribonuclease in granules displays antiviral property on RNA virus such as RSV. Eosinophils are able to bind to fungal wall via their b2 integrin chain. Finally, DNA traps possess antibacterial activities. Eosinophils are involved in the pathological features of several diseases. In asthma, using eosinophil depleted mice (Ddbl-GATA-1 and PHIL) eosinophils have been shown to be involved in AHR, mucus production, TH2 cytokine production, and collagen deposition. The role of eosinophils in EGID and HES might lead to tissue damage but needs to be better studied.
interpret. A role for IL-5 in protective immunity has been suggested following infection with Strongyloides venezuelensis, Strongyloides ratti, Heligmosomoides polygyrus, and Nippostrongyloides brasiliensis (Behm and Ovington, 2000; Korenaga et al., 1991). The contribution of other IL-5 receptor bearing cells, such as B cell and basophils (Bischoff et al., 1990; Erickson et al., 2001; Hakonarson et al., 1999; Sanderson, 1992), has not been ruled out in this model. The analysis of CCR3 and eotaxin-1-deficient mice has suggested a role for eosinophils in controlling the Brugia malayi microfilariae infection and in the encystment of larvae in Trichinella spiralis (Gurish et al., 2002; Simons et al., 2005); but the ultimate evidence for a role of eosinophils in host defense against parasites has not been provided yet. Swartz et al. explored the role of eosinophils in host defense against helminthic parasites in Schistosoma mansoni infection model in the two eosinophil lineage ablation mice lines (DdblGATA and PHIL). They found that eosinophil ablation had no effect on worm burden or on egg deposition, indicating that eosinophil ablation has no impact on traditional measures of disease in the S. mansoni infection model in mice. However,
98
Carine Blanchard and Marc E. Rothenberg
the authors concluded: ‘‘eosinophils may have unexplored immunomodulatory contributions to this disease process’’ (Swartz et al., 2006).
5.1.2. Viral infection Eosinophil granule proteins are known for their ribonuclease activity (such as human ECP and EDN, and at least 11 eosinophil associated ribonucleases (EAR) orthologs in mice) and have been shown to degrade single stranded RNA containing viruses (Rosenberg and Domachowske, 2001). Interestingly, it has recently been shown that viruses (parainfluenza virus, respiratory syncytial virus (RSV), or rhinovirus) induce the release of EPO by eosinophils when coincubated in the presence of antigen-presenting cells and T cells (Davoine et al., 2008). Eosinophils may also have a protective role in other infections, especially against RNA viruses, such as RSV and the related natural rodent pathogen, pneumonia virus of mice (PVM), in vivo (Adamko et al., 1999; Rosenberg and Domachowske, 2001). Despite divergence of the coding regions, (Rosenberg and Domachowske, 2001), the conserved ribonuclease activity of these molecules across species, suggests a strong evolutionary pressure to preserve this critical enzymatic activity. Paradoxally, in vitro study has shown that eosinophils may be an important reservoir for the HIV-1 virus in vivo (Freedman et al., 1991).
5.1.3. Fungal infection Recent investigation has focused on the role of eosinophils in fungi infections. Indeed, eosinophils release their cytotoxic granule proteins into the extracellular milieu and onto the surface of fungal organisms and kill fungi in a contact-dependent manner. Yoon et al. has recently shown that eosinophils use their versatile b2-integrin molecule, CD11b, to adhere to a major cell wall component, b-glucan, but eosinophils do not express other common fungal receptors, such as dectin-1 and lactosylceramide. The I-domain of CD11b is distinctively involved in eosinophil interaction with b-glucan. Interestingly, eosinophils do not react with chitin, another fungal cell wall component (Yoon et al., 2008).
5.1.4. Bacterial infection As previously discussed, eosinophils rapidly release mitochondrial DNA in response to exposure to bacteria, C5a or CCR3 ligands. The traps contain the granule protein ECP and MBP, and display antimicrobial activity (Yousefi et al., 2008). In the extracellular space, the mitochondrial DNA and the granule proteins form extracellular structures that bind and kill bacteria both in vitro and under inflammatory conditions in vivo. After cecal ligation and puncture, IL5-transgenic but not wild-type mice show intestinal eosinophil infiltration and extracellular DNA deposition in association with protection against microbial sepsis. This data suggests
Biology of the Eosinophil
99
a previously undescribed mechanism of eosinophil-mediated innate immune responses that might be crucial for maintaining the intestinal barrier function after inflammation-associated epithelial cell damage, preventing the host from uncontrolled invasion of bacteria (Yousefi et al., 2008).
5.2. Role of eosinophils in asthma Granule proteins, such as MBP, have been found in bronchoalveolar lavage fluid from patients with asthma in sufficient concentrations to induce cytotoxicity of a variety of host tissue including respiratory epithelial cells in vitro (Rothenberg, 1998). As previously discussed, MBP has been indirectly involved in airway hyperreactivity (AHR) due to the ability to directly increase smooth muscle reactivity ( Jacoby et al., 1993). In addition to its effect on tissue, MBP can trigger the degranulation of mast cells and basophils which may also be involved in disease pathogenesis (Rothenberg, 1998). Additionally, eosinophils generate large amounts of the cysteinyl LTs (Bandeira-Melo et al., 2002) that may lead to increased vascular permeability, mucus secretion, and are potent smooth muscle constrictors. Indeed, inhibitors of cysteinyl LTs are effective therapeutic agents for the treatment of allergic airway disease. However, during the past decade, the exact involvement of eosinophils in asthma pathogenesis has been very controversial due to the gap between rodent models, murine strains, and contradictory observation in human disease. (1) While observed in humans, eosinophil degranulation is not always consistent in murine models (Denzler et al., 2000; Shinkai et al., 2002). (2) Elevated levels of blood and/or lung eosinophils are not constitutively associated with lung changes in studies with transgenic mice overexpressing IL-5 (in T cells, lung epithelial cells, or enterocytes) (Dent et al., 1990; Lee et al., 1997a,b; Mishra et al., 2002b; Tominaga et al., 1991). (3) Neutralization of IL-5 or IL-5 deficient mice, have reduced lung eosinophilia in allergen challenged lungs, (Foster et al., 1996, 2001; Hamelmann and Gelfand, 2001; Hogan et al., 1998; Mattes et al., 2002) but this reduction is not total (Corry et al., 1996; Foster et al., 1996; Hamelmann et al., 1997) and does not always correlate with lung function (AHR). For example, antigen-induced AHR occurs in allergic IL-5-deficient BALB/c mice but not in IL-5-deficient mice of the C57BL/6 strain (Foster et al., 1996, 1997). (4) A modest effect is seen in human asthma studies using anti-IL-5 antibodies. Patients with mild to moderate asthma were shown to have decreased circulating and sputum eosinophil levels (Leckie et al., 2000); however, no clinical benefit (e.g., improvement
100
Carine Blanchard and Marc E. Rothenberg
in FEV1) was demonstrated. Indeed, clinical studies have shown that AHR correlates with mast cell localization near pulmonary nerves, whereas pulmonary eosinophilia relates more strongly with chronic cough (Brightling et al., 2002). The role of eosinophils in asthma has also been investigated by targeting the receptor CCR3 and its eotaxin ligands. Using these strategies, the depletion of murine eosinophils in the lung has suggested an important role for eosinophils in the development of asthma associated AHR (Justice et al., 2003). However, all these studies, using neutralizing antibody or deficient mice, do not account for the possible action of these molecules on other cell types. Indeed, two different lines of eosinophil-deficient mice were developed almost simultaneously, using two different approaches. (1) The PHIL mice. Lee et al. targeted eosinophils using the EPO promoter to drive expression of diphtheria toxin A chain (Lee et al., 2004b). The eosinophil-deficient character of these mice (called PHIL mice) was assessed by examination of peripheral blood and by immunohistochemistry of tissues with such as bone marrow, uterus, small intestine, and thymus using antibodies specific for eosinophil granule proteins. (2) The Ddbl-GATA mice. In comparison, Yu et al. developed mice harboring a deletion of a high affinity GATA binding site in the GATA-1 promoter (Ddbl-GATA) which led to the specific ablation of the eosinophil lineage (Humbles et al., 2004). RT-PCR analysis of gene expression in the bone marrow of the Ddbl-GATA mice revealed no expression of EPO, but expression of MBP was only partially reduced and CCR3 expression remained unchanged. Eosinophil deficiency in these mice was assessed by morphological observation of cells from the blood, bone marrow, and spleen. Indeed, utilizing both eosinophil-deficient mice, eosinophils were shown to have an integral role in experimental allergic asthma. However, their specific contribution toward allergen-induced airway hyperresponsiveness and mucus cell metaplasia was different. It is possible that DdblGATA mice have residual eosinophils or unappreciated hematological abnormalities, or that alternatively, diptheria toxin treatment of PHIL mice may induce toxic effects on noneosinophil cells. It should be noted that Ddbl-GATA mice had impaired development of lung remodeling in a chronic model of asthma, consistent with the results of anti-human IL-5 in patients with asthma (Foster et al., 2002; Kips et al., 2003). In addition, in a recent study, Walsh et al. reported that in contrast to results obtained on a BALB/c background, eosinophil-deficient C57BL/6 Ddbl-GATA mice have reduced airway hyperresponsiveness, and cytokine production of
Biology of the Eosinophil
101
IL-4, 5, and 13 in OVA-induced allergic airway inflammation. This was caused by reduced T cell recruitment into the lung, as these mouse lungs had reduced expression of CCL7/MCP-3, CC11/eotaxin-1, and CCL24/ eotaxin-2. These studies indicate that on the C57BL/6 background, eosinophils are integral to the development of airway allergic responses by modulating chemokine and/or cytokine production in the lung, leading to T cell recruitment (Walsh et al., 2008). Finally, recent attention has been drawn to the contribution of eosinophils in regulating T cell responses in the asthmatic lung. The current paradigm surrounding allergen-mediated Th2 immune responses in the lung suggests an almost hegemonic role for T cells. Lee et al. proposed an alternative hypothesis implicating eosinophils in the regulation of pulmonary T cell responses. This was supported by OVA-sensitized/challenged mice devoid of eosinophils (the transgenic line PHIL) that have reduced airway levels of Th2 cytokines that correlated with a reduced ability to recruit effector T cells to the lung. Indeed, they have shown that adoptive transfer of Th2-polarized OVA-specific transgenic T cells (OT-II) alone into OVA-challenged PHIL recipient mice failed to restore Th2 cytokines, airway histopathologies, and, the recruitment of pulmonary effector T cells (Jacobsen et al., 2008). Using Aspergillus fumigatus-induced allergic airway inflammation, Fulkerson et al. have shown that mice deficient in CCR3, mice deficient in both eotaxin-1 and 2 and DdblGATA have eosinophilic infiltration abolished by 94%, 98%, and 99%, respectively. Importantly, Th2 lymphocyte cytokine production and allergen induced-mucus production were impaired in the lung of eosinophil and CCR3-deficient mice (Fulkerson et al., 2006). All together these studies present multiple lines of independent evidence that eosinophils have a central role in chronic allergic airway disease.
5.3. Atopic dermatitis In spite of the progress regarding the description of immunological phenomena associated with atopic dermatitis (AD), the pathogenesis of this disease still remains unclear. The presence of eosinophils in the inflammatory infiltrate of AD has long been established. Eosinophil numbers as well as eosinophil granule protein levels in peripheral blood are elevated in most AD patients and appear to correlate with disease activity. Moreover, eosinophil granule proteins, which possess cytotoxic activity, are deposited in the skin lesions. Interestingly, Davis et al. have shown abundant MBP positive staining in the skin of AD patients even in the absence of eosinophils (Davis et al., 2003). These observations indicate a role for eosinophils in the pathogenesis of AD. Furthermore, AD is associated with increased production of T helper 2 cytokines including IL-5 and IL-4. In AD, IL-5 would specifically act on eosinophils, resulting in accelerated eosinophilopoiesis, chemotaxis, cell activation, and delayed apoptosis
102
Carine Blanchard and Marc E. Rothenberg
and IL-4 would be responsible for the Th2 response and eosinophil specific chemokine production. Therefore, IL-5 is an interesting target for experimental therapy in this inflammatory disorder of the skin. Such studies might result in new insights into the pathogenic role of eosinophils in AD.
5.4. GI disorders While present in multiple tissues, only GI eosinophils are associated with a marked eosinophil degranulation (Kato et al., 1998). In healthy patients or normal mice, eosinophils are present in the lamina propria throughout the GI tract from the stomach to the colon (DeBrosse et al., 2006; Kato et al., 1998). However, eosinophils are not found in Peyers patches, or intraepithelial locations (Mishra et al., 2000; Rothenberg, 2004; Rothenberg et al., 2001a,b). Murine models have demonstrated that eosinophil infiltration in the GI tract is not dependent upon the colonic flora or the endotoxin load of the gut as assessed by the high eosinophil level observed in prenatal mice (Mishra et al., 1999). Indeed, germ-free mice have normal levels of GI eosinophils. The accumulation of eosinophils in the GI tract is a common feature of numerous disorders such as drug reactions, helminth infections, gastroesophageal reflux disease, HES, eosinophilic gastroenteritis (EGE), allergic colitis and inflammatory bowel disease (Rothenberg, 2004). A subset of these diseases, are referred to as primary eosinophilic GI disorders (EGID), including EE, eosinophilic gastritis (EG), and EGE. EGID usually occurs independent of peripheral blood eosinophilia, indicating the significance of GI-specific mechanisms for regulating eosinophil levels. Interestingly, the intestine of eotaxin-1 deficient mice is almost completely devoid of eosinophils (Matthews et al., 1998; Mishra et al., 1999); and similar results were observed in CCR3 deficient mice, which show a decreased eosinophil level at baseline, in the jejunum. The residual presence of eosinophils in the GI tract of CCR3 deficient mice and eotaxin-1 deficient mice suggest a modest involvement of other chemotactic factors for eosinophils in the jejunum (Gurish et al., 2002; Humbles et al., 2002; Matthews et al., 1998). Under baseline conditions, the receptor PIR-B, expressed by eosinophils, provides an inhibitory signal that limits eosinophil accumulation into the GI tract, including the esophagus (Munitz et al., 2008). While absent in the normal esophagus, eosinophils markedly accumulate in the esophagus of EE patients. A minimum of 15 eosinophils per high power field is now used as pathological criteria for EE (Gonsalves et al., 2006; Lim et al., 2004; Potter et al., 2004; Furuta et al., 2007). Murine models have demonstrated that IL-5 maintains the systemic eosinophil levels needed for esophageal eosinophilia accumulation (Mishra et al., 1999, 2002a). Substantial evidence is accumulating that human EE is also associated with a Th2 type immune response and local or systemic Th2 cytokine
Biology of the Eosinophil
103
overproduction; IL-5 mRNA expression is induced in the biopsies of EE patients compared to healthy controls ((Straumann et al., 2001, 2005) and unpublished data)). Eosinophil accumulation has been shown to be CCL11/eotaxin-1 and CCR3 dependent using the respective gene targeted mice (Blanchard et al., 2006b; Mishra and Rothenberg, 2003). However, eosinophils are still infiltrating the esophagus of CD2-IL-5tg/CCL11KO mice, suggesting that other factors are involved (Mishra et al., 1999). In human EE, eotaxin-3 expression strongly correlates with eosinophil numbers (Blanchard et al., 2006b). Other factors such as chemokines, extracellular matrix component (periostin) or adhesion molecules may facilitate the entry of eosinophils in esophageal tissue. Eotaxin-3 is a Th2 induced molecule and interestingly, IL-13 has recently been shown to induce 20% of the EE transcriptome, and in particular, to induce eotaxin-3 expression in primary esophageal epithelial cells (Blanchard et al., 2007). Interestingly, the EE transcriptome of the diseased biopsies revealed that the accumulation of esophageal eosinophils is not associated with an increase in eosinophil specific transcripts (Blanchard et al., 2006b). As discussed earlier, Locksley’s group demonstrated that eosinophil granule protein mRNAs were detectable in the early development of eosinophils but not once the eosinophils infiltrate into the tissues (Voehringer et al., 2007). Therefore, although not actively transcribed in the esophagus, granule proteins, such as MBP, EPO and EDN are present in the esophageal eosinophils, and MBP deposition has been detected by immunohistochemistry, in EE patient esophageal biopsies. As such, granule proteins may influence disease via their cytotoxic activity. Indeed, most of the published models so far have shown an association between lung and esophageal eosinophilia; but EE and AD also share common features, including squamous epithelial cell hyperplasia, eosinophil infiltration, eosinophil degranulation, suggesting that common pathogenic mechanisms may be taking place. While in human AD, eotaxin-3 is also increased, two murine models have shown that skin sensitization primes for EE (Akei et al., 2005, 2006). Epicutaneous exposure to the allergens OVA or A. fumigatus induces ADlike skin inflammation but eosinophils do not migrate into the esophagus despite a strong systemic Th2 response, chronic cutaneous antigen exposure, accelerated bone marrow eosinophilopoiesis and circulating eosinophilia. However, when epicutaneously sensitized mice are subsequently exposed only once to intranasal antigen, esophageal eosinophilia (and lung inflammation) is powerfully induced (Akei et al., 2005, 2006). Collectively, these experimental systems demonstrate an intimate connection between the development of eosinophilic inflammation in the respiratory tract, the skin and esophagus.
104
Carine Blanchard and Marc E. Rothenberg
There is a paucity of studies on the molecular pathogenesis of EG, EGE, and EC, mainly due to the lack of murine models. In mice, the overexpression of eotaxin-1 by epithelial cells is sufficient to induce intestinal eosinophilia in eotaxin-deficient mice suggesting a possible role for eotaxin-1 in small bowel eosinophilia (Mishra et al., 2002a). Additionally, RANTES expression has been shown to correlate with eosinophilia in food allergy model in mice (OVA) (Lee et al., 2004a) and, like eotaxin-1, RANTES mRNA is highly expressed in the jejunum of mice (Lee et al., 2004a). RANTES is expressed at baseline in the human GI tract and may contribute to hematopoietic cell recruitment in healthy and in EGID patients (Beyer et al., 2002). RANTES is increased in the colon of AD patients (Yamada et al., 1996) and in a rat colitis model (Ajuebor et al., 2001). No studies on RANTES deficient mice have determined the ultimate role of this cytokine in eosinophil recruitment at baseline and in EGID. Using an experimental GI allergy model an essential role for eotaxin-1 in regulating eosinophil-associated GI pathology (Forbes et al., 2004), as well as the development of eosinophilia in DSS-induced colitis has been demonstrated (Hogan et al., 2000). Indeed the use of eosinophil deficient mice will uncover the role of eosinophils in these GI models.
5.5. Hyper eosinophilic diseases Idiopathic HES and chronic eosinophilic leukemia (CEL) are related hematological malignancies characterized by sustained, unexplained hypereosinophilia (>1500 eosinophils/microL). The term CEL is used when there is evidence that the disease is of clonal origin. A subset of patients with HES have a 800 kb interstitial deletion on chromosome 4 (4q12) that results in the fusion of an unknown gene Fip1-like1 (FIP1L1) with the platelet derived growth factor receptor-a (PDGFRA) (Cools et al., 2003, 2004). Dysregulated tyrosine kinase activity by the FIP1L1-PDGFRA fusion gene has been identified as a cause of clonal HES, called FIP1L1PDGFRA-positive CEL in humans. However, transplantation of FIP1L1PDGFRA-transduced hematopoietic stem cells/progenitors (HSC/Ps) into mice results in a chronic myelogenous leukemia-like disease, which does not resemble HES. Because a subgroup of patients with HES show T-cell-dependent IL-5 overexpression, the expression of the FIP1L1PDGFRA fusion gene in the presence of transgenic T-cell IL-5 overexpression in mice induces HES-like disease was studied. Mice that received a transplant of CD2-IL-5-transgenic FIP1L1-PDGFRA positive HSC/Ps (IL-5Tg-F/P) developed intense leukocytosis, strikingly high eosinophilia, and eosinophilic infiltration of nonhematopoietic as well as hematopoietic tissues, a phenotype resembling human HES. The disease phenotype was transferable to secondary transplant recipients, suggesting involvement of a short-term repopulating stem cell or an early
Biology of the Eosinophil
105
myeloid progenitor. Induction of significant eosinophilia is in this model specific for FIP1L1-PDGFRA since expression of another fusion oncogene, p210-BCR/ABL, in the presence of IL-5 overexpression is characterized by a significantly lower eosinophilia than IL-5Tg-F/P recipients. These results suggest that FIP1L1-PDGFRA fusion gene is not sufficient to induce a HES/CEL-like disease but requires a second event associated with IL-5 overexpression (Yamada et al., 2006).
6. ANTIEOSINOPHIL THERAPEUTICS 6.1. Therapeutics available Several therapeutics help in the control of systemic and tissue eosinophilia (Rothenberg and Hogan, 2005). (1) Glucocorticoids are the most common agents for reducing eosinophilia (Rothenberg, 1998). They seems to act on the transcription of a number of genes for inflammatory mediators including the genes for IL-3, IL-4, IL-5, GM-CSF, and various chemokines including the eotaxins. Glucocorticoids have also been shown to destabilize the mRNA of eosinophil active cytokines; thus, reducing the half-life of cytokines, such as eotaxins (Stellato et al., 1999). In addition, glucocorticoids inhibit the cytokinedependent survival of eosinophils (Schleimer and Bochner, 1994). Systemic or topical (inhaled or intranasal) glucocorticoid treatment causes a rapid reduction in eosinophils. Systemic and topical glucocorticoids are indeed widely used in controlling eosinophil infiltration in EE, when the diet modification is too restricting (Aceves et al., 2005; Blanchard et al., 2006a; Konikoff et al., 2006; Rothenberg et al., 2001c). Unfortunately long-term use of glucocorticoids is usually accompanied by side effects. Indeed glucocorticoids are not effective for everyone since some patients are glucocorticoid-resistant and maintain eosinophilia despite high doses (Barnes and Adcock, 1995). The mechanism of glucocorticoid resistance is unclear, but a reduced level of glucocorticoid receptors, polymorphism and alterations in transcription factor activator protein-1 (AP-1) appear to be at least partially responsible in some of them (Barnes and Adcock, 1995). Glucocorticoid-resistant patients thus require other therapy such as myelosuppressive drugs (hydroxyurea, vincristine) or a-interferon (Rothenberg, 1998). (2) a-Interferon can be especially helpful because it inhibits eosinophil degranulation and effector function (Aldebert et al., 1996). Notably, patients with myeloproliferative variants of HES can often go into remission with a-interferon therapy.
106
Carine Blanchard and Marc E. Rothenberg
(3) Cyclosporine A has also been used because it blocks the transcription of numerous eosinophil-active cytokines (e.g. IL-5, GM-CSF) (Meng et al., 1997; Rolfe et al., 1997). (4) Lidocaine is another drug that has been shown to shorten eosinophil survival, and while its effects mimic those of glucocorticoids they are noncytotoxic (Bankers-Fulbright et al., 1998). Indeed, a clinical trial has shown that nebulized lidocaine is effective in subjects with asthma (Hunt et al., 2004). (5) The arachidonic acid products are also targeted and drugs that interfere with eosinophil chemotactic signals include LT antagonists and inhibitors. For example, 5-lipoxygenase inhibition blocks the ratelimiting step in LT synthesis and inhibits the generation of the eosinophil chemoattractant, LTB4, and the cysteinyl LTs (Kane et al., 1996). The inhibition of cysteinyl LT receptor, using antagonists blocks the increased vascular permeability mediated by leukocyte-derived LTs (Gaddy et al., 1992). (6) Some of the third generation antihistamines inhibit the vacuolization (Snyman et al., 1992) and accumulation (Redier et al., 1992) of eosinophils after challenge and directly inhibit eosinophils in vitro (Rand et al., 1988; Snyman et al., 1992). (7) Cromoglycate and nedocromil inhibit the effector function of eosinophils such as antibody-dependent cellular cytotoxicity (Rand et al., 1988). (8) Imatinib therapy. The etiology of the primary disease often specifies the best therapeutic strategy. Patients with HES with FIP1L1PDGFRAþ disease are now treated with Imatinib mesylate or STI 571 as first line therapy (Gleich et al., 2002). This anti-tyrosine-kinase was the first of its categories to be prescribed in patients and has been shown active on non-FIP1L1-PDGFRAþ cancer patients. Indeed, a variety of other activated tyrosine kinases have been associated with HES including PDGFR-b, Janus kinase-2, and fibroblast growth factor receptor-1 (Klion, 2005). (9) Alemtuzumab is a monoclonal anti-CD52 antibody that depletes CD52þ cells including lymphocytes; it is used in the treatment of chronic lymphocytic leukemia (CLL) and T-cell lymphoma. As CD52þ cells, it was hypothesized that eosinophils may also be depleted by this therapy. Indeed, recent clinical trials have shown that Alemtuzumab can lower eosinophils and induced disease remission in patients with refractory idiopathic HES with abnormal T cells (CD3CD4þ) (Pitini et al., 2004; Sefcick et al., 2004). This targeted therapy hold great promise for the treatment of certain HES patients who are resistant to other therapies.
Biology of the Eosinophil
107
6.2. Therapeutics in development The identification of molecules that specifically regulate eosinophil function and/or production offers new therapeutic strategies in the pipeline. Agents that interrupt eosinophil adhesion to the endothelium through the interaction of CD18/ICAM-1 (Wegner et al., 1990) or VLA-4/VCAM-1 may be useful (Kuijpers et al., 1993; Weg et al., 1993). Inhibitors of the IL13/eotaxin/CCR3 axis including small molecule inhibitors of CCR3 and a human anti-human eotaxin-1 and IL-13 antibody are being developed (Blanchard et al., 2005; Zimmermann et al., 2003) and look promising for lowering tissue eosinophil levels. A recently identified eosinophil surface molecule Siglec-8 may offer a therapeutic opportunity (Nutku et al., 2003). Siglec-8 is a member of the sialic acid binding lectin family and contains ITIMs (immunoreceptor tyrosine-based inhibitory motifs) that can induce efficient eosinophil apoptosis when crosslinked. Finally, CD48 is an activation molecule on eosinophils, its neutralization has been shown to decrease eosinophil infiltration in the lung in vivo (Munitz et al., 2006). Siglec-8, as well as CCR-3 and the chemoattractant receptor-homologous molecule expressed on Th2 lymphocytes (CRTH2) are coexpressed by other cells involved in Th2 responses including Th2 cells, mast cells, and basophils and may thus target several other aspects of allergic disorders than just eosinophils (Rothenberg and Hogan, 2005). The critical role of humanized anti-IL-5 in decreasing eosinophil load in humans has been demonstrated by several clinical trials with humanized anti-IL-5 antibody (Egan et al., 1995; Mauser et al., 1995). This drug dramatically lowers eosinophil levels in the blood, decreases eosinophil activation and to a lesser extent eosinophil levels in the inflamed lung and esophagus (Flood-Page et al., 2003a,b; Kips et al., 2003; Leckie et al., 2000; Stein et al., 2008). In a recent study, 85 HES patients (whose condition remained stable on steroid monotherapy) were randomized to placebo or 750 mg of mepolizumab every 4 weeks for 36 weeks (Rothenberg et al., 2008). Indeed, all but one patient in the mepolizumab group (95%) had eosinophil counts below 600 for at least eight weeks, versus 45% of the placebo group. Additionally, the mean prednisone dose increased to 6.2 mg/day in the mepolizumab group, compared with 21.8 mg/day in the placebo group confirming that anti-IL-5 therapies such as mepolizumab have potential as clinical therapies for HES. In a recent study, Nair et al. studied, in a randomized placebocontrolled trial, the prednisone-sparing effect of mepolizumab on eosinophilic bronchitis with or without asthma. They found that patients who received mepolizumab were able to reduce their prednisone dose by 90% of their maximum possible compared to 55% in the placebo arm (p<0.05). Mepolizumab treatment was accompanied by a significant decrease in sputum and blood eosinophils and improvements in asthma control,
108
Carine Blanchard and Marc E. Rothenberg
FEV1 and asthma quality of life that were maintained for 8 weeks after the last infusion, suggesting that mepolizumab is an effective prednisonesparing therapy in patients with eosinophilic bronchitis with or without asthma (Nair et al., 2008).
ACKNOWLEDGMENTS The Authors wish to thank the whole eosinophil field that built the concepts presented. Andrea Lippelman, Katherine Henderson, and LaWanda Bryant for administrative assistance. This work was supported by in part by the Thrasher Research Fund NR-0014 (C.B.), the PHS Grant P30 DK0789392 (C.B.), the NIH AI079874-01 (C.B.) AI070235, AI45898, and DK076893 (M.E.R.), the Food Allergy and Anaphylaxis Network (M.E.R.), Campaign Urging Research for Eosinophil Disorders (CURED), the Buckeye Foundation (M.E.R.) and The Food Allergy Project (M.E.R).
REFERENCES Aceves, S. S., Dohil, R., Newbury, R. O., and Bastian, J. F. (2005). Topical viscous budesonide suspension for treatment of eosinophilic esophagitis. J. Allergy Clin. Immunol. 116, 705–706. Ackerman, S. J., Gleich, G. J., Loegering, D. A., Richardson, B. A., and Butterworth, A. E. (1985). Comparative toxicity of purified human eosinophil granule cationic proteins for schistosomula of Schistosoma mansoni. Am. J. Trop. Med. Hyg. 34, 735–745. Adamko, D. J., Yost, B. L., Gleich, G. J., Fryer, A. D., and Jacoby, D. B. (1999). Ovalbumin sensitization changes the inflammatory response to subsequent parainfluenza infection. Eosinophils mediate airway hyperresponsiveness, m(2) muscarinic receptor dysfunction, and antiviral effects. J. Exp. Med. 190, 1465–1478. Agosti, J. M., Altman, L. C., Ayars, G. H., Loegering, D. A., Gleich, G. J., and Klebanoff, S. J. (1987). The injurious effect of eosinophil peroxidase, hydrogen peroxide, and halides on pneumocytes in vitro. J. Allergy Clin. Immunol. 79, 496–504. Ahrens, R., Waddell, A., Seidu, L., Blanchard, C., Carey, R., Forbes, E., Lampinen, M., Wilson, T., Cohen, E., Stringer, K., Ballard, E., Munitz, A., et al. (2008). Intestinal macrophage/epithelial cell-derived CCL11/eotaxin-1 mediates eosinophil recruitment and function in pediatric ulcerative colitis. J. Immunol. 181, 7390–7399. Ajuebor, M. N., Hogaboam, C. M., Kunkel, S. L., Proudfoot, A. E., and Wallace, J. L. (2001). The chemokine RANTES is a crucial mediator of the progression from acute to chronic colitis in the rat. J. Immunol. 166, 552–558. Akei, H. S., Brandt, E. B., Mishra, A., Strait, R. T., Finkelman, F. D., Warrier, M. R., Hershey, G. K., Blanchard, C., and Rothenberg, M. E. (2006). Epicutaneous aeroallergen exposure induces systemic TH2 immunity that predisposes to allergic nasal responses. J. Allergy Clin. Immunol. 118, 62–69. Akei, H. S., Mishra, A., Blanchard, C., and Rothenberg, M. E. (2005). Epicutaneous antigen exposure primes for experimental eosinophilic esophagitis in mice. Gastroenterology 129, 985–994. Aldebert, D., Lamkhioued, B., Desaint, C., Gounni, A. S., Goldman, M., Capron, A., Prin, L., and Capron, M. (1996). Eosinophils express a functional receptor for interferon alpha: Inhibitory role of interferon alpha on the release of mediators. Blood 87, 2354–2360.
Biology of the Eosinophil
109
Artis, D., Humphreys, N. E., Potten, C. S., Wagner, N., Muller, W., McDermott, J. R., Grencis, R. K., and Else, K. J. (2000). Beta 7 integrin-deficient mice: Delayed leukocyte recruitment and attenuated protective immunity in the small intestine during enteric helminthic infection. Eur. J. Immunol. 30, 1656–1664. Bandeira-Melo, C., Woods, L. J., Phoofolo, M., and Weller, P. F. (2002). Intracrine cysteinyl leukotriene receptor-mediated signaling of eosinophil vesicular transport-mediated interleukin-4 secretion. J. Exp. Med. 196, 841–850. Bankers-Fulbright, J. L., Kephart, G. M., Loegering, D. A., Bradford, A. L., Okada, S., Kita, H., and Gleich, G. J. (1998). Sulfonylureas inhibit cytokine-induced eosinophil survival and activation. J. Immunol. 160, 5546–5553. Barnes, P. J., and Adcock, I. M. (1995). Steroid resistance in asthma. QJM 88, 455–468. Bashir, M. E., Louie, S., Shi, H. N., and Nagler-Anderson, C. (2004). Toll-like receptor 4 signaling by intestinal microbes influences susceptibility to food allergy. J. Immunol. 172, 6978–6987. Behm, C. A., and Ovington, K. S. (2000). The role of eosinophils in parasitic helminth infections: Insights from genetically modified mice. Parasitol. Today 16, 202–209. Beyer, K., Castro, R., Birnbaum, A., Benkov, K., Pittman, N., and Sampson, H. A. (2002). Human milk-specific mucosal lymphocytes of the gastrointestinal tract display a TH2 cytokine profile. J. Allergy Clin. Immunol. 109, 707–713. Bischoff, S. C., Brunner, T., De, W. A., and Dahinden, C. A. (1990). Interleukin 5 modifies histamine release and leukotriene generation by human basophils in response to diverse agonists. J. Exp. Med. 172, 1577–1582. Blanchard, C., Mingler, M. K., MacBride, M., Putnam, P. E., Collins, M. H., Chang, G., Stringer, K., Abonia, J. P., Molkentin, J. D., and Rothenberg, M. E. (2008). Periostin facilitates eosinophil tissue infiltration in allergic lung and esophageal responses. Mucosal. Immunol. 1, 289–296. Blanchard, C., Mingler, M. K., Vicario, M., Abonia, J. P., Wu, Y. Y., Lu, T. X., Collins, M. H., Putnam, P. E., Wells, S. I., and Rothenberg, M. E. (2007). IL-13 involvement in eosinophilic esophagitis: Transcriptome analysis and reversibility with glucocorticoids. J. Allergy Clin. Immunol. 120, 1292–1300. Blanchard, C., Mishra, A., Saito-Akei, H., Monk, P., Anderson, I., and Rothenberg, M. E. (2005). Inhibition of human interleukin-13-induced respiratory and oesophageal inflammation by anti-human-interleukin-13 antibody (CAT-354). Clin. Exp. Allergy 35, 1096. Blanchard, C., Wang, N., and Rothenberg, M. E. (2006a). Eosinophilic esophagitis: Pathogenesis, genetics, and therapy. J. Allergy Clin. Immunol. 118, 1054–1059. Blanchard, C., Wang, N., Stringer, K. F., Mishra, A., Fulkerson, P. C., Abonia, J. P., Jameson, S. C., Kirby, C., Konikoff, M. R., Collins, M. H., Cohen, M. B., Akers, R., et al. (2006b). Eotaxin-3 and a uniquely conserved gene-expression profile in eosinophilic esophagitis. J. Clin. Invest. 116, 536–547. Bochner, B. S., and Schleimer, R. P. (1994). The role of adhesion molecules in human eosinophil and basophil recruitment. J. Allergy Clin. Immunol. 94, 427–438. Boyce, J. A., Friend, D., Matsumoto, R., Austen, K. F., and Owen, W. F. (1995). Differentiation in vitro of hybrid eosinophil/basophil granulocytes: Autocrine function of an eosinophil developmental intermediate. J. Exp. Med. 182, 49–57. Brightling, C. E., Bradding, P., Symon, F. A., Holgate, S. T., Wardlaw, A. J., and Pavord, I. D. (2002). Mast-cell infiltration of airway smooth muscle in asthma. N. Eng. J. Med. 346, 1699–1705. Bullock, E. D., and Johnson, E. M., Jr. (1996). Nerve growth factor induces the expression of certain cytokine genes and bcl-2 in mast cells. Potential role in survival promotion. J. Biol. Chem. 271, 27500–27508. Butterworth, A. E. (1977). The eosinophil and its role in immunity to helminth infection. Curr. Top. Microbiol. Immunol. 77, 127–168.
110
Carine Blanchard and Marc E. Rothenberg
Butterworth, A. E. (1984). Cell-mediated damage to helminths. Adv. Parasitol. 23, 143–235. Chae, S. C., Park, Y. R., Shim, S. C., Lee, I. K., and Chung, H. T. (2005). Eotaxin-3 gene polymorphisms are associated with rheumatoid arthritis in a Korean population. Hum. Immunol. 66, 314–320. Collins, P. D., Marleau, S., Griffiths-Johnson, D. A., Jose, P. J., and Williams, T. J. (1995). Cooperation between interleukin-5 and the chemokine eotaxin to induce eosinophil accumulation in vivo. J. Exp. Med. 182, 1169–1174. Cools, J., DeAngelo, D. J., Gotlib, J., Stover, E. H., Legare, R. D., Cortes, J., Kutok, J., Clark, J., Galinsky, I., Griffin, J. D., Cross, N. C., Tefferi, A., et al. (2003). A tyrosine kinase created by fusion of the PDGFRA and FIP1L1 genes as a therapeutic target of imatinib in idiopathic hypereosinophilic syndrome. N. Engl. J. Med. 348, 1201–1214. Cools, J., Stover, E. H., Wlodarska, I., Marynen, P., and Gilliland, D. G. (2004). The FIP1L1PDGFRalpha kinase in hypereosinophilic syndrome and chronic eosinophilic leukemia. Curr. Opin. Hematol. 11, 51–57. Corry, D., Folkesson, H., Warnock, M., Erle, D., Matthay, M., Wiener-Kronish, J., and Locksley, R. (1996). Interleukin 4, but not interleukin 5 or eosinophils, is required in a murine model of acute airway hyperreactivity. J. Exp. Med. 183, 109–117. Daugherty, B. L., Siciliano, S. J., Demartino, J. A., Malkowitz, L., Sirotina, A., and Springer, M. S. (1996). Cloning, expression, and characterization of the human eosinophil eotaxin receptor. J. Exp. Med. 183, 2349–2354. Davis, M. D., Plager, D. A., George, T. J., Weiss, E. A., Gleich, G. J., and Leiferman, K. M. (2003). Interactions of eosinophil granule proteins with skin: Limits of detection, persistence, and vasopermeabilization. J. Allergy Clin. Immunol. 112, 988–994. Davoine, F., Cao, M., Wu, Y., Ajamian, F., Ilarraza, R., Kokaji, A. I., Moqbel, R., and Adamko, D. J. (2008). Virus-induced eosinophil mediator release requires antigenpresenting and CD4+ T cells. J. Allergy Clin. Immunol. 122, 69–77, e61–62. DeBrosse, C. W., Case, J. W., Putnam, P. E., Collins, M. H., and Rothenberg, M. E. (2006). Quantity and distribution of eosinophils in the gastrointestinal tract of children. Pediatr. Dev. Pathol. 9, 210–218. Dent, L. A., Strath, M., Mellor, A. L., and Sanderson, C. J. (1990). Eosinophilia in transgenic mice expressing interleukin 5. J. Exp. Med. 172, 1425–1431. Denzler, K. L., Farmer, S. C., Crosby, J. R., Borchers, M. T., Cieslewicz, G., Larson, K. A., Cormier-Regard, S., Lee, N. A., and Lee, J. J. (2000). Eosinophil major basic protein-1 does not contribute to allergen-induced airways pathologies in mouse models of asthma. J. Immunol. 165, 5509–5517. Du, J., Stankiewicz, M. J., Liu, Y., Xi, Q., Schmitz, J. E., Lekstrom-Himes, J. A., and Ackerman, S. J. (2002). Novel combinatorial interactions of GATA-1, PU.1, and C/EBPepsilon isoforms regulate transcription of the gene encoding eosinophil granule major basic protein. J. Biol. Chem. 277, 43481–43494. Egan, R. W., Athwahl, D., Chou, C. C., Emtage, S., Jehn, C. H., Kung, T. T., Mauser, P. J., Murgolo, N. J., and Bodmer, M. W. (1995). Inhibition of pulmonary eosinophilia and hyperreactivity by antibodies to interleukin-5. [Review]. Int. Arch. Allergy & Immunol. 107, 321–322. Erickson, L. D., Foy, T. M., and Waldschmidt, T. J. (2001). Murine B1 B cells require IL-5 for optimal T cell-dependent activation. J. Immunol. 166, 1531–1539. Feltenmark, S., Gautam, N., Brunnstrom, A., Griffiths, W., Backman, L., Edenius, C., Lindbom, L., Bjorkholm, M., and Claesson, H. E. (2008). Eoxins are proinflammatory arachidonic acid metabolites produced via the 15-lipoxygenase-1 pathway in human eosinophils and mast cells. Proc. Natl. Acad. Sci. USA 105, 680–685. Flood-Page, P., Menzies-Gow, A., Phipps, S., Ying, S., Wangoo, A., Ludwig, M. S., Barnes, N., Robinson, D., and Kay, A. B. (2003a). Anti-IL-5 treatment reduces deposition of ECM
Biology of the Eosinophil
111
proteins in the bronchial subepithelial basement membrane of mild atopic asthmatics. J. Clin. Invest. 112, 1029–1036. Flood-Page, P., Phipps, S., Menzies-Gow, A., Ong, Y. E., and Kay, A. B. (2003b). Effect of intravenous administration of an anti-IL-5 (mepolizumab) on allergen-induced tissue eosinophilia, the late-phase allergic reaction and the expression of a marker of repair/ remodeling in human atopic subjects. J. Allergy Clin. Immunol. 111, S261. Flood-Page, P. T., Menzies-Gow, A. N., Kay, A. B., and Robinson, D. S. (2003c). Eosinophil’s role remains uncertain as anti-interleukin-5 only partially depletes numbers in asthmatic airway. Am. J. Respir. Crit. Care Med. 167, 199–204. Forbes, E., Murase, T., Yang, M., Matthaei, K. I., Lee, J. J., Lee, N. A., Foster, P. S., and Hogan, S. P. (2004). Immunopathogenesis of experimental ulcerative colitis is mediated by eosinophil peroxidase. J. Immunol. 172, 5664–5675. Forssmann, U., Stoetzer, C., Stephan, M., Kruschinski, C., Skripuletz, T., Schade, J., Schmiedl, A., Pabst, R., Wagner, L., Hoffmann, T., Kehlen, A., Escher, S. E., et al. (2008). Inhibition of CD26/dipeptidyl peptidase IV enhances CCL11/eotaxin-mediated recruitment of eosinophils in vivo. J. Immunol. 181, 1120–1127. Foster, P., Hogan, S., Ramsay, A., Matthaei, K., and Young, I. (1996). Interleukin-5 deficiency abolishes eosinophilia, airway hyperreactivity and lung damage in mouse asthma model. J. Exp. Med. 183, 195–201. Foster, P., Mould, A., Yang, M., Mackenzie, J., Mattes, J., Hogan, S., Mahalingam, S., ANJ, M., Rothenberg, M., Young, I., Matthaei, K., and Webb, D. (2001). Elemental signals regulating eosinophil accumulation in the lung. Immunol. Rev. 179, 173–181. Foster, P. S., Hogan, S. P., Matthaei, K. I., and Young, I. G. (1997). Interleukin-4 and interleukin-5 as targets for the inhibition of eosinophilic inflammation and allergic airways hyperreactivity. Mem. Inst. Oswaldo. Cruz. 92, Suppl 2, 55–61. Foster, P. S., Hogan, S. P., Yang, M., Mattes, J., Young, I. G., Matthaei, K. I., Kumar, R. K., Mahalingam, S., and Webb, D. C. (2002). Interleukin-5 and eosinophils as therapeutic targets for asthma. Trends Mol. Med. 8, 162–167. Freedman, A. R., Gibson, F. M., Fleming, S. C., Spry, C. J., and Griffin, G. E. (1991). Human immunodeficiency virus infection of eosinophils in human bone marrow cultures. J. Exp. Med. 174, 1661–1664. Frigas, E., Loegering, D. A., and Gleich, G. J. (1980). Cytotoxic effects of the guinea pig eosinophil major basic protein on tracheal epithelium. Lab. Invest. 42, 35–43. Fulkerson, P. C., Fischetti, C. A., McBride, M. L., Hassman, L. M., Hogan, S. P., and Rothenberg, M. E. (2006). A central regulatory role for eosinophils and the eotaxin/ CCR3 axis in chronic experimental allergic airway inflammation. Proc. Natl. Acad. Sci. USA 103, 16418–16423. Fulkerson, P. C., Zhu, H., Williams, D. A., Zimmermann, N., and Rothenberg, M. E. (2005). CXCL9 inhibits eosinophil responses by a CCR3- and Rac2-dependent mechanism. Blood 106, 436–443. Furuta, G. T., Nieuwenhuis, E. E., Karhausen, J., Gleich, G., Blumberg, R. S., Lee, J. J., and Ackerman, S. J. (2005). Eosinophils alter colonic epithelial barrier function: role for major basic protein. Am. J. Physiol. Gastrointest. Liver Physiol. 289, G890–G897. Furuta G. T., Liacouras C. A., Collins M. H., Gupta S. K., Justinich C., Putnam P. E., Bonis P., Hassall E., Straumann A., and Rothenberg M. E. (2007). First International Gastrointestinal Eosinophil Research Symposium (FIGERS) Subcommittees. Eosinophilic esophagitis in children and adults: A systematic review and consensus recommendations for diagnosis and treatment. Gastroenterology 133, 1342–1363. Gaddy, J. N., Margolskee, D. J., Bush, R. K., Williams, V. C., and Busse, W. W. (1992). Bronchodilation with a potent and selective leukotriene D4 (LTD4) receptor antagonist (MK-571) in patients with asthma. Am. Rev. Respir. Dis. 146, 358–363. Gleich, G. J. (1986). The functions of eosinophils. Ann. Inst. Pasteur Immunol. 137D, 136–214.
112
Carine Blanchard and Marc E. Rothenberg
Gleich, G. J., and Adolphson, C. R. (1986). The eosinophilic leukocyte: Structure and function. Adv. Immunol. 39, 177–253. Gleich, G. J., Frigas, E., Loegering, D. A., Wassom, D. L., and Steinmuller, D. (1979). Cytotoxic properties of the eosinophil major basic protein. J. Immunol. 123, 2925–2927. Gleich, G. J., Leiferman, K. M., Pardanani, A., Tefferi, A., and Butterfield, J. H. (2002). Treatment of hypereosinophilic syndrome with imatinib mesilate. Lancet 359, 1577–1578. Gonsalves, N., Policarpio-Nicolas, M., Zhang, Q., Rao, M. S., and Hirano, I. (2006). Histopathologic variability and endoscopic correlates in adults with eosinophilic esophagitis. Gastrointest. Endosc. 64, 313–319. Gonzalo, J. A., Lloyd, C. M., Kremer, L., Finger, E., Martinez, A. C., Siegelman, M. H., Cybulsky, M., and Gutierrez-Ramos, J. C. (1996). Eosinophil recruitment to the lung in a murine model of allergic inflammation. The role of T cells, chemokines, and adhesion receptors. J. Clin. Invest. 98, 2332–2345. Gonzalo, J. A., Lloyd, C. M., Wen, D., Albar, J. P., Wells, T. N., Proudfoot, A., Martinez, A. C., Dorf, M., Bjerke, T., Coyle, A. J., and Gutierrez-Ramos, J. C. (1998). The coordinated action of CC chemokines in the lung orchestrates allergic inflammation and airway hyperresponsiveness. J. Exp. Med. 188, 157–167. Gouon-Evans, V., Lin, E. Y., and Pollard, J. W. (2002). Requirement of macrophages and eosinophils and their cytokines/chemokines for mammary gland development. Breast Cancer Res. 4, 155–164. Gouon-Evans, V., and Pollard, J. W. (2001). Eotaxin is required for eosinophil homing into the stroma of the pubertal and cycling uterus. Endocrinology 142, 4515–4521. Gouon-Evans, V., Rothenberg, M. E., and Pollard, J. W. (2000). Postnatal mammary gland development requires macrophages and eosinophils. Development 127, 2269–2282. Gurish, M. F., Humbles, A., Tao, H., Finkelstein, S., Boyce, J. A., Gerard, C., Friend, D. S., and Austen, K. F. (2002). CCR3 is required for tissue eosinophilia and larval cytotoxicity after infection with Trichinella spiralis. J. Immunol. 168, 5730–5736. Hajek, A. R., Lindley, A. R., Favoreto, S., Jr., Carter, R., Schleimer, R. P., and Kuperman, D. A. (2008a). 12/15-Lipoxygenase deficiency protects mice from allergic airways inflammation and increases secretory IgA levels. J. Allergy Clin. Immunol. 633–639, e633. Hajek, A. R., Lindley, A. R., Favoreto, S., Jr., Carter, R., Schleimer, R. P., and Kuperman, D. A. 12/15-Lipoxygenase deficiency protects mice from allergic airways inflammation and increases secretory IgA levels. (2008b). J Allergy Clin Immunol. 122, 633-639, e633. Hakonarson, H., Maskeri, N., Carter, C., Chuang, S., and Grunstein, M. M. (1999). Autocrine interaction between IL-5 and IL-1beta mediates altered responsiveness of atopic asthmatic sensitized airway smooth muscle. J. Clin. Invest. 104, 657–667. Hamann, K. J., Barker, R. L., Ten, R. M., and Gleich, G. J. (1991). The molecular biology of eosinophil granule proteins. Int. Arch. Allergy. Appl. Immunol. 94, 202–209. Hamelmann, E., and Gelfand, E. W. (2001). IL-5-induced airway eosinophilia–the key to asthma. Immunol. Rev. 179, 182–191. Hamelmann, E., Oshiba, A., Loader, J., Larsen, G. L., Gleich, G., Lee, J., and Gelfand, E. W. (1997). Antiinterleukin-5 antibody prevents airway hyperresponsiveness in a murine model of airway sensitization. Am. J. Respir. Crit. Care Med. 155, 819–825. Handzel, Z. T., Busse, W. W., Sedgwick, J. B., Vrtis, R., Lee, W. M., Kelly, E. A., and Gern, J. E. (1998). Eosinophils bind rhinovirus and activate virus-specific T cells. J. Immunol. 160, 1279–1284. Hirai, H., Tanaka, K., Yoshie, O., Ogawa, K., Kenmotsu, K., Takamori, Y., Ichimasa, M., Sugamura, K., Nakamura, M., Takano, S., and Nagata, K. (2001). Prostaglandin D2 selectively induces chemotaxis in T helper type 2 cells, eosinophils, and basophils via seven-transmembrane receptor CRTH2. J. Exp. Med. 193, 255–261. Hirasawa, R., Shimizu, R., Takahashi, S., Osawa, M., Takayanagi, S., Kato, Y., Onodera, M., Minegishi, N., Yamamoto, M., Fukao, K., Taniguchi, H., Nakauchi, H., et al. (2002).
Biology of the Eosinophil
113
Essential and instructive roles of GATA factors in eosinophil development. J. Exp. Med. 195, 1379–1386. Hisamatsu, K., Ganbo, T., Nakazawa, T., Murakami, Y., Gleich, G. J., Makiyama, K., and Koyama, H. (1990). Cytotoxicity of human eosinophil granule major basic protein to human nasal sinus mucosa in vitro. J. Allergy Clin. Immunol. 86, 52–63. Hogan, S. P., Koskinen, A., and Foster, P. S. (1997). Interleukin-5 and eosinophils induce airway damage and bronchial hyperreactivity during allergic airway inflammation in BALB/c mice. Immunol. Cell Biol. 75, 284–288. Hogan, S. P., Koskinen, A., Matthaei, K. I., Young, I. G., and Foster, P. S. (1998). Interleukin-5producing CD4+ T cells play a pivotal role in aeroallergen-induced eosinophilia, bronchial hyperreactivity, and lung damage in mice. Am. J. Respir. Crit. Care Med. 157, 210–218. Hogan, S. P., Mishra, A., Brandt, E. B., Foster, P. S., and Rothenberg, M. E. (2000). A critical role for eotaxin in experimental oral antigen-induced eosinophilic gastrointestinal allergy. Proc. Natl. Acad. Sci. USA 97, 6681–6686. Hogan, S. P., Mishra, A., Brandt, E. B., Royalty, M. P., Pope, S. M., Zimmermann, N., Foster, P. S., and Rothenberg, M. E. (2001). A pathological function for eotaxin and eosinophils in eosinophilic gastrointestinal inflammation. Nat. Immunol. 2, 353–360. Horie, S., Okubo, Y., Hossain, M., Sato, E., Nomura, H., Koyama, S., Suzuki, J., Isobe, M., and Sekiguchi, M. (1997). Interleukin-13 but not interleukin-4 prolongs eosinophil survival and induces eosinophil chemotaxis. Intern. Med. 36, 179–185. Horigome, K., Bullock, E. D., and Johnson, E. M., Jr. (1994). Effects of nerve growth factor on rat peritoneal mast cells. Survival promotion and immediate-early gene induction. J. Biol. Chem. 269, 2695–2702. Humbles, A. A., Lloyd, C. M., McMillan, S. J., Friend, D. S., Xanthou, G., McKenna, E. E., Ghiran, S., Gerard, N. P., Yu, C., Orkin, S. H., and Gerard, C. (2004). A critical role for eosinophils in allergic airways remodeling. Science 305, 1776–1779. Humbles, A. A., Lu, B., Friend, D. S., Okinaga, S., Lora, J., Al-Garawi, A., Martin, T. R., Gerard, N. P., and Gerard, C. (2002). The murine CCR3 receptor regulates both the role of eosinophils and mast cells in allergen-induced airway inflammation and hyperresponsiveness. Proc. Natl. Acad. Sci. USA 99, 1479–1484. Hunt, L. W., Frigas, E., Butterfield, J. H., Kita, H., Blomgren, J., Dunnette, S. L., Offord, K. P., and Gleich, G. J. (2004). Treatment of asthma with nebulized lidocaine: A randomized, placebo-controlled study. J. Allergy Clin. Immunol. 113, 853–859. Iwasaki, H., Mizuno, S., Mayfield, R., Shigematsu, H., Arinobu, Y., Seed, B., Gurish, M. F., Takatsu, K., and Akashi, K. (2005). Identification of eosinophil lineage-committed progenitors in the murine bone marrow. J. Exp. Med. 201, 1891–1897. Jacobsen, E. A., Ochkur, S. I., Pero, R. S., Taranova, A. G., Protheroe, C. A., Colbert, D. C., Lee, N. A., and Lee, J. J. (2008). Allergic pulmonary inflammation in mice is dependent on eosinophil-induced recruitment of effector T cells. J. Exp. Med. 205, 699–710. Jacoby, D. B., Gleich, G. J., and Fryer, A. D. (1993). Human eosinophil major basic protein is an endogenous allosteric antagonist at the inhibitory muscarinic M2 receptor. J. Clin. Invest. 91, 1314–1318. Jose, P. J., Griffiths-Johnson, D. A., Collins, P. D., Walsh, D. T., Moqbel, R., Totty, N. F., Truong, O., Hsuan, J. J., and Williams, T. J. (1994). Eotaxin: A potent eosinophil chemoattractant cytokine detected in a guinea pig model of allergic airways inflammation. J. Exp. Med. 179, 881–887. Justice, J. P., Borchers, M. T., Crosby, J. R., Hines, E. M., Shen, H. H., Ochkur, S. I., McGarry, M. P., Lee, N. A., and Lee, J. J. (2003). Ablation of eosinophils leads to a reduction of allergen-induced pulmonary pathology. Am. J. Physiol. Lung Cell. Mol. Physiol. 284, L169–L178. Kane, G. C., Pollice, M., Kim, C. J., Cohn, J., Dworski, R. T., Murray, J. J., Sheller, J. R., Fish, J. E., and Peters, S. P. (1996). A controlled trial of the effect of the 5-lipoxygenase
114
Carine Blanchard and Marc E. Rothenberg
inhibitor, zileuton, on lung inflammation produced by segmental antigen challenge in human beings. J. Allergy Clin. Immunol. 97, 646–654. Kato, M., Kephart, G. M., Talley, N. J., Wagner, J. M., Sarr, M. G., Bonno, M., McGovern, T. W., and Gleich, G. J. (1998). Eosinophil infiltration and degranulation in normal human tissue. Anat. Rec. 252, 418–425. Kips, J. C., O’Connor, B. J., Langley, S. J., Woodcock, A. A., Kerstjens, H. A., Postma, D. S., Danzig, M., Cuss, F., and Pauwels, R. A. (2003). Effect of SCH55700, a humanized antihuman interleukin-5 antibody, in severe persistent asthma: A pilot study. Am. J. Respir. Crit. Care Med. 167, 1655–1659. Kita, H. (1996). The eosinophil: a cytokine-producing cell. J. Allergy Clin. Immunol. 97, 889–892. Klion, A. D. (2005). Recent advances in the diagnosis and treatment of hypereosinophilic syndromes. Hematology Am. Soc. Hematol. Educ. Program 209–214. Konikoff, M. R., Noel, R. J., Blanchard, C., Kirby, C., Jameson, S. C., Buckmeier, B. K., Akers, R., Cohen, M. B., Collins, M. H., Assa’ad, A. H., Aceves, S. S., Putnam, P. E., et al. (2006). A Randomized, Double-Blind, Placebo-Controlled Trial of Fluticasone Propionate for Pediatric Eosinophilic Esophagitis. Gastroenterology 131, 1381–1391. Kopf, M., Brombacher, F., Hodgkin, P. D., Ramsay, A. J., Milbourne, E. A., Dai, W. J., Ovington, K. S., Behm, C. A., Kohler, G., Young, I. G., and Matthaei, K. I. (1996). IL-5deficient mice have a developmental defect in CD5+ B-1 cells and lack eosinophilia but have normal antibody and cytotoxic T cell responses. Immunity 4, 15–24. Korenaga, M., Hitoshi, Y., Yamaguchi, N., Sato, Y., Takatsu, K., and Tada, I. (1991). The role of interleukin-5 in protective immunity to Strongyloides venezuelensis infection in mice. Immunology 72, 502–507. Korsgren, M., Erjefalt, J. S., Korsgren, O., Sundler, F., and Persson, C. G. A. (1997). Allergic eosinophil-rich inflammation develops in lungs and airways of B cell-deficient mice. J. Exp. Med. 185, 885–892. Kuijpers, T. W., Mul, E. P., Blom, M., Kovach, N. L., Gaeta, F. C., Tollefson, V., Elices, M. J., and Harlan, J. M. (1993). Freezing adhesion molecules in a state of high-avidity binding blocks eosinophil migration. J. Exp. Med. 178, 279–284. Lacy, P., and Moqbel, R. (2000). Eosinophil cytokines. Chem. Immunol. 76, 134–155. Leckie, M. J., ten Brinke, A., Khan, J., Diamant, Z., O’Connor, B. J., Walls, C. M., Mathur, A. K., Cowley, H. C., Chung, K. F., Djukanovic, R., Hansel, T. T., Holgate, S. T., et al. (2000). Effects of an interleukin-5 blocking monoclonal antibody on eosinophils, airway hyperresponsiveness, and the late asthmatic response. Lancet 356, 2144–2148. Lee, J. B., Matsumoto, T., Shin, Y. O., Yang, H. M., Min, Y. K., Timothy, O., Bae, S. J., and Quan, F. S. (2004a). The role of RANTES in a murine model of food allergy. Immunol. Invest. 33, 27–38. Lee, J. J., Dimina, D., Macias, M. P., Ochkur, S. I., McGarry, M. P., O’Neill, K. R., Protheroe, C., Pero, R., Nguyen, T., Cormier, S. A., Lenkiewicz, E., Colbert, D., et al. (2004b). Defining a link with asthma in mice congenitally deficient in eosinophils. Science 305, 1773–1776. Lee, J. J., McGarry, M. P., Farmer, S. C., Denzler, K. L., Larson, K. A., Carrigan, P. E., Brenneise, I. E., Horton, M. A., Haczku, A., Gelfand, E. W., Leikauf, G. D., and Lee, N. A. (1997a). Interleukin-5 expression in the lung epithelium of transgenic mice leads to pulmonary changes pathognomonic of asthma. J. Exp. Med. 185, 2143–2156. Lee, N. A., McGarry, M. P., Larson, K. A., Horton, M. A., Kristensen, A. B., and Lee, J. J. (1997b). Expression of IL-5 in thymocytes/T cells leads to the development of a massive eosinophilia, extramedullary eosinophilopoiesis, and unique histopathologies. J. Immunol. 158, 1332–1344. Lim, J. R., Gupta, S. K., Croffie, J. M., Pfefferkorn, M. D., Molleston, J. P., Corkins, M. R., Davis, M. M., Faught, P. P., Steiner, S. J., and Fitzgerald, J. F. (2004). White specks in the esophageal mucosa: An endoscopic manifestation of non-reflux eosinophilic esophagitis in children. Gastrointest. Endosc. 59, 835–838.
Biology of the Eosinophil
115
Logan, M. R., Lacy, P., Bablitz, B., and Moqbel, R. (2002). Expression of eosinophil target SNAREs as potential cognate receptors for vesicle-associated membrane protein-2 in exocytosis. J. Allergy Clin. Immunol. 109, 299–306. Lopez, A. F., Begley, C. G., Williamson, D. J., Warren, D. J., Vadas, M. A., and Sanderson, C. J. (1986). Murine eosinophil differentiation factor. An eosinophil-specific colony-stimulating factor with activity for human cells. J. Exp. Med. 163, 1085–1099. Lopez, A. F., Sanderson, C. J., Gamble, J. R., Campbell, H. D., Young, I. G., and Vadas, M. A. (1988). Recombinant human interleukin 5 is a selective activator of human eosinophil function. Source (Bibliographic Citation): J. Exp. Med. 167, 219–224. Ma, W., Bryce, P. J., Humbles, A. A., Laouini, D., Yalcindag, A., Alenius, H., Friend, D. S., Oettgen, H. C., Gerard, C., and Geha, R. S. (2002). CCR3 is essential for skin eosinophilia and airway hyperresponsiveness in a murine model of allergic skin inflammation. J. Clin. Invest. 109, 621–628. MacKenzie, J. R., Mattes, J., Dent, L. A., and Foster, P. S. (2001). Eosinophils promote allergic disease of the lung by regulating CD4(+) Th2 lymphocyte function. J. Immunol. 167, 3146–3155. MacPherson, J. C., Comhair, S. A., Erzurum, S. C., Klein, D. F., Lipscomb, M. F., Kavuru, M. S., Samoszuk, M. K., and Hazen, S. L. (2001). Eosinophils are a major source of Nitric Oxide-derived Oxidants in Severe asthma: Characterization of pathways available to eosinophils for generating reactive nitrogen species. J. Immunol. 166, 5763–5772. Maddox, D. E., Kephart, G. M., Coulam, C. B., Butterfield, J. H., Benirschke, K., and Gleich, G. J. (1984). Localization of a molecule immunochemically similar to eosinophil major basic protein in human placenta. J. Exp. Med. 160, 29–41. Mattes, J., Yang, M., Mahalingam, S., Kuehr, J., Webb, D. C., Simson, L., Hogan, S. P., Koskinen, A., McKenzie, A. N., Dent, L. A., Rothenberg, M. E., Matthaei, K. I., et al. (2002). Intrinsic defect in T cell production of interleukin (IL)-13 in the absence of both IL -5 and eotaxin precludes the development of eosinophilia and airways hyperreactivity in experimental asthma. J. Exp. Med. 195, 1433–1444. Matthews, A. N., Friend, D. S., Zimmermann, N., Sarafi, M. N., Luster, A. D., Pearlman, E., Wert, S. E., and Rothenberg, M. E. (1998). Eotaxin is required for the baseline level of tissue eosinophils. Proc. Natl. Acad. Sci. USA 95, 6273–6278. Mauser, P. J., Pitman, A. M., Fernandez, X., Foran, S. K., Adams, G. R., Kreutner, W., Egan, R. W., and Chapman, R. W. (1995). Effects of an antibody to interleukin-5 in a monkey model of asthma. American J. Resp. Crit. Care Med. 152, 467–472. Mawhorter, S. D., Kazura, J. W., and Boom, W. H. (1994). Human eosinophils as antigenpresenting cells: Relative efficiency for superantigen- and antigen-induced CD4+ T-cell proliferation. Immunology 81, 584–591. McNagny, K., and Graf, T. (2002). Making eosinophils through subtle shifts in transcription factor expression. J. Exp. Med. 195, F43–F47. Meng, Q., Ying, S., Corrigan, C. J., Wakelin, M., Assoufi, B., Moqbel, R., and Kay, A. B. (1997). Effects of rapamycin, cyclosporin A, and dexamethasone on interleukin 5-induced eosinophil degranulation and prolonged survival. Allergy 52, 1095–1101. Milanovic, M., Terszowski, G., Struck, D., Liesenfeld, O., and Carstanjen, D. (2008). IFN consensus sequence binding protein (Icsbp) is critical for eosinophil development. J. Immunol. 181, 5045–5053. Mishra, A., and Rothenberg, M. E. (2003). Intratracheal IL-13 induces eosinophilic esophagitis by an IL-5, eotaxin-1, and STAT6-dependent mechanism. Gastroenterology 125, 1419–1427. Mishra, A., Hogan, S. P., Brandt, E. B., and Rothenberg, M. E. (2000). Peyer’s patch eosinophils: Identification, characterization, and regulation by mucosal allergen exposure, interleukin-5, and eotaxin. Blood 96, 1538–1544.
116
Carine Blanchard and Marc E. Rothenberg
Mishra, A., Hogan, S. P., Brandt, E. B., and Rothenberg, M. E. (2002a). IL-5 promotes eosinophil trafficking to the esophagus. J. Immunol. 168, 2464–2469. Mishra, A., Hogan, S. P., Brandt, E. B., Wagner, N., Crossman, M. W., Foster, P. S., and Rothenberg, M. E. (2002b). Enterocyte expression of the eotaxin and interleukin-5 transgenes induces compartmentalized dysregulation of eosinophil trafficking. J. Biol. Chem. 277, 4406–4412. Mishra, A., Hogan, S. P., Lee, J. J., Foster, P. S., and Rothenberg, M. E. (1999). Fundamental signals that regulate eosinophil homing to the gastrointestinal tract. J. Clin. Invest. 103, 1719–1727. Moser, R., Fehr, J., and Bruijnzeel, P. L. (1992). IL-4 controls the selective endothelium-driven transmigration of eosinophils from allergic individuals. J. Immunol. 149, 1432–1438. Munitz, A., Bachelet, I., Eliashar, R., Khodoun, M., Finkelman, F. D., Rothenberg, M. E., and Levi-Schaffer, F. (2006). CD48 is an allergen and IL-3-induced activation molecule on eosinophils. J. Immunol. 177, 77–83. Munitz, A., McBride, M. L., Bernstein, J. S., and Rothenberg, M. E. (2008). A dual activation and inhibition role for the paired immunoglobulin-like receptor B in eosinophils. Blood 111, 5694–5703. Murphy, P. M. (1994). The molecular biology of leukocyte chemoattractant receptors. Annu. Rev. Immunol. 12, 593–633. Nair, P., Pizzichini, M., Kjarsgaard, M., Inman, M. D., Efthimiadis, A., Pizzichini, E., O’Byrne, P. M., and Hargreave, F. E. (2008). Prednisone-sparing effect of mepolizumab on eosinophilic bronchitis with or without asthma: A randomized, placebo-controlled trial. Am. J. Res. Crit. Care Med. 177, A568. Nakajima, H., Sano, H., Nishimura, T., Yoshida, S., and Iwamoto, I. (1994). Role of vascular cell adhesion molecule 1/very late activation antigen 4 and intercellular adhesion molecule 1/lymphocyte function-associated antigen 1 interactions in antigen-induced eosinophil and T cell recruitment into the tissue. J. Exp. Med. 179, 1145–1154. Nakamura, H., Luster, A. D., Nakamura, T., In, K. H., Sonna, L. A., Deykin, A., Israel, E., Drazen, J. M., and Lilly, C. M. (2001). Variant eotaxin: Its effects on the asthma phenotype. J. Allergy Clin. Immunol. 108, 946–953. Nerlov, C., and Graf, T. (1998). PU.1 induces myeloid lineage commitment in multipotent hematopoietic progenitors. Genes Dev. 12, 2403–2412. Nerlov, C., McNagny, K. M., Doderlein, G., Kowenz-Leutz, E., and Graf, T. (1998). Distinct C/EBP functions are required for eosinophil lineage commitment and maturation. Genes Dev. 12, 2413–2423. Neves, J. S., Perez, S. A., Spencer, L. A., Melo, R. C., Reynolds, L., Ghiran, I., MahmudiAzer, S., Odemuyiwa, S. O., Dvorak, A. M., Moqbel, R., and Weller, P. F. (2008). Eosinophil granules function extracellularly as receptor-mediated secretory organelles. Proc. Natl. Acad. Sci. USA 105, 18478–18483. Nutku, E., Aizawa, H., Hudson, S. A., and Bochner, B. S. (2003). Ligation of Siglec-8: A selective mechanism for induction of human eosinophil apoptosis. Blood 101, 5014–5020. O’Donnell, M. C., Ackerman, S. J., Gleich, G. J., and Thomas, L. L. (1983). Activation of basophil and mast cell histamine release by eosinophil granule major basic protein. J. Exp. Med. 157, 1981–1991. O’Reilly, M., Alpert, R., Jenkinson, S., Gladue, R. P., Foo, S., Trim, S., Peter, B., Trevethick, M., and Fidock, M. (2002). Identification of a histamine H4 receptor on human eosinophils– role in eosinophil chemotaxis. J. Recept. Signal Transduct. Res. 22, 431–448. Odemuyiwa, S. O., Ghahary, A., Li, Y., Puttagunta, L., Lee, J. E., Muscat-Marcu, S., Ghahary, A., and Moqbel, R. (2004). Human eosinophils regulate T cell subset selection through indoleamine 2,3-dioxyenase. J. Immunol. 173, 5909–5913.
Biology of the Eosinophil
117
Piliponsky, A., Gleich, G., Bar, I., and Levi-Schaffer, F. (2002). Effects of eosinophils on mast cells: A new pathway for the perpetuation of allergic inflammation. Mol. Immunol. 38, 1369–1372. Pitini, V., Teti, D., Arrigo, C., and Righi, M. (2004). Alemtuzumab therapy for refractory idiopathic hypereosinophilic syndrome with abnormal T cells: A case report. Br. J. Haematol. 127, 477. Plager, D. A., Loegering, D. A., Checkel, J. L., Tang, J., Kephart, G. M., Caffes, P. L., Adolphson, C. R., Ohnuki, L. E., and Gleich, G. J. (2006). Major Basic Protein Homolog (MBP2): A Specific Human Eosinophil Marker. 177, 7340–7345. Ponath, P. D., Qin, S., Post, T. W., Wang, J., Wu, L., Gerard, N. P., Newman, W., Gerard, C., and Mackay, C. R. (1996). Molecular cloning and characterization of a human eotaxin receptor expressed selectively on eosinophils. J. Exp. Med. 183, 2437–2448. Pope, S. M., Zimmermann, N., Stringer, K. F., Karow, M. L., and Rothenberg, M. E. (2005). The eotaxin chemokines and CCR3 are fundamental regulators of allergen-induced pulmonary eosinophilia. J. Immunol. 175, 5341–5350. Popken-Harris, P., Checkel, J., Loegering, D., Madden, B., Springett, M., Kephart, G., and Gleich, G. J. (1998). Regulation and processing of a precursor form of eosinophil granule major basic protein (ProMBP) in differentiating eosinophils. Blood 92, 623–631. Potter, J. W., Saeian, K., Staff, D., Massey, B. T., Komorowski, R. A., Shaker, R., and Hogan, W. J. (2004). Eosinophilic esophagitis in adults: an emerging problem with unique esophageal features. Gastrointest. Endosc. 59, 355–361. Pretolani, M., Ruffie, C., Lapa e Silva, J. R., Joseph, D., Lobb, R. R., and Vargaftig, B. B. (1994). Antibody to very late activation antigen 4 prevents antigen-induced bronchial hyperreactivity and cellular infiltration in the guinea pig airways. J. Exp. Med. 180, 795–805. Rand, T. H., Lopez, A. F., Gamble, J. R., and Vadas, M. A. (1988). Nedocromil sodium and cromolyn (sodium cromoglycate) selectively inhibit antibody-dependent granulocytemediated cytotoxicity. Int. Arch. Allergy Appl. Immunol. 87, 151–158. Rankin, S. M., Conroy, D. M., and Williams, T. J. (2000). Eotaxin and eosinophil recruitment: Implications for human disease. Mol. Med. Today 6, 20–27. Redier, H., Chanez, P., De, V. C., Rifai, N., Clauzel, A. M., Michel, F. B., and Godard, P. (1992). Inhibitory effect of cetirizine on the bronchial eosinophil recruitment induced by allergen inhalation challenge in allergic patients with asthma. J. Allergy Clin. Immunol. 90, 215–224. Reese, T. A.361, Liang, H. E., Tager, A. M., Luster, A. D., Van Rooijen, N., Voehringer, D., and Locksley, R. M. (2007). Chitin induces accumulation in tissue of innate immune cells associated with allergy. Nature 447, 92–96. Robertson, S. A., Allanson, M., and Mau, V. J. (1998). Molecular regulation of uterine recruitment during early pregnancy in the mouse. Trophoblast Research 11, 101–120. Robertson, S. A., Mau, V. J., Young, I. G., and Matthaei, K. I. (2000). Uterine eosinophils and reproductive performance in interleukin 5-deficient mice. J. Reprod. Fertil. 120, 423–432. Rolfe, F. G., Valentine, J. E., and Sewell, W. A. (1997). Cyclosporin A and FK506 reduce interleukin-5 mRNA abundance by inhibiting gene transcription. Am. J. Respir. Cell Mol. Biol. 17, 243–250. Rosenberg, H. F., and Domachowske, J. B. (2001). Eosinophils, eosinophil ribonucleases, and their role in host defense against respiratory virus pathogens. J. Leukoc. Biol. 70, 691–698. Rothenberg, M. E. (1998). Eosinophilia. N. Engl. J. Med. 338, 1592–1600. Rothenberg, M. E. (2004). Eosinophilic gastrointestinal disorders (EGID). J. Allergy Clin. Immunol. 113, 11–28, quiz 29. Rothenberg, M. E., and Hogan, S. P. (2005). The Eosinophil. Annu. Rev. Immunol. 24, 147–174. Rothenberg, M. E., Klion, A. D., Roufosse, F. E., Kahn, J. E., Weller, P. F., Simon, H. U., Schwartz, L. B., Rosenwasser, L. J., Ring, J., Griffin, E. F., Haig, A. E., Frewer, P. I., et al.
118
Carine Blanchard and Marc E. Rothenberg
(2008). Treatment of patients with the hypereosinophilic syndrome with mepolizumab. N. Engl. J. Med. 358, 1215–1228. Rothenberg, M. E., Luster, A. D., and Leder, P. (1995). Murine eotaxin: An eosinophil chemoattractant inducible in endothelial cells and in interleukin 4-induced tumor suppression. Proc. Natl. Acad. Sci. USA 92, 8960–8964. Rothenberg, M. E., MacLean, J. A., Pearlman, E., Luster, A. D., and Leder, P. (1997). Targeted disruption of the chemokine eotaxin partially reduces antigen-induced tissue eosinophilia. J. Exp. Med. 185, 785–790. Rothenberg, M. E., Mishra, A., Brandt, E. B., and Hogan, S. P. (2001a). Gastrointestinal eosinophils. Immunol. Rev. 179, 139–155. Rothenberg, M. E., Mishra, A., Brandt, E. B., and Hogan, S. P. (2001b). Gastrointestinal eosinophils in health and disease. Adv. Immunol. 78, 291–328. Rothenberg, M. E., Mishra, A., Collins, M. H., and Putnam, P. E. (2001c). Pathogenesis and clinical features of eosinophilic esophagitis. J. Allergy Clin. Immunol. 108, 891–894. Rothenberg, M. E., Pomerantz, J. L., Owen, W. F., Jr., Avraham, S., Soberman, R. J., Austen, K. F., and Stevens, R. L. (1988). Characterization of a human eosinophil proteoglycan, and augmentation of its biosynthesis and size by interleukin 3, interleukin 5, and granulocyte/macrophage colony stimulating factor. J. Biol. Chem. 263, 13901–13908. Sanderson, C. J. (1992). Interleukin-5, eosinophils, and disease. Blood 79, 3101–3109. Schleimer, R. P., and Bochner, B. S. (1994). The effect of glucocorticoids on human eosinophils. J. Allergy Clin. Immunol. 94, 1202–1213. Sefcick, A., Sowter, D., DasGupta, E., Russell, N. H., and Bryne, J. L. (2004). Alemtuzumab therapy for refractory idiopathic hypereosinophilic syndrome. Br. J. Haematol. 124, 558–559. Sferruzzi-Perri, A. N., Robertson, S. A., and Dent, L. A. (2003). Interleukin-5 transgene expression and eosinophilia are associated with retarded mammary gland development in mice. Biol. Reprod. 69, 224–233. Shen, Z. J., Esnault, S., and Malter, J. S. (2005). The peptidyl-prolyl isomerase Pin1 regulates the stability of granulocyte-macrophage colony-stimulating factor mRNA in activated eosinophils. Nat. Immunol. 6, 1280–1287. Sher, A., Coffman, R. L., Hieny, S., Scott, P., and Cheever, A. W. (1990). Interleukin-5 is required for the blood and tissue eosinophilia but not granuloma formation induced by infection with schistosoma mansoni. Proc. Natl. Acad. Sci. USA 87, 61–65. Shi, H. (2004). Eosinophils function as antigen-presenting cells. J. Leuko. Biol. 76, 520–527. Shi, H. Z., Humbles, A., Gerard, C., Jin, Z., and Weller, P. F. (2000). Lymph node trafficking and antigen presentation by endobronchial eosinophils. J. Clin. Invest. 105, 945–953. Shinkai, A., Yoshisue, H., Koike, M., Shoji, E., Nakagawa, S., Saito, A., Takeda, T., Imabeppu, S., Kato, Y., Hanai, N., Anazawa, H., Kuga, T., et al. (1999). A novel human CC chemokine, eotaxin-3, which is expressed in IL-4-stimulated vascular endothelial cells, exhibits potent activity toward eosinophils. J. Immunol. 163, 1602–1610. Shinkai, K., Mohrs, M., and Locksley, R. M. (2002). Helper T cells regulate type-2 innate immunity in vivo. Nature 420, 825–829. Simons, J. E., Rothenberg, M. E., and Lawrence, R. A. (2005). Eotaxin-1-regulated eosinophils have a critical role in innate immunity against experimental Brugia malayi infection. Eur. J. Immunol. 35, 189–197. Slifman, N. R., Loegering, D. A., McKean, D. J., and Gleich, G. J. (1986). Ribonuclease activity associated with human eosinophil-derived neurotoxin and eosinophil cationic protein. J. Immunol. 137, 2913–2917. Snyman, J. R., Sommers, D. K., Gregorowski, M. D., and Boraine, H. (1992). Effect of cetirizine, ketotifen and chlorpheniramine on the dynamics of the cutaneous hypersensitivity reaction: a comparative study. Eur. J. Clin. Pharmacol. 42, 359–362.
Biology of the Eosinophil
119
Solomon, A., Aloe, L., Pe’er, J., Frucht-Pery, J., Bonini, S., and Levi-Schaffer, F. (1998). Nerve growth factor is preformed in and activates human peripheral blood eosinophils. J. Allergy Clin. Immunol. 102, 454–460. Stein, M. L., Villanueva, J. M., Buckmeier, B. K., Yamada, Y., Filipovich, A. H., Assa’ad, A. H., and Rothenberg, M. E. (2008). Anti-IL-5 (mepolizumab) therapy reduces eosinophil activation ex vivo and increases IL-5 and IL-5 receptor levels. J. Allergy Clin. Immunol. 121, 1473–1483, e1471–1474. Stellato, C., Matsukura, S., Fal, A., White, J., Beck, L. A., Proud, D., and Schleimer, R. P. (1999). Differential regulation of epithelial-derived C-C chemokine expression by IL-4 and the glucocorticoid budesonide. J. Immunol. 163, 5624–5632. Straumann, A., Bauer, M., Fischer, B., Blaser, K., and Simon, H. U. (2001). Idiopathic eosinophilic esophagitis is associated with a T(H)2-type allergic inflammatory response. J. Allergy Clin. Immunol. 108, 954–961. Straumann, A., Kristl, J., Conus, S., Vassina, E., Spichtin, H. P., Beglinger, C., and Simon, H. U. (2005). Cytokine expression in healthy and inflamed mucosa: probing the role of eosinophils in the digestive tract. Inflamm. Bowel. Dis. 11, 720–726. Suzuki, K., and Verma, I. M. (2008). Phosphorylation of SNAP-23 by IkappaB kinase 2 regulates mast cell degranulation. Cell 134, 485–495. Swartz, J. M., Dyer, K. D., Cheever, A. W., Ramalingam, T., Pesnicak, L., Domachowske, J. B., Lee, J. J., Lee, N. A., Foster, P. S., Wynn, T. A., and Rosenberg, H. F. (2006). Schistosoma mansoni infection in eosinophil lineage-ablated mice. Blood 108, 2420–2427. Tager, A. M., Dufour, J. H., Goodarzi, K., Bercury, S. D., von Andrian, U. H., and Luster, A. D. (2000). BLTR mediates leukotriene B(4)-induced chemotaxis and adhesion and plays a dominant role in eosinophil accumulation in a murine model of peritonitis. J. Exp. Med. 192, 439–446. Tai, P.-C., Hayes, D. J., Clark, J. B., and Spry, C. J. F. (1982). Toxic effects of eosinophil secretion products on isolated rat heart cells in vitro. Biochem. J. 204, 75–80. Takatsu, K., Takaki, S., and Hitoshi, Y. (1994). Interleukin-5 and its receptor system: implications in the immune system and inflammation. Adv. Immunol. 57, 45–90. Ten, R. M., Pease, L. R., McKean, D. J., Bell, M. P., and Gleich, G. J. (1989). Molecular cloning of the human eosinophil peroxidase. Evidence for the existence of a peroxidase multigene family. J. Exp. Med. 169, 1757–1769. Throsby, M., Herbelin, A., Pleau, J. M., and Dardenne, M. (2000). CD11c+ eosinophils in the murine thymus: Developmental regulation and recruitment upon MHC class I-restricted thymocyte deletion [In Process Citation]. J. Immunol. 165, 1965–1975. Tominaga, A., Takaki, S., Koyama, N., Katoh, S., Matsumoto, R., Migata, M., Hitoshi, Y., Hosoya, Y., Yamauchi, S., Kanai, Y., Miyazaki, J.-I., Usuku, G., et al. (1991). Transgenic mice expressing a B cell growth and differentiation factor (interleukin 5) develop eosinophilia and autoantibody production. J. Exp. Med. 173, 429–439. Ulrich, M., Petre, A., Youhnovski, N., Promm, F., Schirle, M., Schumm, M., Pero, R. S., Doyle, A., Checkel, J., Kita, H., Thiyagarajan, N., Acharya, K. R., et al. (2008). Posttranslational tyrosine nitration of eosinophil granule toxins mediated by eosinophil peroxidase. J. Biol. Chem. 283, 28629–28640. Vadas, M., Lopez, A., Gamble, J., Khew, G. Y., Smith, W., Bernard, C., Cockerill, G., Cockerill, P., Shannon, F., Sun, Q., Korpelainen, E., van der Heuvel, C., et al. (1994). Cytokines and allergy. J. Allergy Clin. Immunol. 94, 1289–1293. van Rijt, L. S., Vos, N., Hijdra, D., De Vries, V. C., Hoogsteden, H. C., and Lambrecht, B. N. (2003). Airways eosinophils accumulate in the mediastinal lymph nodes but lack antigenpresenting potential for naive T-cells. J. Immunol. 171, 3372–3378. Venge, P., Bystrom, J., Carlson, M., Hakansson, L., Karawacjzyk, M., Peterson, C., Seveus, L., and Trulson, A. (1999). Eosinophil cationic protein (ECP): Molecular and biological
120
Carine Blanchard and Marc E. Rothenberg
properties and the use of ECP as a marker of eosinophil activation in disease. Clin. Exp. Allergy 29, 1172–1186. Venge, P., Dahl, R., Hallgren, R., and Olsson, I. (1980). Cationic proteins of human eosinophils and their role in the inflammatory reaction. In ‘‘The eosinophil in health and disease’’ (A. A. F. Mahmoud, and and K. F. Austin, Eds.), pp. 1131–1142. Grune and Stratton, New York. Voehringer, D., van Rooijen, N., and Locksley, R. M. (2007). Eosinophils develop in distinct stages and are recruited to peripheral sites by alternatively activated macrophages. J. Leukoc Biol. 81, 1434–1444. Wagner, J. M., Hustin, J., Bonno, M., Kephart, G. M., Gurian, K. V., and Gleich, G. J. (1994). Pregnancy-associated major basic protein: Deposition of protein and expression of mRNA at the maternal-fetal junction in early and late gestation. Placenta. 15, 625–640. Walsh, E. R., Sahu, N., Kearley, J., Benjamin, E., Kang, B. H., Humbles, A., and August, A. (2008). Strain-specific requirement for eosinophils in the recruitment of T cells to the lung during the development of allergic asthma. J. Exp. Med. 205, 1285–1292. Wang, H. B., Ghiran, I., Matthaei, K., and Weller, P. F. (2007). Airway eosinophils: Allergic inflammation recruited professional antigen-presenting cells. J. Immunol. 179, 7585–7592. Wasmoen, T. L., Bell, M. P., Loegering, D. A., Gleich, G. J., Prendergast, F. G., and McKean, D. J. (1988). Biochemical and amino acid sequence analysis of human eosinophil granule major basic protein. J. Biol. Chem. 263, 12559–12563. Weg, V. B., Williams, T. J., Lobb, R. R., and Nourshargh, S. (1993). A monoclonal antibody recognizing very late activation antigen-4 inhibits eosinophil accumulation in vivo. J. Exp. Med. 177, 561–566. Wegner, C. D., Gundel, R. H., Reilly, P., Haynes, N., Letts, L. G., and Rothlein, R. (1990). Intercellular adhesion molecule-1 (ICAM-1) in the pathogenesis of asthma. Science 247, 456–459. Wu, W., Chen, Y., and Hazen, S. L. (1999). Eosinophil peroxidase, nitrates, protein tyrosyl residues. Implications for oxidative damage by nitrating intermediates in eosinophilic inflammatory disorders. J. Biol. Chem. 274, 25933–25944. Yamada, H., Izutani, R., Chihara, J., Yudate, T., Matsukura, M., and Tezuka, T. (1996). RANTES mRNA expression in skin and colon of patients with atopic dermatitis. Int. Arch. Allergy Immunol. 1(111 Suppl), 19–21. Yamada, Y., Rothenberg, M. E., Lee, A. W., Saito Akei, H., Brandt, E. B., Williams, D. A., and Cancelas, J. A. (2006). The FIP1L1-PDGFR{alpha} fusion gene cooperates with IL-5 to induce murine hypereosinophilic syndrome (HES)/chronic eosinophilic leukemia (CEL)like disease. Blood 107, 4071–4079. Yang, D., Chen, Q., Su, S. B., Zhang, P., Kurosaka, K., Caspi, R. R., Michalek, S. M., Rosenberg, H. F., Zhang, N., and Oppenheim, J. J. (2008). Eosinophil-derived neurotoxin acts as an alarmin to activate the TLR2-MyD88 signal pathway in dendritic cells and enhances Th2 immune responses. J. Exp. Med. 205, 79–90. Yoon, J., Ponikau, J. U., Lawrence, C. B., and Kita, H. (2008). Innate antifungal immunity of human eosinophils mediated by a beta2 integrin, CD11b. J. Immunol. 181, 2907–2915. Young, J. D., Peterson, C. G., Venge, P., and Cohn, Z. A. (1986). Mechanism of membrane damage mediated by human eosinophil cationic protein. Nature 321, 613–616. Yousefi, S., Gold, J. A., Andina, N., Lee, J. J., Kelly, A. M., Kozlowski, E., Schmid, I., Straumann, A., Reichenbach, J., Gleich, G. J., and Simon, H. U. (2008). Catapult-like release of mitochondrial DNA by eosinophils contributes to antibacterial defense. Nat. Med. 14, 949–953. Yu, C., Cantor, A. B., Yang, H., Browne, C., Wells, R. A., Fujiwara, Y., and Orkin, S. H. (2002). Targeted deletion of a high-affinity GATA-binding site in the GATA-1 promoter leads to selective loss of the eosinophil lineage in vivo. J. Exp. Med. 195, 1387–1395.
Biology of the Eosinophil
121
Zhang, J., Lathbury, L. J., and Salamonsen, L. A. (2000). Expression of the chemokine eotaxin and its receptor, CCR3, in human endometrium. Biol. Reprod. 62, 404–411. Zheutlin, L. M., Ackerman, S. J., Gleich, G. J., and Thomas, L. L. (1984). Stimulation of basophil and rat mast cell histamine release by eosinophil granule-derived cationic proteins. J. Immunol. 133, 2180–2185. Zimmermann, N., Daugherty, B. L., Kavanaugh, J. L., El-Awar, F. Y., Moulton, E. A., and Rothenberg, M. E. (2000a). Analysis of the CC chemokine receptor 3 gene reveals a complex 50 exon organization, a functional role for untranslated exon 1, and a broadly active promoter with eosinophil-selective elements. Blood 96, 2346–2354. Zimmermann, N., Hershey, G. K., Foster, P. S., and Rothenberg, M. E. (2003). Chemokines in asthma: Cooperative interaction between chemokines and IL-13. J. Allergy Clin. Immunol. 111, 227–242; quiz 243. Zimmermann, N., Hogan, S. P., Mishra, A., Brandt, E. B., Bodette, T. R., Pope, S. M., Finkelman, F. D., and Rothenberg, M. E. (2000b). Murine eotaxin-2: A constitutive eosinophil chemokine induced by allergen challenge and IL-4 overexpression. J. Immunol. 165, 5839–5846.
CHAPTER
4 Basophils: Beyond Effector Cells of Allergic Inflammation John T. Schroeder
Contents
1. Introduction 2. Development and Inflammatory Mediator Content 3. Cell-Surface Markers 3.1. Adhesion and migration 3.2. Cytokine receptors 3.3. Activation-linked 3.4. Innate immunity 4. Human Basophil Cytokine Secretion 4.1. IL-4 4.2. IL-13 4.3. Other cytokines 5. Basophil Participation in Human Disease 5.1. Allergic inflammation 5.2. Innate immune responses 5.3. Delayed-type hypersensitivity 6. Basophils in Mouse Models of Th2 Inflammation 7. Concluding Remarks References
Abstract
Despite being first described in humans nearly 130 years ago, the basophil granulocyte has received little recognition other than being the least common leukocyte circulating in blood. Even after its identity as the source of histamine released by blood cells in response to reaginic IgE, its role in allergic disease has largely been viewed as redundant to that of the tissue mast cell. This line of
124 125 127 127 128 130 133 134 134 137 138 139 139 143 145 146 151 152
The Department of Medicine, Division of Allergy and Clinical Immunology, The Johns Hopkins Asthma and Allergy Center, Johns Hopkins University, Baltimore, Maryland 21224 Advances in Immunology, Volume 101 ISSN 0065-2776, DOI: 10.1016/S0065-2776(08)01004-3
#
2009 Elsevier Inc. All rights reserved.
123
124
John T. Schroeder
thought, however, is changing with evidence that has emerged during the last 15 years. Not only have these rare cells been shown to constitute a significant source of cytokines (IL-4 and IL-13) vital to the pathogenesis of allergic disease, but by doing so, may very well modulate T-helper 2-type inflammation at the level of T-cell/dendritic cell interactions. This novel concept combined with the fact that basophils selectively infiltrate allergic lesion sites has sparked greater interest in this once overlooked immune cell, both in adaptive as well as in innate immunity.
1. INTRODUCTION Paul Ehrlich’s fascination in staining various tissues eventually led this German-born scientist and putative ‘‘Father of Immunology’’ to first described the basophil in 1879—a cell that resembled tissue mast cells for which he had also described just 2 years earlier (Ehrlich, 1877, 1879). He did so after treating dried blood films with various aniline dyes. And while this observation, along with his descriptions of eosinophils and neutrophils, helped launch the fields of hematology and immunology, it would take nearly 100 additional years before the basophil would be identified as the source of histamine among blood leukocytes. Morphologically similar to tissue mast cells with the appearance of darkly stained cytoplasmic granules, basophils were later implicated in binding IgE immunoglobulin with high affinity and in releasing preformed histamine upon activation with specific allergen or with anti-IgE antibodies (Ishizaka et al., 1972). This finding then prompted the idea that basophils, being easily accessible from blood, could serve as a surrogate by which to study the far less assessable mast cell, including its role in allergic reactions. However, in vitro studies that began in the 1970s and extended through the early 1990s revealed that this line of thought was not fully valid and that a number of inconsistencies existed between these cell types (Lichtenstein and Bochner, 1991; MacGlashan et al., 1983; Schleimer et al., 1983). Only during the last 15 years has there been a renewed appreciation for the basophil and its role in allergic diseases— this coming mostly from evidence that these cells secrete cytokines in addition to inflammatory mediators. Most notably, there is substantial evidence that basophils (more so than the mast cells) represent an important source of IL-4 and IL-13, both of which are critical in the pathogenesis of allergic disease (Schroeder et al., 2001b). This concept first rose to acceptance with in vitro studies using human basophils and has only recently been substantiated in vivo using IL-4 reporter transgenic mice. Thus, not only do basophils contribute to effector cell functions in allergic inflammation by releasing potent inflammatory mediators, but by
Basophils: Beyond Effector Cells of Allergic Inflammation
125
secreting IL-4/IL-13 they also have the potential to direct the overall immune response towards a Th2 phenotype. This review will focus on some of the more recent developments regarding basophil cytokine secretion, while also highlighting mounting evidence that innate immunity plays an important role in regulating basophil function that extends beyond IgE. In doing so, however, a brief review and update on other phenotypic and functional aspects is also included to accentuate the achievements made and the progress yet to come in understanding the overall biology of this intriguing cell.
2. DEVELOPMENT AND INFLAMMATORY MEDIATOR CONTENT As with all granulocytes basophils develop in the bone marrow and are released from this organ as fully mature cells. With a survival span estimated to be 2–3 days, their longevity is far less than that of mast cells, which are thought to survive for months. In humans, IL-3 is thought to play a critical role in basophil maturation and there is a long history of studies showing that recombinant forms of this cytokine support the in vitro growth of basophil-like cells from CD34þ precursors (Kepley et al., 1998; Kirshenbaum et al., 1992; Langdon et al., 2008; Takao et al., 2003). This has also been substantiated in vivo where recombinant human IL-3 causes a basophilia when infused into nonhuman primates (Dvorak et al., 1989). In contrast, IL-3 has little impact on the final stages of mast cell development in humans, even though, ironically, it alone has long been known to support the growth of murine mast cells from bone marrow precursors in vitro. Instead, stem cell factor (SCF) is required for the maturation of culture-derived human mast cells and facilitates the development of murine mast cells. Whether other growth factors/cytokines assist in basophil development has not been fully elucidated. Recent studies by Denburg and colleagues show evidence that the CD34þ progenitors of infants at high risk for atopy and asthma have an increased expression of IL-3 receptor (CD123), yet a decrease in receptors for IL-5 (CD125). This observation has also been extended to infants who experience a greater number of airway respiratory infections (ARI) (Fernandes et al., 2008). When cultured in recombinant IL-3, these progenitors have a high preponderance to develop into cells expressing basophil/eosinophil characteristics. As will become evident below, the relevance of these findings extends to mature basophils where IL-3 not only enhances essentially every IgE-dependent response seen in these cells but is also known to directly activate basophils for mediator release
126
John T. Schroeder
and cytokine secretion. It is therefore becoming apparent that IL-3 should not only be viewed as a growth factor important for basophil development but also as a cytokine playing a key role in the pathogenesis of allergic disease. Like mast cells, basophils release several inflammatory mediators long known to play a central role in the pathophysiology of allergic disease (see Schroeder et al., 2001b for general review). Most commonly recognized are histamine and leukotriene C4 (LTC4), which are best known for their capacity to cause smooth muscle contraction. Although beyond the scope of this review, it is also important to note that histamine and LTC4 are more recently shown to possess distinct functions that imply an immunomodulatory role for these mediators and thus for the cells that release them (Austen, 2007; MacGlashan, 2003). Whatsoever, it has long been thought that basophils release these substances during and/or after selectively infiltrating sites of allergic inflammation and thus contribute towards the symptoms of the so-called late phase response (LPR), as discussed below. This is in contrast to the release of these mediators from tissue mast cells, which accounts towards the acute signs and symptoms associated with allergic reactions. Human basophils are also reported to release several other substances that are believed to possess inflammatory properties, although their exact role in allergic inflammation remains unclear at this time. In particular, so-called, basogranulin, which is currently defined by the monoclonal antibody, BB1, is a granule-specific highly basic protein secreted as a large complex of 5 106 Da (McEuen et al., 2001). It is specific to basophils and is secreted in vitro under the same conditions important for histamine release, including those occurring with both IgE-dependent and -independent stimulation (Mochizuki et al., 2003). In addition, basophils are recently reported to synthesize and secrete granzyme B—a product more commonly associated with Natural killer (NK) cells (Spiegl et al., 2008; Tschopp et al., 2006). This mediator, however, is readily synthesized and released by basophils after IL-3 exposure and is not generally made under conditions involving IgE receptor activation. Granzyme B has also been detected in bronchoalveolar lavage (BAL) fluids following allergen challenge, but its cellular source in this response is yet to be determined. Finally, it is also worth noting that basophils have long been reported to express relatively small levels of alpha-tryptase but not beta-tryptase—the later of which is more commonly associated with mast cells. However, a more recent study reports the presence of tryptase in basophils at levels higher than previously thought (Foster et al., 2002). Although the levels detected ranged more than a 100-fold among subjects, there were no correlations with various disease states. Nonetheless, these findings could raise concerns as to whether tryptase is as specific a marker to mast cells as is presently thought.
Basophils: Beyond Effector Cells of Allergic Inflammation
127
3. CELL-SURFACE MARKERS 3.1. Adhesion and migration As noted above, basophils circulate in the blood under homeostatic conditions but will migrate into tissue during the LPR, which often follows acute allergic reactions. While the exact mechanism of how they achieve this is not fully understood, in vitro studies have provided information regarding the adhesion molecules most likely involved (Bochner and Schleimer, 2001). In general, those that appear important for eosinophils are also likely to regulate basophil migration. For example, L-selectin (CD62L), which attaches to the ligands, CD34 and MAdCAM-1, is thought to initiate attachment to endothelium. However, firm adhesion is mediated by specific b1- and b2-integrins, along with intracellular adhesion molecules (ICAMs) (or Ig-like molecules), and is ultimately necessary for transmigration through this barrier. Very late antigen (VLA)-4 is the b1-integrin expressed on basophils that is thought to mediate this process. Its ligand is vascular cell adhesion molecule (VCAM-1), which happens to be the same molecule most important for the transendothelial migration of eosinophils and Th2 cells. It has long been known that IL-4 and IL-13 selectively induce VCAM-1 on endothelium (Bochner et al., 1995; Moser et al., 1992; Schleimer et al., 1992). It, therefore, goes to reason that basophils, by producing these cytokines, have the potential to facilitate their own migration into tissue as well as that of eosinophils and lymphocytes. Basophils express a variety of seven membrane transverse receptors that bind chemotactic factors and in all probability play a role in attracting basophils into allergic lesion sites (reviewed in Esche et al., 2005). First, it is important to acknowledge once again that many of these are also important in eosinophil migration, which gives explanation for the comigration of these two cell types into allergic lesion sites. Most are members of the CCR family of receptors that bind CC (or the b-family) chemokines. Among those with overlapping binding (predominately to CCR3) are members of the monocyte chemotactic protein (MCP) family, including MCP-1 (CCL2), -3 (CCL7), and -4 (CCL13), but also RANTES (CCL5), MIP-1a (CCL3), eotaxin-1 (CCL11), and -2 (CCL24). Stromal cell-derived factor (SDF)-1 (CXCL12) is an exception to the rule. This potent chemotactic factor is a member of the CXC family that binds CXCR-4 and is inducible on basophils cultured under a variety of conditions. Likewise, the CXCR2 binding chemokine, IL-8 (CXCL8), is also reported to cause basophil migration. The chemoattractant-homologous receptor expressed on Th2 cells (CRTH2, also known as DP2) is the most recent receptor identified on basophils (as well as on eosinophils and Th2 cells) that is important in the selective migration of these cells (Hirai et al., 2001; Nagata et al., 1999).
128
John T. Schroeder
CRTH2, however, is not a chemokine receptor but instead is a G-protein coupled receptor that mediates high affinity binding of the mast cell product, prostaglandin D2 (PGD2). It is to be distinguished from DP1, which also binds PGD2 with high affinity but is not expressed on basophils. Although CRTH2 is implicated in playing a significant role in basophil migration, there is also mounting evidence that it plays a critical role in chronic allergic inflammation by also helping to polarize for Th2 responses (Pettipher, 2008). Although the chemotactic factors listed above function primarily for migration, many have long been reported to activate basophils for mediator release, and more recently for cytokine secretion. In fact, MCP-1, -3, and -4 (Dahinden et al., 1993; Uguccioni et al., 1997) along with SDF-1 (Jinquan et al., 2000), and IL-8 (Krieger et al., 1992) are all reported to cause histamine release. Many of these early studies, however, were done using basophils from highly allergic subjects who typically have hyper-responsive cells, or were conducted using cells that had undergone treatment with IL-3 in order to prime for greater responsiveness. It is our experience that these chemotactic factors potentially prime for greater IgE-mediated release, as reported for eotaxin (Devouassoux et al., 1999b), but typically do not directly activate basophils for histamine release and cytokine secretion.
3.2. Cytokine receptors Human basophils express several cytokine receptors, thus raising the possibility that they communicate with a variety of other leukocytes (Toba et al., 1999). Among those identified are receptors that bind specific interleukins including IL-2, IL-3, IL-4, IL-5, and most recently, IL-33 (Smithgall et al., 2008). At this time, however, there is only evidence that IL-3 and IL-33 mediate significant functional responses. Basophils are but one of two cell types in blood (immature plasmacytoid dendritic cells (pDCs) being the other) that express IL-3 receptors (CD123) at exceedingly high levels (Dzionek et al., 2000; Sarmiento et al., 1995). While the exact number of receptors has yet to be determined, flow cytometry indicates expression levels that are nearly 2 logs greater than any other cell type. This characteristic, in fact, has led to CD123 expression being a useful marker to specifically gate on basophils (and pDCs) during flow analysis (Ducrest et al., 2005). As noted above, IL-3 plays an important role in the maturation of basophils from precursor cells and recent evidence points to this cytokine as an important growth factor for pDCs as well. Thus, the two cell types retain high-level CD123 expression throughout their development and are responsive to IL-3 protein having reached maturity. Exactly why these two seemingly very different cell types share this uniqueness remains to be determined.
Basophils: Beyond Effector Cells of Allergic Inflammation
129
As emphasized throughout this review, there is no other cytokine known that has a greater impact on basophil survival or on the ability to augment secretion than does IL-3. However, there is more recent evidence that IL-33 is not far behind IL-3 in affecting basophil function. This cytokine binds to the innate immune associated receptor, ST2—a member of the IL-1 receptor family that has been studied in the context of its association with Th2-associated inflammation (Schmitz et al., 2005). IL-33 binding to ST2 expressed on basophils has been shown to synergize with IL-3 to induce IL-4 and IL-13 secretion, even in the absence of IgE receptor-dependent activation (Smithgall et al., 2008). In these studies, basophils were shown to markedly upregulate ST2 expression following IL-3 exposure, which may partially explain the need for this cytokine in order for IL-33 activity to be manifested. Nerve growth factor (NGF) and human recombinant histaminereleasing factor (HrHRF) are two other cytokines that enhance functional responses in basophils (Burgi et al., 1996). For NGF, this activity is mediated by its binding to the TrkA receptor found on these cells. Like IL-3, it too has the capacity to directly induce IL-13 from basophils and to augment mediator release and cytokine secretion stimulated through the IgE receptor (Sin et al., 2001). However, this activity is substantially less than that observed for IL-3. In fact, IL-3, IL-5, and NGF have all been shown to induce similar signal transduction events in human basophils, but with subtle differences that are more related to potency of the individual cytokines (Miura et al., 2001). In contrast, the receptor for HrHRF remains elusive even though this factor has long been known to induce histamine release and IL-4 secretion from basophils of a select group of allergic subjects (Escura et al., 1998). Basophils releasing to HrHRF have reduced levels of the Src homology 2 domain—containing inositol 50 phosphatase (SHIP)—a negative regulator of cellular responses, compared to those not responding to HrHRF (Vonakis et al., 2001). Direct evidence linking releasability to HrHRF with reduced SHIP levels has since been provided in studies that directly suppress this phosphatase in culture-derived basophils and mast cells using siRNA technology (Langdon et al., 2008). Moreover, recent studies further show that HrHRF enhances basophil responses through signaling cascades that differ from those used by IL-3, IL-5, and NGF (Vonakis et al., 2008). While there is currently a good understanding of the cytokines and factors that augment basophil activity, there is substantially less information of those that possess inhibitory activity toward these cells. Initially, there was the thought that classic Th1-like cytokines (e.g., IFN-g) or that those possessing immunosuppressive activity (e.g., IL-10) would suppress the IL-4/IL-13-producing capacity of basophils. However, there are no such reports at this time, even though one such cytokine (e.g., IL-10) is reported to suppress mast cell function (Kennedy Norton et al., 2008). Indeed, our own
130
John T. Schroeder
investigations from testing various cytokines, including IFN-g, IL-10, IL-12, TGF-b, and IL-18 have all failed in finding any that inhibit IgE-mediated or IgE-independent cytokine secretion from basophils, let alone mediator release ( J. T. Schroeder, unpublished observations). In spite of these negative results, there is one class of cytokines, the Type I IFNs that seemingly suppress basophil responses by interacting through IFNaR2 receptors expressed on their cell surface. For example, IFN-a and to a lesser extent IFN-b have both been shown to inhibit IL3-dependent secretion of IL-13 and IL-4 (Chen et al., 2003). Although the exact mechanism for this inhibition requires further investigation, preliminary findings (Schroeder et al., 2007a) and the current literature suggests a STAT-1-dependent induction of suppressor of cytokine synthesis (SOCS) genes. IFN-a induces STAT-1 in many cell types, which leads to the transcription of SOCS genes (Yoshimura et al., 2007). Both SOCS-1 and SOCS-3 have the potential to interact with JAK2 kinase to prevent subsequent docking of STAT-5, both of which are critical elements linked to early IL-3 signaling events in human basophils (Miura et al., 2001). Interestingly, pDCs are considered the major source of Type I IFNs, especially following activation with TLR9 agonists such as unmethylated CpG-DNA (Liu, 2005). Consequently, it seems logical to suggest that these cells may play a role in regulating basophil responses. In fact, there is other incidental evidence to support the belief that an ‘‘axis-interplay’’ exists between basophils and pDCs. For example, it has been shown that histamine, IL-13, and IL-4—all basophil products are likewise capable of inhibiting IFN-a production by pDCs (Hober et al., 1998; Mazzoni et al., 2003). As a result, activation of either cell type can theoretically have suppressive activity towards the other, which implies cross-regulation of innate and IgE-dependent adaptive immune responses. With this concept in mind, it is also relevant to note that TLR9-dependent IFN-a secretion is recently reported to be impaired in allergic subjects (Gehlhar et al., 2006; Tversky et al., 2008). Moreover, in vitro results show that pDCs, when activated using IgE-dependent stimulation, downregulate TLR9 expression and IFN-a production, which is seemingly TNF-a-dependent (Schroeder et al., 2008b).
3.3. Activation-linked The high affinity IgE receptor (FceRI) remains the single most significant activation-linked molecule known on basophils (and mast cells), which, by its association with immediate hypersensitivity reactions, has essentially defined these cell types for the past 40 years. Naturally, the specific details of IgE, FceRI structures, and the intracellular signaling pathways linked to FceRI aggregation in basophils are beyond the scope of this review and, in fact, are described in detail elsewhere (Gould and Sutton,
Basophils: Beyond Effector Cells of Allergic Inflammation
131
2008; Holowka et al., 2007; Kraft et al., 2004; MacGlashan, 2005). Nonetheless, a few of the essentials are worth mentioning here. First, the receptor found on basophils and mast cells is comprised of 4 subunits—an alpha, beta, and 2 gamma chains to form a tetramer structure (abg2). Two extracellular domains on the a-subunit allow IgE binding, whereas signaling events are initiated through immunoreceptor tyrosine-based activation motifs (ITAMs) located within intracellular portions of the b- and g-subunits. In humans, a trimeric form of FceRI, which lacks the b-subunit (ag2), is also found on antigen-presenting cells (APCs) including Langerhans cells, monocytes, and blood dendritic cells (both monocytoid and plasmacytoid). And, while the role of the ag2 variant remains poorly understood, there is in vitro evidence that it plays a role in antigen presentation. As noted above, it may also play a role in suppressing specific innate immune functions in pDCs (Schroeder et al., 2008b). The number of FceRIa molecules expressed on human basophils ranges between 5000 and 1 million and is driven by serum IgE concentrations (MacGlashan, 1993, 2005). In fact, the importance of IgE levels in determining FceRI expression on basophils, mast cells, and APCs has only recently been appreciated with the development of anti-IgE therapy. Studies show that the administration of omalizumab causes a rapid drop in serum free IgE levels within a day. IgE expression on basophils subsequently decreases only to be followed by a decline in FceRIa expression (T1/2 ¼ 3 days) (MacGlashan et al., 1997). Yet, all three parameters eventually return to near baseline levels upon cessation of treatment (Saini et al., 1999). Importantly, it is estimated that just 200–300 IgE/ receptor cross-links are sufficient to initiate mediator release from basophils (MacGlashan, 1993). This means that a minimum reduction in allergen specific IgE of 96% is required to achieve clinical efficacy with omalizumab. Thus, both the amount of drug and the duration that it is given become very important parameters in achieving this efficacy. It is important to stress that the capacity of one’s basophils to react to an IgE-dependent stimulus is not necessarily determined by the density of occupied receptor sites. Logically, there is a requirement for a sufficient number of receptor sites to be occupied with specific IgE during antigenic stimulation. However, studies have long demonstrated a wide variation in basophil responses to IgE/FceRI cross-linking stimuli (e.g., anti-IgE antibody) among different subjects, even when the actual numbers of receptor sites do not significantly differ (MacGlashan, 1993). Basophils from subjects expressing the so-called ‘‘nonreleaser’’ phenotype fail to release histamine upon antigenic stimulation, regardless of FceRI expression levels. Kepley et al. had shown that this unresponsiveness correlated with the inability to detect levels of spleen tyrosine kinase (syk)—an early signaling component in FceRI-dependent responses (Kepley et al., 1999). Results emerging from the laboratory of Dr. Donald MacGlashan further
132
John T. Schroeder
point to the levels of syk as being a key predictor of basophil function among the general population. An analysis of six early signaling components revealed that syk levels accounted for much of the variance in basophil responses (MacGlashan, 2007). Whereas previous studies using mice had implicated SHIP levels as being the key component in regulating mast cell responses, this signaling element in basophils appears less important compared to syk. Interestingly, MacGlashan has additionally shown that prolong incubations (18 h) with activating anti-IgE antibody cause a marked decrease in syk levels, with no effects on some 23 other signaling elements (MacGlashan and Miura, 2004; MacGlashan et al., 2008). Such FceRI aggregation in vivo, even if subtle in nature with no clinical consequences, could theoretically account for the wide profile in syk expression and functional responses among basophils in the general population. MacGlashan, and others, have also proposed that reductions in basophil syk expression/function may account for the therapeutic efficacy resulting from drug desensitization (e.g., aspirin) (MacGlashan and Miura, 2004) and/or with standard immunotherapy (Kepley, 2005). Whereas mast cells are reported to express receptors for IgG, including FcgRI (CD64) and FcgRIIa that are demonstrated to provide activating responses in these cells, there is currently no evidence that human basophils share this feature. In contrast, it has long been known that basophils express FcgRIIb (CD32), or the low affinity IgG-receptor that has been associated with negative regulation in several other cell types. Studies conducted by Kepley et al. were the first to provide evidence suggesting that coaggregating FcgRIIb and FceRI inhibits basophil mediator release and cytokine secretion that normally results from FceRI aggregation alone (Kepley et al., 2000). An Fcg–Fce fusion protein seemingly capable of this costimulation has since been synthesized and shown to inhibit IgEdependent responses in basophils (Zhu et al., 2002), but also those of mast cells (Kepley et al., 2004) and dendritic cells (Kepley et al., 2003). Recent in vivo studies using this reagent and a fusion protein composed of a truncated human IgG Fcg1 and the major cat allergen Fel d1 have indicated clinical efficacy in animal models of allergic inflammation (Zhu et al., 2005), including one in nonhuman primates (Van Scott et al., 2008). Assuming this reagent will have similar efficacy in humans will nonetheless raise questions regarding its mechanism. For instance, several studies show that some human mast cell populations (e.g., skin) actually express IgG receptors associated with activation (i.e., FcgRIIa and FcgRI), while lacking the FcgRIIb ideally targeted by this reagent (Woolhiser et al., 2004; Zhao et al., 2006). This information would imply that Fcg–Fce fusion proteins might potentially activate rather than suppress specific mast cell populations. It was shown more than 15 years ago that human basophils are one of just a few cell types that express CD40L (Devouassoux et al., 1999a; Gauchat et al., 1993); others include mast cells, activated T cells, platelets,
Basophils: Beyond Effector Cells of Allergic Inflammation
133
and endothelial cells. When engaged with CD40 on B cells, CD40L provides an important activation signal necessary for these lymphocytes to develop into immunoglobulin-producing plasma cells. It was therefore demonstrated in vitro that basophils, by additionally secreting IL-4 and IL-13, could provide the two necessary signals for B cells to produce IgE (Gauchat et al., 1993). Whether this interaction occurs in vivo remains to be determined, but seems more probable in light of the work done in the mouse model (see below). Basophils express several other activation-linked markers that are worth discussing, including CD203c, CD63, and CD69. The CD203c marker is an ectoenzyme (ectonucleotide pyrophosphatase/phosphodiesterase-3) that is constitutively and specifically expressed on the cell surface and within intracellular compartments of basophils, mast cells, and precursors of these cells (Buhring et al., 2001). Because its expression is unique to basophils among the cells circulating in blood, its detection by flow cytometry has been used in specifically identifying basophils within a mixed leukocyte suspension. CD63 is an endosomal-associated tetraspanin protein that is actually found on several cell types, particularly activated platelets where it has been shown to interact with ATPases (Goschnick and Jackson, 2007). Whereas the exact role(s) of CD203c and CD63 in basophil biology remains to be determined, their expression is both rapidly and markedly upregulated following IgE-dependent activation. As a result, there has been substantial effort in recent years to exploit this phenomenon in flow cytometrybased assays for use in diagnosing clinical disease (de Weck et al., 2008). However, a variety of issues relating mostly to specificity and to the concentration of stimulus required for inducing these activation markers has raised concern regarding their diagnostic utility (Hamilton, 2004; Kleine-Tebbe et al., 2006). Finally, CD69 expression, like that of CD63, is not specific to basophils but is also found on several cell types. In contrast to CD63 and CD203c, the increased expression of CD69 on basophils following IgEdependent activation is considerably slower, requiring several hours (Suzukawa et al., 2007). As noted below, there is recent evidence that this expression is secondary to IL-3 production by the basophil itself. In fact, in vitro studies show that CD69 expression on basophils is more specific to IL-3 exposure than to other modes of activation (Yoshimura et al., 2002).
3.4. Innate immunity The mere fact that basophils are granulocytes implicates a role for these cells in innate immunity. Indeed, several types of receptors associated with innate immune responses have been identified on these cells, although their exact significance remains a mystery. In particular, basophils express several receptors known to bind complement factors, including CR1, CR3, CR4, and that which binds the anaphylatoxin C5a
134
John T. Schroeder
(CD88). It is been known since the mid 1970s that C5a is a potent stimulus of histamine release from basophils, inducing this mediator independently of IgE/receptor activation (Siraganian and Hook, 1976). Likewise, the seven-membrane transverse receptor for the bacterial peptide, fMLP, is also expressed by basophils (Siraganian and Hook, 1977). It too functions in mediator release with basophils from an estimated 90% of the general population releasing histamine when challenged with this agent. Toll-Like Receptors (TLR) are emerging as key players in innate immunity and have been identified on a variety of immune cells. In fact, several laboratories have identified TLR2 (along with its coreceptors, TLR1 and TLR6), TLR4, and TLR9 expression on/in human basophils (Bieneman et al., 2005; Komiya et al., 2006; Sabroe et al., 2002). As noted below, however, only TLR2 specific ligands are reported to possess functional activity at this time. Finally, another class of innate immune receptors known as leukocyte immunoglobulin-like receptors (LIR) is also found on basophils (Sloane et al., 2004). While ligands specific for these receptors have yet to be identified, specific antibodies targeting these receptors have been shown to mediate both stimulatory and inhibitory activity. A schematic representation shown in Fig. 4.1 summarizes many of the receptor/ligand interactions associated with human basophil responses resulting in mediator release and cytokine secretion.
4. HUMAN BASOPHIL CYTOKINE SECRETION 4.1. IL-4 Among the most significant findings pertaining to basophil biology during the past 15 years has been the discovery that these cells are a rich source of IL-4 and IL-13—perhaps the two most important cytokines associated with allergic disease. For human basophils, this line of investigation arose from work initially conducted with murine mast cell lines and with so-called IL-4-producing non-T, non-B cells identified in the spleen of mice infected with Nippostrongylus brasiliensis (Seder et al., 1991a,b). And, while several of these early studies demonstrated the capacity of mast cell lines to secrete various cytokines, it were those conducted by Plaut et al. that first associated the generation of specific Th2 cytokines with IgE receptor (FceRI) cross-linking (Plaut et al., 1989). At that time, IL-4, IL-5, and IL-6 were among those detected following FceRI-dependent stimulation or activation with calcium ionophore. Studies using human cells soon followed by reporting IL-4 (and later IL-13) expression by lung mast cells (Bradding et al., 1992; Brightling et al., 2003). However, these early findings in humans relied mostly on immunohistochemical staining of cells in tissue and have been
Basophils: Beyond Effector Cells of Allergic Inflammation
135
FIGURE 4.1 Human basophils respond to a variety of adaptive- and innate- immune stimuli that regulate their secretion of inflammatory mediators and cytokines pivotal in allergic disease. In particular, both preformed histamine and newly generated LTC4 are secreted within minutes after stimulation through the high affinity IgE receptor (FceRI) by allergen or by an activating anti-IgE antibody. This mode of activation also induces de novo generation of proinflammatory cytokines that are either maximally secreted within 4–6 h (e.g., IL-3 and IL-4) or those (i.e., IL-13) that begin at this time yet are more prolonged. The binding of IL-3 to its receptor (CD123), either through autocrine activity or from other cell sources, directly induces IL-13 and will generally prime basophils for greater responsiveness overall. New evidence shows that IL-33 binding to its receptor, ST2, can synergize with IL-3 to directly induce mediator release and cytokine secretion. In contrast, coligation of FceRI along with FcyRIIb (CD32) is now thought to suppress secretion induced through FceRI. Substances associated with innate immunity also affect basophil function, either negatively or positively. For example, both the complement factor C5a and the bacterial peptide fMLP have long been known to induce mediator release. HrHRF, acting through an unknown receptor, can directly activate basophils from a subgroup of allergic subjects while priming those from most all subjects. Glycoproteins both from helminthes (IPSE/alpha-1) and from viruses (i.e., gp120/HIV) are also reported to activate basophils, acting as ‘‘superantigens’’ that nonspecifically bind IgE. In addition, basophils reportedly express several TLR molecules. TLR2 ligands (e.g., PGN) can directly activate basophils for mediator/cytokine secretion as well as augment FceRI-dependent responses. The functions of other TLR (TLR4, -7, 8, -9) await characterization. Finally, immunoglobulin-like receptors (LIR3 and LIR7) differentially affect basophil function, yet ligands for these receptors have not been identified.
136
John T. Schroeder
more difficult to replicate using mast cell suspensions prepared from tissue (Gibbs et al., 1997, and J. T. Schroeder, unpublished observations). Whether the enzymatic digestion of tissue that is needed when isolating mast cells renders them incapable of making IL-4 is one issue that has never been fully resolved. However, subsequent studies using cultured human mast cells grown from precursor cells have also failed to demonstrate IL-4 production (Yanagihara et al., 1998), which has raised concern regarding the capacity of whether all mast cells secrete this cytokine. In fact, this latter finding is in contrast to basophil-like cells grown from CD34þ precursors under culture conditions with IL-3 alone. These basophil-like cells secrete IL-4 with the same parameters important for IL-4 secretion by basophils isolated from blood (Langdon et al., 2008; Yanagihara et al., 1998). Concurrent studies using human basophils began revealing a picture that looked more like that of murine mast cells rather than what was emerging with their human counterpart. Indeed, IL-4 was the first of these cytokines reportedly made by human basophils, with early findings stating a dependency for IL-3 pretreatment in order for IgE-dependent secretion to occur (Brunner et al., 1993). Subsequent studies conducted in our laboratory, which were later confirmed by others, soon reveal that basophils generated IL-4 without the need for IL-3 although IL-4 secretion in response to IgE/FceRI cross-linking could be augmented several fold with IL-3 costimulation (Gibbs et al., 1996; MacGlashan et al., 1994; Schroeder et al., 1994b). Most significantly, basophils were found to rapidly generate IL-4, with secretion of this cytokine detected within 1 h and peaking by 4 h following stimulation. In addition, they were clearly the predominate IL-4-producing cell in mixed leukocyte suspensions when stimulated with specific allergen or activating anti-IgE antibody (Devouassoux et al., 1999a; Schroeder et al., 1994b). The importance of prolonged calcium responses in human basophil cytokine responses was first shown in studies exploring the parameters regulating IL-4 secretion. Foremost, calcium ionophores (A23187 and ionomycin) were found to be extremely potent stimuli, inducing IL-4 levels approaching ng/106 basophils within 4 h incubation (Schroeder et al., 1994a). Chelating calcium at anytime during the reaction, as achieved with the addition of EGTA, immediately halts secretion. Secondly, it was discovered early on that generation of IL-4 (mRNA and protein secretion) is optimal at concentrations of anti-IgE about a log less than those optimal for mediator release. This phenomenon is also evident when using specific allergen as the stimulus (MacGlashan and Schroeder, 2000). Single-cell calcium studies had previously shown that these suboptimal concentrations, while not prone to inducing rapid large calcium spikes do, however, cause calcium responses that appear more prolonged than those observed during optimal mediator release (MacGlashan and Guo, 1991). Studies now show that other cytokines produced by basophils
Basophils: Beyond Effector Cells of Allergic Inflammation
137
in response to IgE-dependent stimulation (e.g., IL-13 and IL-3) follow many of the same parameters important for IL-4 generation. Studies demonstrating the importance of cytosolic calcium in the generation of IgE-dependent cytokine responses prompted further investigation of whether a calcium-dependent calcineurin pathway might be involved. Indeed, FK506 and CsA, both potent inhibitors of calcineurindependent pathways, inhibit FceRI- and calcium ionophore- dependent secretion of IL-4 (and IL-13) by basophils when used at femptomolar concentrations (Redrup et al., 1998). Concurrent studies using murine mast cell models had demonstrated the importance of the nuclear factor of activated T cell (NFAT) family of transcription factors in the generation of IL-4, with particular emphasis on NFAT2 (NFATc1) in deriving this response (Hock and Brown, 2003). Importantly, the expression of NFAT2 had also been shown to be inducible in most cells types rather than constitutively expressed, as was demonstrated for NFAT1 (NFATc2). However, we found a very different pattern of expression for these transcription factors in human basophils. Our studies revealed that NFAT2 is constitutively expressed in basophils whereas NFAT1 is not found at all (Schroeder et al., 2002). Whether this accounts, in part, for their rapid capacity to secrete IL-4 is not fully understood. However, the NFAT2 identified in the cytosol of activated basophils was shown to bind DNA sequences within the IL-4 promoter.
4.2. IL-13 Human basophils are also very competent in generating IL-13, which, of course, is known to have biological properties that overlap with IL-4. This cytokine is secreted by basophils following IgE-dependent activation or with calcium ionophore, both in a manner very similar to that of IL-4 (Gibbs et al., 1996; Li et al., 1996; Ochensberger et al., 1996; Redrup et al., 1998). However, whereas IL-4 secretion is nearly complete by 4 h after IgE-dependent stimulation, IL-13 production is first evident at this time, with levels of this cytokine peaking some 16–20 h later. Basophils not only secrete IL-13 in response to IgE/FceRI—dependent signals but also in response to other stimuli that do not necessarily act through the IgE receptor (Ochensberger et al., 1996; Redrup et al., 1998). In particular, IL-3 directly induces basophils to make IL-13 in a manner that is pharmacologically distinct from that induced by crosslinking IgE/FceRI complexes. For instance, both FK506 and CsA will prevent cytokine (IL-4 and IL-13) secreted in response to IgE-dependent stimuli as well as that produced in response to ionophore. However, neither of these compounds inhibits IL-13 secreted in response to IL-3, suggesting not only an alternative pathway for the generation of this cytokine, but also one that is likely independent of calcineurin phosphatase activity (Redrup
138
John T. Schroeder
et al., 1998). Although there are reports of IL-3 also inducing IL-4, particularly when combined with other non-IgE-dependent secretagogues, such as C5a (Eglite, 2000), these levels are substantially less than those generated following IgE-dependent activation. Therefore, IL-4 secretion by human basophils is rapid and seemingly most dependent on IgEdependent activation, whereas IL-13 is prolonged and additionally generated in response to IgE-independent stimuli.
4.3. Other cytokines In addition to IL-4 and IL-13, human basophils are also reported to produce several other cytokines typically classified as mediating pro-Th2 activity. For example, at least one recent study reports the production of IL-25—a member of the IL-17 family that is important in promoting the survival of so-called Th2 memory cells bearing the CD4þ CRTH2þ phenotype (Wang et al., 2007). In this study, basophils were found to constitutively express mRNA for IL-25 (also known as IL-17E) and to secrete this cytokine following a 3d culture under costimulatory conditions with IL-3 and anti-IgE antibody (Wang et al., 2007). Most strikingly, basophils from allergic subjects secreted 3-fold greater levels of IL-25 (1600 pg/106 cells) than did eosinophils from the same subjects or basophils from nonallergic individuals. It should be noted that eosinophils were the only other cell type that generated IL-25. One caveat, however, regards the cell-sorting approach taken in preparing the basophils used in this study, which were themselves defined as CRTH2þ cells lacking CD4. Common approaches to determine the presence of basophils, such as morphology with Alcianblue staining or the release of histamine, were not investigated, which raises some concern regarding whether these cells were, indeed, basophils or at least a subset thereof. Nonetheless, the probability seems high in light of previous evidence that basophils express another IL-17 family member, IL-17F (also known as ML-1) (Kawaguchi et al., 2001). Recent evidence has also shown that human basophils rapidly generate IL-3 upon activation through IgE/FceRI complexes (Schroeder et al., 2008a). In particular, mRNA levels were increased within 15 min following activation and had peaked by as much as several thousand fold by 1 h. Likewise, secretion of IL-3 protein was detected by 1 h and had peaked by 4 h post activation—a time course identical to the production of IL-4 by basophils having undergone IgE-dependent activation. These finding, in fact, are not unexpected in light of previous studies reporting that mouse mast cells have the same capacity (Plaut et al., 1989). However, the observation in the human model has significant implications regarding basophil hyper-releasability or ‘‘priming’’—a phenomenon long observed among basophils from allergic subjects. For instance, we were initially unable in these experiments to detect IL-3 protein unless the basophils were activated with calcium
Basophils: Beyond Effector Cells of Allergic Inflammation
139
ionophore—a stimulus that typically induces large quantities of IL-4, IL-13, and presumably other cytokines. Yet, by adding IL-3 receptor (IL-3R) antibodies to prevent potential autocrine binding of IL-3 to its receptor, it suddenly became possible to detect IL-3 protein in the culture supernatants. This finding further suggested that autocrine binding of IL-3 has functional consequences and may actually enable basophils to mediate their own priming, or at least prolong functional responses. As noted above, IL-3 enhances essentially every aspect of basophil function through IL-3 receptors (CD123) densely expressed on the surface of these cells. Therefore, it was not surprising to find that the IL-13 (and IL-4) secreted by basophils in response to IgE-dependent activation was inhibited by as much as 50% with the addition of anti-IL-3R antibody (Schroeder et al., 2008a). Since IL-3 itself induces IL-13 production from basophils, its secretion during the first 4 h following IgE-dependent stimulation had added to the overall production of IL-13 during 16 h incubation. Other autocrine effects of IL-3 production by basophils were seen at the phenotypic level. For example, CD69 is an activation-linked marker that is upregulated on a variety of cells following stimulation. However, its expression had not been linked to IgE receptor activation like that reported for CD63 and CD203c, both of which increase within minutes on basophils with this mode of activation. Yet, the expression of CD69 did increase on basophils within 2 h after activation—during a time that correlated with IL-3 secretion. As expected, the addition of IL-3R antibody at the time of activation markedly reduced the induction of CD69 on basophils (Schroeder et al., 2008a). As discussed below, the priming effect that autocrine IL-3 mediates on basophil IL-13 secretion and CD69 expression may provide insight into several clinically relevant observations. Human basophils are also reported to express mRNA and/or secrete protein for several other cytokines and chemokines worth mentioning. Among the chemokines are MIP-1a, MIP-5, and Eotaxin. At least one study has reported being able to detect IL-1b, IL-6, IL-5, IL-8, and GMCSF (Smithgall et al., 2008), which shares some commonality to what has been detailed in the mouse model (see below). At this time, however, only the secretion of IL-8 and GM-CSF is confirmed in other studies using human cells (Gilmartin et al., 2008).
5. BASOPHIL PARTICIPATION IN HUMAN DISEASE 5.1. Allergic inflammation Ever since the basophil was identified as the blood leukocyte releasing histamine upon challenge with allergen and in a reaction requiring reaginic IgE (Ishizaka et al., 1972), efforts have been made to use this cell as an in vitro surrogate by which to study the more elusive tissue mast cell.
140
John T. Schroeder
Adding to the validity of this concept, early studies had also demonstrated that basophil responses were indeed good predictors of clinical disease (Marone et al., 1994). However, the numerous studies that were to follow testing both cell types, many of which were conducted during the 1970s and 1980s by Lichtenstein and colleagues, demonstrated that there were just as many differences between the two cell types as there were similarities. These early studies therefore provided the rationale to scrutinize the basophil beyond simply being a source of histamine, but instead as an immune cell that plays an important role in the pathogenesis underlying allergic disease. This conviction is stronger today more than ever in light of the continued work being done in the human model and more recently by that arising from studies being done in mice. Foremost, there is now solid evidence in humans that basophils infiltrate sites of allergic inflammation, including those arising from natural exposure to allergen but also from those experimentally induced to produce a LPR. Of course, studies dating back to the 1970s first suggested this by identifying basophils, and mediators specific to these cells, in experimentally induced LPR models in the skin, nose, and lung (Lichtenstein and Bochner, 1991). The development of basophil-specific antibodies suitable for immunohistochemistry have since confirmed these findings by definitively showing the presence of basophils in biopsies taken from inflamed tissue (Irani et al., 1998; KleinJan et al., 2000; Macfarlane et al., 2000). Moreover, the participation of basophils in these LPR lesions sites is further suggested by evidence that they are actively secreting histamine and expressing both IL-4 and IL-13 (Nouri-Aria et al., 2001; Schroeder et al., 2001a,b; J. T. Schroeder, unpublished observations). Basophils have also been identified in tissue taken from various allergic diseases, including rhinitis (Wilson et al., 2001), fatal asthma (Kepley et al., 2001), urticaria (Ying et al., 2002), and atopic dermatitis (Plager et al., 2006). Whether basophil mediator release plays a role in anaphylactic type reactions in humans has yet to be definitively shown. However, the mere fact that these cells circulate in blood with potential to release histamine and LTC4, makes them suspect for at least contributing to the rapid symptoms associated with systemic anaphylaxis, particularly those arising from insect stings and/or food ingestion (Golden, 2007). As emphasized below, studies in mast cell-deficient mice have recently implicated basophils as having a role in anaphylaxis by secreting platelet-activating factor (PAF) (Galli and Franco, 2008; Tsujimura et al., 2008). Indeed, PAF has also been recently implicated in human anaphylaxis (Vadas et al., 2008). And while small quantities of PAF are reportedly generated by human basophils following IgE-dependent activation (Lie et al., 2003), this source has yet to be linked to human anaphylaxis. On the other hand, studies continue to show evidence that there are significant functional differences among basophils isolated from allergic
Basophils: Beyond Effector Cells of Allergic Inflammation
141
compared to nonallergic subjects as well as between different disease states. For example, early studies had demonstrated that basophils from some allergic asthmatics show higher spontaneous release of histamine in vitro without any stimulus other than buffer alone (Akagi and Townley, 1989). Perhaps even stronger evidence for this was seen among subjects suffering from food hypersensitivity and/or atopic dermatitis—conditions that typically present with some of the highest serum IgE levels (Sampson et al., 1989). We have recently confirmed this latter finding and have additionally found greater spontaneous release of IL-4 during the course of a 4-h incubation when investigating basophils from milk allergic children (J. T. Schroeder, unpublished observations). As alluded to above, allergic asthmatics are also reported to possess basophils with a primed phenotype. Rather than spontaneously secreting mediators and cytokines, these cells typically show greater releasability (histamine and/or IL-4 secretion) to a diverse array of stimuli, both physiological (e.g., HrHRF, IL-3, various chemokines, and IgE crosslinking stimuli), and nonphysiological (e.g., D20). In contrast, these substances (with the exception of anti-IgE antibody) do not generally activate basophils from normal subjects (summarized in Schroeder et al., 1995). Several lines of investigation point to IL-13 generation as being perhaps a better indicator of increased basophil responsiveness among allergic subjects, even when spontaneous histamine release is not evident. In a study involving 18 allergic rhinitics and 12 nonallergic controls, basophils from the former group secreted on average 2–3 times more IL-13 in response to IL-3 or to NGF (Sin et al., 2001). This was observed in spite of no significant differences in basophil IL-13 secretion between the two groups of subjects when instead using IgE-dependent stimulation. Additional evidence to support this finding came from experiments investigating the effect of TLR2 ligands on basophil responses (see below). Once again, IL-3 induced greater IL-13 secretion from basophils of allergic subjects and these were themselves augmented several fold upon costimulation with peptidoglygan—a TLR2 ligand (Bieneman et al., 2005). While the exact mechanism(s) underlying the enhanced secretion of IL-13 in allergic individuals remain poorly understood, there is additional evidence linking it to allergen exposure. For example, circulating basophils from allergic rhinitis subjects who underwent experimental nasal allergen challenge in the nose on 3 consecutive days were shown to spontaneously produced IL-13 ex vivo (Saini et al., 2004). This response was not observed at baseline prior to administration of allergen, yet had subsided 7 days after the third challenge. Evidence that experimental allergen challenge can alter the immune responses of circulating basophils has likewise been observed in a lung model involving mildly asthmatic subjects allergic to either dust mite of ragweed (Schroeder et al., 2007b). The IL-13 secreted by blood basophils from these subjects when
142
John T. Schroeder
stimulated ex vivo with IL-3 had nearly doubled 24 h after a single segmental allergen challenge (SAC). In addition, these IL-13 responses showed a striking correlation with the pulmonary inflammation resulting from the LPR, as determined by both the influx of eosinophils and by the total cells recovered in the BAL. Collectively, these findings help validate the belief that local allergen exposure can mediate systemic effects in the blood by augmenting the proallergic effects of basophils and likely other cell types (Togias, 2000). As mentioned above, in vitro studies have long suggested that IL-3 most likely accounts for the in vivo priming of basophils. This should be particularly true for IL-13 responses, which are themselves induced in basophils exposed to IL-3 alone. With evidence that basophils make IL-3 and express many receptors for this cytokine on their cell surface, then it is not unreasonable to conclude that they regulate their own production of IL-13 (Schroeder et al., 2008a). Whether this accounts for the enhanced secretion of IL-13 following the allergen challenge protocols described above remains to be determined, but is seemingly possible even if low levels of allergen were to reach these cells in circulation. Circulating basophils from allergic and nonallergic subjects have also been shown to differ phenotypically, as determined by specific activationlinked markers expressed on their cell surface. In particular, Yoshimura et al. first reported seeing increased CD69 expression on basophils from allergic asthmatics compared to normal subjects (Yoshimura et al., 2002). Saini and colleagues have since extended this observation to include basophils from allergic rhinitis subjects as well as those from chronic idiopathic urticaria patients (Vasagar et al., 2006). Interestingly, the basophils from these latter two groups were also shown to constitutively express CD63, albeit at levels nearly 10-fold less than what could be induced in vitro using anti-IgE antibody. While this CD63 observation might be some indication for low-level in vivo activation mediated through FceRI, another marker of degranulation, CD203c, was not elevated on the basophils of these subjects. Nonetheless, the same investigators have also reported seeing increased CD69 expression on circulating basophils from venom allergic individuals undergoing a sting challenge, with small changes in CD203c even though no changes in CD63 were detected (Gober et al., 2007). Overall, the pattern of these basophil activation markers in allergic individuals bears remarkable commonality with the increased expression of IL-13 also seen in these subjects. For instance, IL-3 is not only a potent stimulus for IL-13 secretion by basophils but is also known to strongly induce the expression of CD69 on these cells in vitro. And, while IgE-dependent activation induces a delayed expression of CD69, this response is secondary to autocrine effects of IL-3 (Schroeder et al., 2008a). Therefore, CD69 expression on circulating basophils is likely a good indication that these cells have
Basophils: Beyond Effector Cells of Allergic Inflammation
143
been exposed to IL-3. This is certainly true in vitro and likely extends to in vivo findings. One question that remains to be determined however is whether the source of this IL-3 is the basophil itself, perhaps having been activated through the IgE receptor by the binding of allergen. If so, then low levels of allergen may very well be reaching basophils in circulation, which could also account for the increased CD63 and/or CD203c that is often coexpressed. Support for this hypothesis may be forthcoming from studies that investigate whether IgE depletion using omalizumab reduces these markers (i.e., IL-13 and CD69) of basophil priming.
5.2. Innate immune responses Whereas basophil responses to allergen naturally link these cells with having a role in allergic disease, their involvement in normal human physiological and immunological processes remains very much a mystery. Nonetheless, there are several areas of investigation that are beginning to emerge suggesting that basophil activation extends beyond the requirement for sensitization with specific IgE. Several laboratories have reported nonspecific interactions between IgE and innate immunerelated stimuli that activate basophil for mediator release and cytokine secretion. In particular, the gp120 glycoprotein of human immunodeficiency virus (HIV) has been show to act like a ‘‘super antigen’’ by interacting with the VH3 region of IgE to induce histamine release and IL-4/ IL-13 secretion (Marone et al., 2007; Patella et al., 2000). It has been suggested, in fact, that this interaction may account in part for the Th2 prevalence and increased IgE levels observed during HIV disease progression (Marone et al., 2000). Similarly, various dietary lectins have been reported to activate basophils, presumably by inducing IgE/FceRI crosslinking resulting from their capacity to bind heavily glycosylated regions of IgE (Haas et al., 1999). At least one glycoprotein from schistosomes, IPSE/alpha-1, is thought to activate basophils for large quantities of IL-4 by nonspecifically interacting with IgE and/or FceRI to induce crosslinking (Schramm et al., 2007). Interestingly, IPSE consists of two N-glycosylation sites that are occupied with glycans consisting of Lewis X motifs that are thought to be important immunogenic elements of this parasite (Wuhrer et al., 2006). Other antigens from various helminths are also capable of activating basophils but do so by binding specific IgE (like allergen) to induce receptor cross-linking (Mitre and Nutman, 2006). Overall, it is predicted that these parasitic responses, by promoting IL-4/IL-13 secretion, play an important role in helping to drive the Th2 inflammation that is common with helminth infections, both in humans as in mice. Accordingly, there is a striking relationship between immediate hypersensitivity reactions and parasitic infections in that increased IgE, eosinophils, basophils, and mast cells are often associated with both
144
John T. Schroeder
immune responses. However, helminth infections essentially do not produce the same clinical manifestations as those seen in allergic disease. Exactly why this disparity exists between the two disease states remains to be determined. As noted earlier several reports have identified specific TLRs expressed on/in human basophils, suggesting that specific ligands for these receptors play a role in modulating mediator release and cytokine secretion. In particular, peptidoglycan (PGN), a component found predominately within the cell wall of gram positive bacteria, is reported to interact with TLR2/6 heterodimers. This ligand directly induced IL-4 and IL-13 from basophils, even though the levels secreted were 10-fold less than those typically induced with IgE/FceRI cross-linking (Bieneman et al., 2005). PGN alone did not induce detectable levels of histamine and LTC4 above those measured in control cultures. However, this TLR2 ligand significantly augmented both mediator release and cytokine secretion induced upon IgE-dependent stimulation, as well as the IL-13 produced following IL-3-dependent activation. Pam3Cys, a synthetic lipopetide reported to have greater specificity for TLR2/1 heterodimers was likewise shown to augment the same responses in basophils. Both TLR2-specific compounds induced in basophils intracellular events (e.g., nuclear localization of NFkB) that are consistent with TLR signaling. Despite expressing relatively high levels of mRNA and protein for TLR4, there are currently no functional responses observed in basophils when using ligands specific for this receptor (Bieneman et al., 2005; Sabroe et al., 2002). For example, many of the same functional responses observed when using TLR2-specific agonists were not seen when treating basophils with detoxified lipopolysacharride (LPS)–the traditional TLR4 agonist that is a constituent of gram negative bacteria. At this time, the most logical explanation for this unresponsiveness focuses on findings that basophils lack expression of CD14—an important coreceptor necessary for capturing LPS in order for it to interact with MD2/TLR4 complexes in the cell membrane. While specific pathological conditions or disease states might provoke CD14 expression on basophils that could then render these cells responsive to LPS, this possibility remains to be determined. Not all of the receptors identified on basophils that are associated with innate immunity play a role in augmenting responses from these cells. In fact, many agonists associated with innate immunity actually promote Th1-like responses and have provided some rationale for exploiting the innate immune system in counter-regulating allergic inflammation and disease. In a study by de Paulis et al., specific gp41 peptides of the HIV-1 envelope protein, while capable of activating basophil migration were additionally shown to inhibit IL-13 secretion by these cells (de Paulis et al., 2002). The interaction of these peptides with formyl peptide
Basophils: Beyond Effector Cells of Allergic Inflammation
145
receptors expressed by the basophil was reported as the mechanism responsible for suppressing cytokine secretion. Others have shown that the LIR that are expressed on basophils seemingly possess both inhibitory and stimulatory activity (Sloane et al., 2004). For example, antibodies targeting LIR3 inhibited IgE-dependent activation of basophils, whereas antibodies targeting LIR7 actually stimulated mediator release and cytokine secretion. However, the natural ligands that bind these LIR receptors are yet to be determined. TLR9, which has a strong link to pro-Th1 activity in pDCs, is also reportedly expressed in human basophils (Komiya et al., 2006). While the exact functional role(s) for this receptor on basophils continues to be under investigation, preliminary data indicate that it mediates inhibitory activity toward the capacity of these cells to secrete IL-4/IL-13 ( J. T. Schroeder, unpublished observations). Naturally, a discovery of TLR9-dependent responses would imply that basophils play a role in viral and bacterial infections. To date, there is no other information in the literature to suggest that basophils express TLR important in recognizing other viral products (e.g., TLR7, -8, or -3), but this is one area requiring further investigation.
5.3. Delayed-type hypersensitivity Although basophils are primarily recognized for their role in immediate hypersensitivity reactions, they have also been long implicated in specific delayed-type reactions. In particular were the Jones–Mote reactions, which later fell under the heading of cutaneous basophilic hypersensitivity (CBH) because of their commonality to reactions induced in guinea pigs (Richerson et al., 1969). Like the LPRs resulting from allergen exposure, the lesion sites in human CBH models also show a selective infiltration of basophils along with eosinophils and mononuclear cells. However, they differ from LPRs in that their time course is considerably longer requiring 3–6 days for histological changes to occur. In fact, early studies using animal models (i.e., guinea pig) clearly showed a dependency on T cells, which partly led to these reactions being classified as a form of delayed-type hypersensitivity (DTH). The agents/compounds that commonly induce CBH reactions also differ from the common allergens associated with immediate hypersensitivity reaction. Specific models conducted in humans over 30 years ago employed patch testing with either rhus toxoid (Dvorak et al., 1970) (the active agent in poison ivy) or with dinitrochlorobenzene (Dvorak and Mihm, 1972). Histological examination of lesion sites showed basophils in the dermis, with percentages estimated at nearly 20% of the total leukocyte infiltrate. Changes in the dermal microvasculature have suggested basophil mediator release in these human CBH reactions, even though specific mediators have never
146
John T. Schroeder
been definitively identified. Detailed investigations using electron microscopy to analyze the basophils infiltrating CBH reactions did, however, lead Dvorak and colleagues to propose evidence for ‘‘piecemeal degranulation’’ as a mechanism for slow but deliberate release of mediators from these cells (Dvorak, 2005). There have been few studies to date that extend on the above findings in CBH reactions. One recent study has shown that injection of MCP-1 into the skin of allergic subjects induced a late rather than acute inflammatory response that occurred 48 h later and included a selective infiltration of basophils (Gaga et al., 2008). Similarly, the basophils infiltrating delayed-type inflammatory responses in mice were recently shown to be dependent on CRTH2 (Satoh et al., 2006). Whether these molecules play a role in CBH reactions is unknown at this time, but the possibility seemingly exists.
6. BASOPHILS IN MOUSE MODELS OF TH2 INFLAMMATION It goes without saying that animal models have provided an insurmountable amount of information toward our current understanding of immune cell function, immunoregulation, and immunology as a whole. However, it is also valid to conclude that the criteria for defining a mammalian immune cell is ultimately determined by how closely it compares with the phenotype and function of its human counterpart. This is particularly true for the basophil since this leukocyte was originally defined in humans and that the bulk of what we know regarding its function has come almost completely from studies using human cells. Accordingly, there has been, and perhaps still remains, doubt as to whether this granulocyte even exists in mice. It is therefore appropriate to begin this section by briefly discussing some of the background that has led to the more recent work in mice regarding basophil function. The so-called ‘‘persisting’’ or P-cell first described in 1981 by Schrader et al. is perhaps the first identification of what is currently referred to as the mouse basophil (Schrader et al., 1981). This cell contained 0.1 pg of histamine or one-tenth the amount commonly stored in a human basophil. It could be grown from bone marrow precursors of mast celldeficient mice and, therefore, was unlikely to be a mast cell. However, Dvorak and colleagues are credited with identifying the mouse basophil with evidence first presented over 25 years ago. They had done so by defining ultra-structural features in a rare population (0.3%) of bone marrow cells that bore a resemblance to those seen in basophils from other mammalian sources, including humans (Dvorak and Sciuto, 2004;
Basophils: Beyond Effector Cells of Allergic Inflammation
147
Dvorak et al., 1982). Like most mammalian basophils, these cells were reported to have electron dense granules and the presence of a segmental nucleus, as opposed to a nonsegmental oval-shaped nucleus commonly seen in mast cells. However, these mouse granulocytes differed from human basophils in appearance by having far fewer granules of uneven size. Moreover, it was subsequently determined that these mouse basophils varied in histamine content, with values ranging from <1% to 50% of that (i.e., 1.2 pg/basophil) typically found in their human counterpart (Seder et al., 1991a). Using hematological stains (e.g., DiffQuick), many of these same characteristics have once again been reported for mouse basophils isolated in several recent studies (Min et al., 2004; Sokol et al., 2008; Voehringer et al., 2004). In particular, very few granules are found in mouse basophils and in some instances are not even detected. As a result, this discordance has prompted questions among some investigators as to whether these so-called ‘‘mouse basophils’’ are, indeed, basophils (Lee and McGarry, 2007). Nonetheless, recent studies have reported success in isolating this mouse basophil population by using flow cytometry and cell-sorting technology. In addition to staining for IL-4, this cell population has FSClo/SSClo scatter properties and an immunophenotype consistent with that of human basophils (i.e., FceRIþ, CD49b (DX-5)þ, CD69þ, Thy-1.2þ, 2B4þ, CD11bdull, CD117 (c-kit), CD24, CD19, CD80, CD14, CD23, Ly49c, CD122, CD11c, Gr-1, NK1.1, B220, CD3, gdTCR, abTCR, a4, and b4-integrin negative). Surprisingly, there is only one recent study that reports moderate levels of IL-3 receptor (CD123) expressed on mouse basophils (Mack et al., 2005). As noted above, this receptor is actually gaining popularity as a good marker for identifying human basophils (and pDCs), so its sparse use in identifying mouse basophils is somewhat perplexing. Nevertheless, cells sorted based on the FceRIþ, CD49bþ, CD117 phenotype alone produces a population bearing many of the same ultra-structural features originally described by Dvorak and colleagues. However, one could argue that it is the large quantities of IL-4 produced by these cells that best justify their basophil classification, since this capacity is shared with their human counterpart. While it is generally accepted that both human and mouse basophils produce large amounts of IL-4, there are clearly some inconsistencies between the two species (and within the mouse models thus far described) regarding the capacity to secrete other cytokines. As noted above, human basophils secrete IL-13 and, under certain conditions (e.g., IL-3 stimulation), can produce higher levels of this cytokine compared to IL-4. Reports have been more variable regarding IL-13 production by mouse basophils, with some detecting this cytokine whereas others have been unsuccessful in doing so (Min et al., 2004; Voehringer
148
John T. Schroeder
et al., 2006). In addition, mouse basophils seemingly secrete several other proinflammatory cytokines including TNF-a, IL-6, IL-2, and TSLP (thymic stromal lymphopoietin), which are not reportedly made by human basophils (Sokol et al., 2008). It has been known for some time that the frequency of mouse basophils in the spleen, blood, and lung increases upon infection with the helminth parasite, Nippostrongylus brasiliensis (Nb) (Seder et al., 1991b). In fact, infection with Nb has long been used as a model to investigate the mechanisms underlying Th2-type inflammation and it therefore shares some characteristics common with allergic inflammation. It has recently been suggested that the IL-4 secreted by mouse basophils during this infection, but not by T cells, plays an important role in the expulsion of this worm. It apparently does so by causing an accumulation of Th2 cells at the site of Nb infection in the lung, which then leads to worm expulsion (Voehringer et al., 2006). Thus, there is mounting evidence to support a long-held belief that basophils do indeed play a role in immunity to parasites. Until recently, however, there has been little interest among mouse immunologists to explore the biology of basophils beyond what has been achieved in vitro with human cells. As noted above, issues regarding accessibility as well as questions pertaining to whether these cells even exist in mice have long been valid claims for not pursuing such studies. Although, it is equally appropriate to suggest that the role of basophils in allergic disease has largely been viewed as redundant to that of mast cells, which is arguably another reason for this neglect. Whatever has been the situation, this indifference is clearly changing with results obtained from studies using recently developed IL-4 reporter mice, both the ‘‘4get’’ and ‘‘G4’’ strains. These rodent models have essentially allowed in vivo the tracking of cells making IL-4, which has consequently led to the identification a non-T, non-B cell population possessing basophil characteristics. The 4get mice were engineered by ‘‘knocking’’ in a reporter-targeting bicistronic construct consisting of a viral internal ribosomal entry sequence (IRES) element along with enhanced green fluorescent protein (eGFP) linked to the IL-4 gene (Mohrs et al., 2001). Therefore, they make GFP (which allows detection by flow cytometry) as well as produce IL-4. It has been suggested however that these mice reflect basal transcription with only the capacity of a cell to make IL-4 rather than actually secreting protein for this cytokine. In contrast, G4 mice have a cassette encoding eGFP that replaces the first exon of the gene encoding IL-4, thus ‘‘knocking it out’’ (Min et al., 2004). The appearance of GFPþ cells in G4 mice are thought to reflect those cells actually making IL-4. One of the more significant differences between the two stains of mice is evidence that eosinophils are also GFPþ in the 4get mice, particularly following
Basophils: Beyond Effector Cells of Allergic Inflammation
149
parasitic infection were their numbers were shown to increase some 1000-fold. In contrast, IL-4 production in G4 mice reportedly tracks best in non-T cells possessing a basophil phenotype (i.e., GFPþ, CD49bþ, FceRIþ, c-kit). As in the 4get mice, the numbers of these IL-4þ basophils in the G4 animals also increase following infection with Nb. Frequencies 10 days postinoculation approached nearly 15% in the blood, lung, and liver, with lesser numbers (3–5%) in the spleen. Importantly, cells positive for GFP/CD49b in the G4 mice (and 4get mice) are also present in the bone marrow (0.6%) and liver (1%) of naive mice. It has been concluded from this latter finding that normal basophils are already producing IL-4 and that the major affect of Nb infection is to increase their numbers and their accumulation in the tissue (Voehringer et al., 2004). With the basophil being identified as a major IL-4-producing cell, several studies have since addressed the biological significance of these findings by crossing the IL-4 reporter mice with various gene-specific deficient mice. In particular, it has been shown that IL-4 expression in basophils, and their migration into tissue following Nb infection, are both independent of STAT-6 and of IL-4/IL-13 (Voehringer et al., 2004). And, while basophil development and migration into tissue is seemingly dependent on T cells, their capacity to generate IL-4 is not. For example, Rag2/ mice have basophils capable of producing this cytokine and, when reconstituted with CD4 T cells, were shown to enable these IL-4-producing basophils to increase in number as well as to migrate into tissue following Nb infection (Min et al., 2004). Bearing in mind that Rag2/ deficient mice also lack immunoglobulins including IgE, then the expression of IL-4 in the basophils of these mice means that IgE/receptor cross-linking is not a requirement for their production of this cytokine. The observation that basophils do not require IgE/receptor crosslinking to produce IL-4 has opened the possibility that innate immune stimuli might trigger production of this cytokine that then functions in promoting Th2-type adaptive immune responses. One recent study has addressed this hypothesis by focusing on the role of proteases (Sokol et al., 2008). Intrinsic protease activity happens to be one thing in common between both the metazoan parasites and simple protein allergens (e.g., Der p 1 of dust mite) that commonly induce Th2 responses. Investigators showed that mice injected with the protease, papain, developed Th2-type responses, which included the induction of IgE. Most surprisingly, IL-4-producing basophils were found in the draining lymph nodes by day 3 after papain administration and had preceded the appearance of T cells, which occurred a day later, but were no longer present by day 5. While their frequency reached only 0.3% of the infiltrate, depleting mice of basophils prior to immunization not only prevented their migration to lymph nodes, but also suppressed the induction of Th2 responses. In vitro
150
John T. Schroeder
studies additionally showed that so-called bone marrow-derived basophils produced IL-4 and TSLP when directly stimulated with papain, suggesting that basophils are not only targeted by this enzyme in vivo, but that they also influence dendritic cell maturation. Overall, these findings are quite remarkable because they are the first to support the notion that basophils directly promote Th2 responses by affecting T cell and DC responses within secondary lymphoid tissue (Sokol et al., 2008). This is conceptually represented in Fig. 4.2 as well as how basophil IL-4/IL-13 secretion may very well amplify allergic inflammation in general by playing a role in IgE synthesis and eosinophil migration. A recent study in mice has also implicated basophils in mediating anaphylaxis, as determined by decreases in rectal temperature (Tsujimura et al., 2008). First, several studies had shown that systemic anaphylaxis could be induced in mice deficient for mast cells, FceRIa chain, or IgE. In contrast, mice deficient for both FceRI and stimulatory IgG receptors (i.e., FcRg-chain deficient mice) were protected, suggesting an IgG-dependent mechanism capable of inducing anaphylactic reactions. As noted above, Tsujimura, et al. have recently shown, using mast cell-deficient mice, that basophils release PAF upon binding IgG1 complexes, with this also correlating with anaphylaxis (Tsujimura et al., 2008). The investigators then provided evidence that these reactions were indeed mediated by basophils by showing that anaphylaxis could be prevented in animals that were first depleted of these cells. The so-called Ba103 antibody used in these experiments to deplete basophils targeted the CD200R3 expressed by these cells and apparently did not affect other cell types including monocytes and neutrophils. However, this so-called ‘‘nonclassical’’ IgG/basophil-dependent mechanism described in the mouse studies, while eloquent in its design, is currently difficult to relate to the human system where basophils seemingly lack expression of activating IgG receptors. Finally, additional studies in mice have shown that basophils play a significant role in a chronic allergic inflammatory reaction that, in contrast to classical DTH reactions, is IgE-mediated and not dependent on T cells or mast cells (Mukai et al., 2005). For instance, mast cell-deficient mice when passively sensitized with TNP-specific IgE, developed ear inflammation that began 2 days after injection but did not peak until day 4. Reconstituting FcRg-deficient mice with bone marrow-derived DX5þ cells restored the chronic inflammatory reactions seen in the ear, thus implicating a modulatory role for basophils in these reactions. While the underlying role for basophils in these lesions remains to be determined, they were also shown to produce IL-4, which likely contributed to the eosinophilic infiltrate that predominated.
Basophils: Beyond Effector Cells of Allergic Inflammation
151
FIGURE 4.2 A conceptual representation of how basophils might play a role in initiating, modulating, and amplifying the Th2 responses that are hallmark in allergic disease. Studies in mice show that basophils gain access to draining lymph nodes following immunization with specific proteases (e.g., like those associated with dust mite allergens). These proteases activate basophils independently of IgE causing them to produce TSLP and IL-4, which act on DCs and naı¨ve T cells (Th0), respectively. TSLP enhances OX40L expression whereas IL-4 promotes the differentiation of Th0 into Th2 effector cells—conditions that are critical for initiating Th2 responses. Importantly, the depletion of basophils prior to immunization prevents this Th2 development in mice. Other observations, both in humans and mice, indicate that basophils also play a role in amplifying Th2 responses perhaps within localized sites of allergic inflammation. First, there is reason to believe that mast cells play a role in this recruitment by secreting PGD2, which attracts CrTH2þ cells including basophils. Basophils sensitized with specific IgE encounter allergen thus stimulating mediator release and cytokine secretion. The IL-25 (IL-17E) produced expands the numbers of CrTH2þ memory Th2 cells. By producing IL-4/IL-13, basophils can support the synthesis of IgE but also facilitate the transendothelial migation of eosinophils by upregulating VCAM-1 expression. Finally, these proposed pathways for initiation and amplification of Th2 responses interact with one another and in concert with positive and negative signals from innate immunity.
7. CONCLUDING REMARKS The role of the blood basophil in the mechanisms underlying allergic disease has been for many years overshadowed by that of the mast cell, its tissue counterpart. In humans, basophils account for less than 1% of
152
John T. Schroeder
the circulating white blood cells and have thus been viewed as redundant to mast cells by doing little other than secreting pro-inflammatory mediators, such as histamine and LTC4. Only during the last 15 years has there been a renewed appreciation for the basophil—this coming mostly from evidence that these cells secrete in addition to inflammatory mediators key proallergic cytokines, namely IL-4 and IL-13. There is now sound evidence that basophils selectively infiltrate allergic lesion sites, whereby secreting these cytokines not only contribute to the overall inflammatory response but may very well modulate its course. Basophils also express receptors specific for microbial products and or cytokines that are best known for having a role in innate immunity. Some of these receptors appear to have the capacity to function either positively or negatively towards influencing basophil involvement in allergic inflammation. Finally, the development of IL-4 reporter mice has made it possible to track IL-4-producing cells in vivo and in doing so has revealed a basophillike cell as a major source of this cytokine. More novel evidence has additionally shown that mouse basophils migrate to secondary lymphoid tissue and are responsible in driving Th2 responses by potentially modulating CD4 and dendritic cell function. Assuming these latter findings are confirmed in humans then the role of the basophil in allergic disease takes on a whole new meaning.
REFERENCES Akagi, K., and Townley, R. G. (1989). Spontaneous histamine release and histamine content in normal subjects and subjects with asthma. J. Allergy Clin. Immunol. 83, 742. Austen, K. F. (2007). Additional functions for the cysteinyl leukotrienes recognized through studies of inflammatory processes in null strains. Prostaglandins Other Lipid. Mediat. 83, 182. Bieneman, A. P., Chichester, K. L., Chen, Y. H., and Schroeder, J. T. (2005). Toll-like receptor 2 ligands activate human basophils for both IgE-dependent and IgE-independent secretion. J. Allergy Clin. Immunol. 115, 295. Bochner, B. S., and Schleimer, R. P. (2001). Mast cells, basophils, and eosinophils: Distinct but overlapping pathways for recruitment. Immunol. Rev. 179, 5. Bochner, B. S., Klunk, D. A., Sterbinsky, S. A., Coffman, R. L., and Schleimer, R. P. (1995). IL-13 selectively induces vascular cell adhesion molecule-1 expression in human endothelial cells. J. Immunol. 154, 799. Bradding, P., Feather, I. H., Howarth, P. H., Mueller, R., Roberts, J. A., Britten, K., Bews, J. P., Hunt, T. C., Okayama, Y., Heusser, C. H., Bullock, G. R., Church, M. K., et al. (1992). Interleukin 4 is localized to and released by human mast cells. J. Exp. Med. 176, 1381. Brightling, C. E., Symon, F. A., Holgate, S. T., Wardlaw, A. J., Pavord, I. D., and Bradding, P. (2003). Interleukin-4 and -13 expression is co-localized to mast cells within the airway smooth muscle in asthma. Clin. Exp. Allergy 33, 1711. Brunner, T., Heusser, C. H., and Dahinden, C. A. (1993). Human peripheral blood basophils primed by interleukin 3 (IL-3) produce IL-4 in response to immunoglobulin E receptor stimulation. J. Exp. Med. 177, 605.
Basophils: Beyond Effector Cells of Allergic Inflammation
153
Buhring, H. J., Seiffert, M., Giesert, C., Marxer, A., Kanz, L., Valent, P., and Sano, K. (2001). The basophil activation marker defined by antibody 97A6 is identical to the ectonucleotide pyrophosphatase/phosphodiesterase 3. Blood 97, 3303. Burgi, B., Otten, U. H., Ochensberger, B., Rihs, S., Heese, K., Ehrhard, P. B., Ibanez, C. F., and Dahinden, C. A. (1996). Basophil priming by neurotrophic factors. Activation through the trk receptor. J. Immunol. 157, 5582. Chen, Y. H., Bieneman, A. P., Creticos, P. S., Chichester, K. L., and Schroeder, J. T. (2003). IFN-alpha inhibits IL-3 priming of human basophil cytokine secretion but not leukotriene C4 and histamine release. J. Allergy Clin. Immunol. 112, 944. Dahinden, C. A., Krieger, M., Brunner, T., and Bischoff, S. C. (1993). Basophil activation by members of the chemokine superfamily. Adv. Exp. Med. Biol. 351, 99. de Paulis, A., Florio, G., Prevete, N., Triggiani, M., Fiorentino, I., Genovese, A., and Marone, G. (2002). HIV-1 envelope gp41 peptides promote migration of human Fc epsilon RI+ cells and inhibit IL-13 synthesis through interaction with formyl peptide receptors. J. Immunol. 169, 4559. Devouassoux, G., Foster, B., Scott, L. M., Metcalfe, D. D., and Prussin, C. (1999a). Frequency and characterization of antigen-specific IL-4- and IL-13- producing basophils and T cells in peripheral blood of healthy and asthmatic subjects. J. Allergy Clin. Immunol. 104, 811. Devouassoux, G., Metcalfe, D. D., and Prussin, C. (1999b). Eotaxin potentiates antigendependent basophil IL-4 production. J. Immunol. 163, 2877. de Weck, A. L., Sanz, M. L., Gamboa, P. M., Aberer, W., Bienvenu, J., Blanca, M., Demoly, P., Ebo, D. G., Mayorga, L., Monneret, G., and Sainte-Laudy, J. (2008). Diagnostic tests based on human basophils: More potentials and perspectives than pitfalls. Int. Arch. Allergy Immunol. 146, 177. Ducrest, S., Meier, F., Tschopp, C., Pavlovic, R., and Dahinden, C. A. (2005). Flow cytometric analysis of basophil counts in human blood and inaccuracy of hematology analyzers. Allergy 60, 1446. Dvorak, A. M. (2005). Piecemeal degranulation of basophils and mast cells is effected by vesicular transport of stored secretory granule contents. Chem. Immunol. Allergy 85, 135. Dvorak, H. F., and Mihm, M. C., Jr. (1972). Basophilic leukocytes in allergic contact dermatitis. J. Exp. Med. 135, 235. Dvorak, A. M., and Sciuto, T. E. (2004). Images in Allergy and Immunology. Mouse spleen basophils. Int. Arch. Allergy Immunol. 134, 332. Dvorak, H. F., Dvorak, A. M., Simpson, B. A., Richerson, H. B., Leskowitz, S., and Karnovsky, M. J. (1970). Cutaneous basophil hypersensitivity. II. A light and electron microscopic description. J. Exp. Med. 132, 558. Dvorak, A. M., Nabel, G., Pyne, K., Cantor, H., Dvorak, H. F., and Galli, S. J. (1982). Ultrastructural identification of the mouse basophil. Blood 59, 1279. Dvorak, A. M., Monahan-Earley, R. A., Estrella, P., Kissell, S., and Donahue, R. E. (1989). Ultrastructure of monkey peripheral blood basophils stimulated to develop in vivo by recombinant human interleukin 3. Lab. Invest. 61, 677. Dzionek, A., Fuchs, A., Schmidt, P., Cremer, S., Zysk, M., Miltenyi, S., Buck, D. W., and Schmitz, J. (2000). BDCA-2, BDCA-3, and BDCA-4: Three markers for distinct subsets of dendritic cells in human peripheral blood. J. Immunol. 165, 6037. Eglite, S., Pluss, K., and Dahinden, C. A. (2000). Requirements for C5a receptor-mediated IL-4 and IL-13 production and leukotriene C4 generation in human basophils. J. Immunol. 165, 2183. Ehrlich, P. (1877). Beitrage zur kenntnis der anilinfarbungen und ihrer verwendung in der mikroskopischen technik. Arch. Mikrosk Anat. 13, 263. Ehrlich, P. (1879). Beitrage zur kenntnis der granuliertan bindegewebszellen und der eosinophilen leukocyten. Arch. Anat. Physiol. 3, 166.
154
John T. Schroeder
Esche, C., Stellato, C., and Beck, L. A. (2005). Chemokines: Key players in innate and adaptive immunity. J. Invest. Dermatol. 125, 615. Escura, R. B., Schroeder, J. T., and MacDonald, S. M. (1998). HrHRF: Function and regulation. Drug News Perspect. 11, 223. Fernandes, R., Kusel, M., Cyr, M., Sehmi, R., Holt, K., Holt, B., Kebadze, T., Johnston, S. L., Sly, P., Denburg, J. A., and Holt, P. (2008). Cord blood hemopoietic progenitor profiles predict acute respiratory symptoms in infancy. Pediatr. Allergy Immunol. 19, 239. Foster, B., Schwartz, L. B., Devouassoux, G., Metcalfe, D. D., and Prussin, C. (2002). Characterization of mast-cell tryptase-expressing peripheral blood cells as basophils. J. Allergy Clin. Immunol. 109, 287. Gaga, M., Ong, Y. E., Benyahia, F., Aizen, M., Barkans, J., and Kay, A. B. (2008). Skin reactivity and local cell recruitment in human atopic and nonatopic subjects by CCL2/ MCP-1 and CCL3/MIP-1alpha. Allergy 63, 703. Galli, S. J., and Franco, C. B. (2008). Basophils are back! Immunity 28, 495. Gauchat, J. F., Henchoz, S., Mazzei, G., Aubry, J. P., Brunner, T., Blasey, H., Life, P., Talabot, D., Flores-Romo, L., Thompson, J., Kishi, K., Butterfield, J., et al. (1993). Induction of human IgE synthesis in B cells by mast cells and basophils. Nature 365, 340. Gehlhar, K., Bilitewski, C., Reinitz-Rademacher, K., Rohde, G., and Bufe, A. (2006). Impaired virus-induced interferon-alpha2 release in adult asthmatic patients. Clin. Exp. Allergy 36, 331. Gibbs, B. F., Haas, H., Falcone, F. H., Albrecht, C., Vollrath, I. B., Noll, T., Wolff, H. H., and Amon, U. (1996). Purified human peripheral blood basophils release interleukin-13 and preformed interleukin-4 following immunological activation. Eur. J. Immunol. 26, 2493. Gibbs, B. F., Arm, J. P., Gibson, K., Lee, T. H., and Pearce, F. L. (1997). Human lung mast cells release small amounts of interleukin-4 and tumour necrosis factor-alpha in response to stimulation by anti-IgE and stem cell factor. Eur. J. Pharmacol. 327, 73. Gilmartin, L., Tarleton, C. A., Schuyler, M., Wilson, B. S., and Oliver, J. M. (2008). A comparison of inflammatory mediators released by basophils of asthmatic and control subjects in response to high-affinity IgE receptor aggregation. Int. Arch. Allergy Immunol. 145, 182. Gober, L. M., Eckman, J. A., Sterba, P. M., Vasagar, K., Schroeder, J. T., Golden, D. B., and Saini, S. S. (2007). Expression of activation markers on basophils in a controlled model of anaphylaxis. J. Allergy Clin. Immunol. 119, 1181. Golden, D. B. (2007). What is anaphylaxis? Curr. Opin. Allergy Clin. Immunol. 7, 331. Goschnick, M. W., and Jackson, D. E. (2007). Tetraspanins-structural and signalling scaffolds that regulate platelet function. Mini. Rev. Med. Chem. 7, 1248. Gould, H. J., and Sutton, B. J. (2008). IgE in allergy and asthma today. Nat. Rev. Immunol. 8, 205. Haas, H., Falcone, F. H., Schramm, G., Haisch, K., Gibbs, B. F., Klaucke, J., Poppelmann, M., Becker, W. M., Gabius, H. J., and Schlaak, M. (1999). Dietary lectins can induce in vitro release of IL-4 and IL-13 from human basophils. Eur. J. Immunol. 29, 918. Hamilton, R. G. (2004). Diagnostic methods for insect sting allergy. Curr. Opin. Allergy Clin. Immunol. 4, 297. Hirai, H., Tanaka, K., Yoshie, O., Ogawa, K., Kenmotsu, K., Takamori, Y., Ichimasa, M., Sugamura, K., Nakamura, M., Takano, S., and Nagata, K. (2001). Prostaglandin D2 selectively induces chemotaxis in T helper type 2 cells, eosinophils, and basophils via seven-transmembrane receptor CRTH2. J. Exp. Med. 193, 255. Hober, D., Benyoucef, S., Chehadeh, W., Chieux, V., De La Tribonniere, X., Mouton, Y., Bocket, L., and Wattre, P. (1998). Production of interleukin-4, interferon (IFN)-gamma and IFN-alpha in human immunodeficiency virus-1 infection: An imbalance of type 1 and type 2 cytokines may reduce the synthesis of IFN-alpha. Scand J. Immunol. 48, 436.
Basophils: Beyond Effector Cells of Allergic Inflammation
155
Hock, M. B., and Brown, M. A. (2003). Nuclear factor of activated T cells 2 transactivation in mast cells: A novel isoform-specific transactivation domain confers unique FcepsilonRI responsiveness. J. Biol. Chem. 278, 26695. Holowka, D., Sil, D., Torigoe, C., and Baird, B. (2007). Insights into immunoglobulin E receptor signaling from structurally defined ligands. Immunol. Rev. 217, 269. Irani, A. M., Huang, C., Xia, H. Z., Kepley, C., Nafie, A., Fouda, E. D., Craig, S., Zweiman, B., and Schwartz, L. B. (1998). Immunohistochemical detection of human basophils in latephase skin reactions. J. Allergy Clin. Immunol. 101, 354. Ishizaka, T., De Bernardo, R., Tomioka, H., Lichtenstein, L. M., and Ishizaka, K. (1972). Identification of basophil granulocytes as a site of allergic histamine release. J. Immunol. 108, 1000. Jinquan, T., Jacobi, H. H., Jing, C., Reimert, C. M., Quan, S., Dissing, S., Poulsen, L. K., and Skov, P. S. (2000). Chemokine stromal cell-derived factor 1alpha activates basophils by means of CXCR4. J. Allergy Clin. Immunol. 106, 313. Kawaguchi, M., Onuchic, L. F., Li, X. D., Essayan, D. M., Schroeder, J., Xiao, H. Q., Liu, M. C., Krishnaswamy, G., Germino, G., and Huang, S. K. (2001). Identification of a novel cytokine, ML-1, and its expression in subjects with asthma. J. Immunol. 167, 4430. Kennedy Norton, S., Barnstein, B., Brenzovich, J., Bailey, D. P., Kashyap, M., Speiran, K., Ford, J., Conrad, D., Watowich, S., Moralle, M. R., Kepley, C. L., Murray, P. J., et al. (2008). IL-10 suppresses mast cell IgE receptor expression and signaling in vitro and in vivo. J. Immunol. 180, 2848. Kepley, C. L. (2005). Antigen-induced reduction in mast cell and basophil functional responses due to reduced Syk protein levels. Int. Arch. Allergy Immunol. 138, 29. Kepley, C. L., Pfeiffer, J. R., Schwartz, L. B., Wilson, B. S., and Oliver, J. M. (1998). The identification and characterization of umbilical cord blood-derived human basophils. J. Leukoc. Biol. 64, 474. Kepley, C. L., Youssef, L., Andrews, R. P., Wilson, B. S., and Oliver, J. M. (1999). Syk deficiency in nonreleaser basophils. J. Allergy Clin. Immunol. 104, 279. Kepley, C. L., Cambier, J. C., Morel, P. A., Lujan, D., Ortega, E., Wilson, B. S., and Oliver, J. M. (2000). Negative regulation of FcepsilonRI signaling by FcgammaRII costimulation in human blood basophils. J. Allergy Clin. Immunol. 106, 337. Kepley, C. L., McFeeley, P. J., Oliver, J. M., and Lipscomb, M. F. (2001). Immunohistochemical detection of human basophils in postmortem cases of fatal asthma. Am. J. Respir Crit. Care Med. 164, 1053. Kepley, C. L., Zhang, K., Zhu, D., and Saxon, A. (2003). FcepsilonRI-FcgammaRII coaggregation inhibits IL-16 production from human Langerhans-like dendritic cells. Clin. Immunol. 108, 89. Kepley, C. L., Taghavi, S., Mackay, G., Zhu, D., Morel, P. A., Zhang, K., Ryan, J. J., Satin, L. S., Zhang, M., Pandolfi, P. P., and Saxon, A. (2004). Co-aggregation of FcgammaRII with FcepsilonRI on human mast cells inhibits antigen-induced secretion and involves SHIPGrb2-Dok complexes. J. Biol. Chem. 279, 35139. Kirshenbaum, A. S., Goff, J. P., Kessler, S. W., Mican, J. M., Zsebo, K. M., and Metcalfe, D. D. (1992). Effect of IL-3 and stem cell factor on the appearance of human basophils and mast cells from CD34+ pluripotent progenitor cells. J. Immunol. 148, 772. Kleine-Tebbe, J., Erdmann, S., Knol, E. F., MacGlashan, D. W., Jr., Poulsen, L. K., and Gibbs, B. F. (2006). Diagnostic tests based on human basophils: potentials, pitfalls and perspectives. Int. Arch. Allergy Immunol. 141, 79. KleinJan, A., McEuen, A. R., Dijkstra, M. D., Buckley, M. G., Walls, A. F., and Fokkens, W. J. (2000). Basophil and eosinophil accumulation and mast cell degranulation in the nasal mucosa of patients with hay fever after local allergen provocation. J. Allergy Clin. Immunol. 106, 677.
156
John T. Schroeder
Komiya, A., Nagase, H., Okugawa, S., Ota, Y., Suzukawa, M., Kawakami, A., Sekiya, T., Matsushima, K., Ohta, K., Hirai, K., Yamamoto, K., and Yamaguchi, M. (2006). Expression and function of toll-like receptors in human basophils. Int. Arch. Allergy Immunol. 140 Suppl 1, 23. Kraft, S., Rana, S., Jouvin, M. H., and Kinet, J. P. (2004). The role of the FcepsilonRI beta-chain in allergic diseases. Int. Arch. Allergy Immunol. 135, 62. Krieger, M., Brunner, T., Bischoff, S. C., von Tscharner, V., Walz, A., Moser, B., Baggiolini, M., and Dahinden, C. A. (1992). Activation of human basophils through the IL-8 receptor. J. Immunol. 149, 2662. Langdon, J. M., Schroeder, J. T., Vonakis, B. M., Bieneman, A. P., Chichester, K., and Macdonald, S. M. (2008). Histamine-releasing factor/translationally controlled tumor protein (HRF/TCTP)-induced histamine release is enhanced with SHIP-1 knockdown in cultured human mast cell and basophil models. J. Leukoc. Biol. Lee, J. J., and McGarry, M. P. (2007). When is a mouse basophil not a basophil. Blood 109, 859. Lichtenstein, L. M., and Bochner, B. S. (1991). The role of basophils in asthma. Ann. N Y Acad. Sci. 629, 48. Lie, W. J., Homburg, C. H., Kuijpers, T. W., Knol, E. F., Mul, F. P., Roos, D., and Tool, A. T. (2003). Regulation and kinetics of platelet-activating factor and leukotriene C4 synthesis by activated human basophils. Clin. Exp. Allergy 33, 1125. Li, H., Sim, T. C., and Alam, R. (1996). IL-13 released by and localized in human basophils. J. Immunol. 156, 4833. Liu, Y. J. (2005). IPC: Professional type 1 interferon-producing cells and plasmacytoid dendritic cell precursors. Annu. Rev. Immunol. 23, 275. Macfarlane, A. J., Kon, O. M., Smith, S. J., Zeibecoglou, K., Khan, L. N., Barata, L. T., McEuen, A. R., Buckley, M. G., Walls, A. F., Meng, Q., Humbert, M., Barnes, N. C., et al. (2000). Basophils, eosinophils, and mast cells in atopic and nonatopic asthma and in latephase allergic reactions in the lung and skin. J. Allergy Clin. Immunol. 105, 99. MacGlashan, D., Jr. (2003). Histamine: A mediator of inflammation. J. Allergy Clin. Immunol. 112, S53. MacGlashan, D., Jr. (2005). IgE and Fc{epsilon}RI regulation. Ann. N Y Acad. Sci. 1050, 73. MacGlashan, D. W., Jr. (1993). Releasability of human basophils: Cellular sensitivity and maximal histamine release are independent variables. J. Allergy Clin. Immunol. 91, 605. MacGlashan, D. W., Jr. (2007). Relationship between spleen tyrosine kinase and phosphatidylinositol 50 phosphatase expression and secretion from human basophils in the general population. J. Allergy Clin. Immunol. 119, 626. MacGlashan, D., Jr., and Guo, C. B. (1991). Oscillations in free cytosolic calcium during IgEmediated stimulation distinguish human basophils from human mast cells. J. Immunol. 147, 2259. MacGlashan, D., and Miura, K. (2004). Loss of syk kinase during IgE-mediated stimulation of human basophils. J. Allergy Clin. Immunol. 114, 1317. MacGlashan, D., Jr., and Schroeder, J. T. (2000). Functional consequences of FcepsilonRIalpha up-regulation by IgE in human basophils. J. Leukoc. Biol. 68, 479. MacGlashan, D. W., Jr., Schleimer, R. P., Peters, S. P., Schulman, E. S., Adams, G. K., Sobotka, A. K., Newball, H. H., and Lichtenstein, L. M. (1983). Comparative studies of human basophils and mast cells. Fed. Proc. 42, 2504. MacGlashan, D., Jr., White, J. M., Huang, S. K., Ono, S. J., Schroeder, J. T., and Lichtenstein, L. M. (1994). Secretion of IL-4 from human basophils. The relationship between IL-4 mRNA and protein in resting and stimulated basophils. J. Immunol. 152, 3006. MacGlashan, D. W., Jr., Bochner, B. S., Adelman, D. C., Jardieu, P. M., Togias, A., McKenzieWhite, J., Sterbinsky, S. A., Hamilton, R. G., and Lichtenstein, L. M. (1997).
Basophils: Beyond Effector Cells of Allergic Inflammation
157
Down-regulation of Fc(epsilon)RI expression on human basophils during in vivo treatment of atopic patients with anti-IgE antibody. J. Immunol. 158, 1438. MacGlashan, D. W., Jr., Ishmael, S., MacDonald, S. M., Langdon, J. M., Arm, J. P., and Sloane, D. E. (2008). Induced loss of Syk in human basophils by non-IgE-dependent stimuli. J. Immunol. 180, 4208. Mack, M., Schneider, M. A., Moll, C., Cihak, J., Bruhl, H., Ellwart, J. W., Hogarth, M. P., Stangassinger, M., and Schlondorff, D. (2005). Identification of antigen-capturing cells as basophils. J. Immunol. 174, 735. Marone, G., Spadaro, G., Patella, V., and Genovese, A. (1994). The clinical relevance of basophil releasability. J. Allergy Clin. Immunol. 94, 1293. Marone, G., Florio, G., Triggiani, M., Petraroli, A., and de Paulis, A. (2000). Mechanisms of IgE elevation in HIV-1 infection. Crit. Rev. Immunol. 20, 477. Marone, G., Rossi, F. W., Detoraki, A., Granata, F., Marone, G., Genovese, A., and Spadaro, G. (2007). Role of superallergens in allergic disorders. Chem. Immunol. Allergy 93, 195. Mazzoni, A., Leifer, C. A., Mullen, G. E., Kennedy, M. N., Klinman, D. M., and Segal, D. M. (2003). Cutting edge: Histamine inhibits IFN-alpha release from plasmacytoid dendritic cells. J. Immunol. 170, 2269. McEuen, A. R., Calafat, J., Compton, S. J., Easom, N. J., Buckley, M. G., Knol, E. F., and Walls, A. F. (2001). Mass, charge, and subcellular localization of a unique secretory product identified by the basophil-specific antibody BB1. J. Allergy Clin. Immunol. 107, 842. Min, B., Prout, M., Hu-Li, J., Zhu, J., Jankovic, D., Morgan, E. S., Urban, J. F., Jr., Dvorak, A. M., Finkelman, F. D., LeGros, G., and Paul, W. E. (2004). Basophils produce IL-4 and accumulate in tissues after infection with a Th2-inducing parasite. J. Exp. Med. 200, 507. Mitre, E., and Nutman, T. B. (2006). Basophils, basophilia and helminth infections. Chem. Immunol. Allergy 90, 141. Miura, K., Saini, S. S., Gauvreau, G., and MacGlashan, D. W., Jr. (2001). Differences in functional consequences and signal transduction induced by IL-3, IL-5, and nerve growth factor in human basophils. J. Immunol. 167, 2282. Mochizuki, A., McEuen, A. R., Buckley, M. G., and Walls, A. F. (2003). The release of basogranulin in response to IgE-dependent and IgE-independent stimuli: Validity of basogranulin measurement as an indicator of basophil activation. J. Allergy Clin. Immunol. 112, 102. Mohrs, M., Shinkai, K., Mohrs, K., and Locksley, R. M. (2001). Analysis of type 2 immunity in vivo with a bicistronic IL-4 reporter. Immunity 15, 303. Moser, R., Fehr, J., and Bruijnzeel, P. L. (1992). IL-4 controls the selective endothelium-driven transmigration of eosinophils from allergic individuals. J. Immunol. 149, 1432. Mukai, K., Matsuoka, K., Taya, C., Suzuki, H., Yokozeki, H., Nishioka, K., Hirokawa, K., Etori, M., Yamashita, M., Kubota, T., Minegishi, Y., Yonekawa, H., et al. (2005). Basophils play a critical role in the development of IgE-mediated chronic allergic inflammation independently of T cells and mast cells. Immunity 23, 191. Nagata, K., Hirai, H., Tanaka, K., Ogawa, K., Aso, T., Sugamura, K., Nakamura, M., and Takano, S. (1999). CRTH2, an orphan receptor of T-helper-2-cells, is expressed on basophils and eosinophils and responds to mast cell-derived factor(s). FEBS Lett. 459, 195. Nouri-Aria, K. T., Irani, A. M., Jacobson, M. R., O’Brien, F., Varga, E. M., Till, S. J., Durham, S. R., and Schwartz, L. B. (2001). Basophil recruitment and IL-4 production during human allergen-induced late asthma. J. Allergy Clin. Immunol. 108, 205. Ochensberger, B., Daepp, G. C., Rihs, S., and Dahinden, C. A. (1996). Human blood basophils produce interleukin-13 in response to IgE-receptor-dependent and -independent activation. Blood 88, 3028.
158
John T. Schroeder
Patella, V., Florio, G., Petraroli, A., and Marone, G. (2000). HIV-1 gp120 induces IL-4 and IL-13 release from human Fc epsilon RI+ cells through interaction with the VH3 region of IgE. J. Immunol. 164, 589. Pettipher, R. (2008). The roles of the prostaglandin D(2) receptors DP(1) and CRTH2 in promoting allergic responses. Br. J. Pharmacol. 1(153 Suppl), S191. Plager, D. A., Weiss, E. A., Kephart, G. M., Mocharla, R. M., Matsumoto, R., Checkel, J. L., Schwartz, L. B., Gleich, G. J., and Leiferman, K. M. (2006). Identification of basophils by a mAb directed against pro-major basic protein 1. J. Allergy Clin. Immunol. 117, 626. Plaut, M., Pierce, J. H., Watson, C. J., Hanley-Hyde, J., Nordan, R. P., and Paul, W. E. (1989). Mast cell lines produce lymphokines in response to cross-linkage of Fc epsilon RI or to calcium ionophores. Nature 339, 64. Redrup, A. C., Howard, B. P., MacGlashan, D. W., Jr., Kagey-Sobotka, A., Lichtenstein, L. M., and Schroeder, J. T. (1998). Differential regulation of IL-4 and IL-13 secretion by human basophils: their relationship to histamine release in mixed leukocyte cultures. J. Immunol. 160, 1957. Richerson, H. B., Dvorak, H. F., and Leskowitz, S. (1969). Cutaneous basophilic hypersensitivity: A new interpretation of the Jones-Mote reaction. J. Immunol. 103, 1431. Sabroe, I., Jones, E. C., Usher, L. R., Whyte, M. K., and Dower, S. K. (2002). Toll-like receptor (TLR)2 and TLR4 in human peripheral blood granulocytes: A critical role for monocytes in leukocyte lipopolysaccharide responses. J. Immunol. 168, 4701. Saini, S. S., MacGlashan, D. W., Jr., Sterbinsky, S. A., Togias, A., Adelman, D. C., Lichtenstein, L. M., and Bochner, B. S. (1999). Down-regulation of human basophil IgE and FC epsilon RI alpha surface densities and mediator release by anti-IgE-infusions is reversible in vitro and in vivo. J. Immunol. 162, 5624. Saini, S., Bloom, D. C., Bieneman, A., Vasagar, K., Togias, A., and Schroeder, J. (2004). Systemic effects of allergen exposure on blood basophil IL-13 secretion and FcepsilonRIbeta. J. Allergy Clin. Immunol. 114, 768. Sampson, H. A., Broadbent, K. R., and Bernhisel-Broadbent, J. (1989). Spontaneous release of histamine from basophils and histamine-releasing factor in patients with atopic dermatitis and food hypersensitivity. N Engl J. Med. 321, 228. Sarmiento, E. U., Espiritu, B. R., Gleich, G. J., and Thomas, L. L. (1995). IL-3, IL-5, and granulocyte-macrophage colony-stimulating factor potentiate basophil mediator release stimulated by eosinophil granule major basic protein. J. Immunol. 155, 2211. Satoh, T., Moroi, R., Aritake, K., Urade, Y., Kanai, Y., Sumi, K., Yokozeki, H., Hirai, H., Nagata, K., Hara, T., Utsuyama, M., Hirokawa, K., et al. (2006). Prostaglandin D2 plays an essential role in chronic allergic inflammation of the skin via CRTH2 receptor. J. Immunol. 177, 2621. Schleimer, R. P., MacGlashan, D. W., Jr., Schulman, E. S., Peters, S. P., Adams, G. K., 3rd, Adkinson, N. F., Jr., and Lichtenstein, L. M. (1983). Human mast cells and basophils– structure, function, pharmacology, and biochemistry. Clin. Rev. Allergy 1, 327. Schleimer, R. P., Sterbinsky, S. A., Kaiser, J., Bickel, C. A., Klunk, D. A., Tomioka, K., Newman, W., Luscinskas, F. W., Gimbrone, M. A., Jr., McIntyre, B. W., and Bochner, B. S. (1992). IL-4 induces adherence of human eosinophils and basophils but not neutrophils to endothelium. Association with expression of VCAM-1. J. Immunol. 148, 1086. Schmitz, J., Owyang, A., Oldham, E., Song, Y., Murphy, E., McClanahan, T. K., Zurawski, G., Moshrefi, M., Qin, J., Li, X., Gorman, D. M., Bazan, J. F., et al. (2005). IL-33, an interleukin1-like cytokine that signals via the IL-1 receptor-related protein ST2 and induces T helper type 2-associated cytokines. Immunity 23, 479. Schrader, J. W., Lewis, S. J., Clark-Lewis, I., and Culvenor, J. G. (1981). The persisting (P) cell: Histamine content, regulation by a T cell-derived factor, origin from a bone marrow precursor, and relationship to mast cells. Proc. Natl. Acad. Sci. USA 78, 323.
Basophils: Beyond Effector Cells of Allergic Inflammation
159
Schramm, G., Mohrs, K., Wodrich, M., Doenhoff, M. J., Pearce, E. J., Haas, H., and Mohrs, M. (2007). Cutting edge: IPSE/alpha-1, a glycoprotein from Schistosoma mansoni eggs, induces IgE-dependent, antigen-independent IL-4 production by murine basophils in vivo. J. Immunol. 178, 6023. Schroeder, J. T., MacGlashan, D. W., Jr., Kagey-Sobotka, A., White, J. M., and Lichtenstein, L. M. (1994a). Cytokine generation by human basophils. J. Allergy Clin. Immunol. 94, 1189. Schroeder, J. T., MacGlashan, D. W., Jr., Kagey-Sobotka, A., White, J. M., and Lichtenstein, L. M. (1994b). IgE-dependent IL-4 secretion by human basophils. The relationship between cytokine production and histamine release in mixed leukocyte cultures. J. Immunol. 153, 1808. Schroeder, J. T., Kagey-Sobotka, A., and Lichtenstein, L. M. (1995). The role of the basophil in allergic inflammation. Allergy 50, 463. Schroeder, J. T., Lichtenstein, L. M., Roche, E. M., Xiao, H., and Liu, M. C. (2001a). IL-4 production by human basophils found in the lung following segmental allergen challenge. J. Allergy Clin. Immunol. 107, 265. Schroeder, J. T., MacGlashan, D. W., Jr., and Lichtenstein, L. M. (2001b). Human basophils: Mediator release and cytokine production. Adv. Immunol. 77, 93. Schroeder, J. T., Miura, K., Kim, H. H., Sin, A., Cianferoni, A., and Casolaro, V. (2002). Selective expression of nuclear factor of activated T cells 2/c1 in human basophils: Evidence for involvement in IgE-mediated IL-4 generation. J. Allergy Clin. Immunol. 109, 507. Schroeder, J. T., Bieneman, A. P., and Chichester, K. L. (2007a). Induction of suppressor of cytokine signaling (SCOS)-1/3 by IFN-alpha in suppressing IL-3- but not IgE- dependent signaling in human basophils. J. Allergy Clin. Immunol. 119, S50. Schroeder, J. T., Bieneman, A. P., Chichester, K. L., Xiao, H., and Liu, M. C. (2007b). Evidence for interplay between circulating human basophils and plasmacytoid dendritic cells (pDC) following segmental allergen challenge in the lung Keystone Symposia on Molecular and Cellular Biology, Mast cells, Basophils and IgE: Host Defence and Disease Copper Mountain Resort, Copper Mountain, CO. Schroeder, J. T., Chichester, K. L., and Bieneman, A. P. (2008a). Human basophils secrete IL-3: Evidence of autocrine priming for phenotypic and functional responses in allergic disease. J. Immunol. (In Press). Schroeder, J. T., Chichester, K. L., and Bieneman, A. P. (2008b). Toll-like receptor 9 suppression in plasmacytoid dendritic cells after IgE-dependent activation is mediated by autocrine TNF-alpha. J. Allergy Clin. Immunol. 121, 486. Seder, R. A., Paul, W. E., Dvorak, A. M., Sharkis, S. J., Kagey-Sobotka, A., Niv, Y., Finkelman, F. D., Barbieri, S. A., Galli, S. J., and Plaut, M. (1991a). Mouse splenic and bone marrow cell populations that express high-affinity Fc epsilon receptors and produce interleukin 4 are highly enriched in basophils. Proc. Natl. Acad. Sci. USA 88, 2835. Seder, R. A., Plaut, M., Barbieri, S., Urban, J., Jr., Finkelman, F. D., and Paul, W. E. (1991b). Purified Fc epsilon R+ bone marrow and splenic non-B, non-T cells are highly enriched in the capacity to produce IL-4 in response to immobilized IgE, IgG2a, or ionomycin. J. Immunol. 147, 903. Sin, A. Z., Roche, E. M., Togias, A., Lichtenstein, L. M., and Schroeder, J. T. (2001). Nerve growth factor or IL-3 induces more IL-13 production from basophils of allergic subjects than from basophils of nonallergic subjects. J. Allergy Clin. Immunol. 108, 387. Siraganian, R. P., and Hook, W. A. (1976). Complement-induced histamine release from human basophils. II. Mechanism of the histamine release reaction. J. Immunol. 116, 639. Siraganian, R. P., and Hook, W. A. (1977). Mechanism of histamine release by formyl methionine-containing peptides. J. Immunol. 119, 2078.
160
John T. Schroeder
Sloane, D. E., Tedla, N., Awoniyi, M., Macglashan, D. W., Jr., Borges, L., Austen, K. F., and Arm, J. P. (2004). Leukocyte immunoglobulin-like receptors: Novel innate receptors for human basophil activation and inhibition. Blood 104, 2832. Smithgall, M. D., Comeau, M. R., Yoon, B. R., Kaufman, D., Armitage, R., and Smith, D. E. (2008). IL-33 amplifies both Th1- and Th2-type responses through its activity on human basophils, allergen-reactive Th2 cells, iNKT and NK cells. Int. Immunol. 20, 1019. Sokol, C. L., Barton, G. M., Farr, A. G., and Medzhitov, R. (2008). A mechanism for the initiation of allergen-induced T helper type 2 responses. Nat. Immunol. 9, 310. Spiegl, N., Didichenko, S., McCaffery, P., Langen, H., and Dahinden, C. A. (2008). Human basophils activated by mast cell-derived IL-3 express retinaldehyde dehydrogenase-II and produce the immunoregulatory mediator retinoic acid. Blood. Suzukawa, M., Komiya, A., Yoshimura-Uchiyama, C., Kawakami, A., Koketsu, R., Nagase, H., Iikura, M., Yamada, H., Ra, C., Ohta, K., Yamamoto, K., and Yamaguchi, M. (2007). IgE- and FcepsilonRI-mediated enhancement of surface CD69 expression in basophils: Role of low-level stimulation. Int. Arch. Allergy Immunol. 1(143 Suppl), 56. Takao, K., Tanimoto, Y., Fujii, M., Hamada, N., Yoshida, I., Ikeda, K., Imajo, K., Takahashi, K., Harada, M., and Tanimoto, M. (2003). In vitro expansion of human basophils by interleukin-3 from granulocyte colony-stimulating factor-mobilized peripheral blood stem cells. Clin. Exp. Allergy 33, 1561. Toba, K., Koike, T., Shibata, A., Hashimoto, S., Takahashi, M., Masuko, M., Azegami, T., Takahashi, H., and Aizawa, Y. (1999). Novel technique for the direct flow cytofluorometric analysis of human basophils in unseparated blood and bone marrow, and the characterization of phenotype and peroxidase of human basophils. Cytometry 35, 249. Togias, A. G. (2000). Systemic immunologic and inflammatory aspects of allergic rhinitis. J. Allergy Clin. Immunol. 106, S247. Tschopp, C. M., Spiegl, N., Didichenko, S., Lutmann, W., Julius, P., Virchow, J. C., Hack, C. E., and Dahinden, C. A. (2006). Granzyme B, a novel mediator of allergic inflammation: Its induction and release in blood basophils and human asthma. Blood 108, 2290. Tsujimura, Y., Obata, K., Mukai, K., Shindou, H., Yoshida, M., Nishikado, H., Kawano, Y., Minegishi, Y., Shimizu, T., and Karasuyama, H. (2008). Basophils play a pivotal role in immunoglobulin-G-mediated but not immunoglobulin-E-mediated systemic anaphylaxis. Immunity 28, 581. Tversky, J. R., Le, T. V., Bieneman, A. P., Chichester, K. L., Hamilton, R. G., and Schroeder, J. T. (2008). Human blood dendritic cells from allergic subjects have impaired capacity to produce interferon-alpha via Toll-like receptor 9. Clin. Exp. Allergy 38, 781. Uguccioni, M., Mackay, C. R., Ochensberger, B., Loetscher, P., Rhis, S., LaRosa, G. J., Rao, P., Ponath, P. D., Baggiolini, M., and Dahinden, C. A. (1997). High expression of the chemokine receptor CCR3 in human blood basophils. Role in activation by eotaxin, MCP-4, and other chemokines. J. Clin. Invest. 100, 1137. Vadas, P., Gold, M., Perelman, B., Liss, G. M., Lack, G., Blyth, T., Simons, F. E., Simons, K. J., Cass, D., and Yeung, J. (2008). Platelet-activating factor, PAF acetylhydrolase, and severe anaphylaxis. N Engl. J. Med. 358, 28. Van Scott, M. R., Mertsching, E., Negrou, E., Miles, J., Stallings, H. W., 3rd, Graff, C., and Kehry, M. R. (2008). Systemic administration of an Fcgamma-Fc(epsilon)-fusion protein in house dust mite sensitive nonhuman primates. Clin. Immunol. 128, 340. Vasagar, K., Vonakis, B. M., Gober, L. M., Viksman, A., Gibbons, S. P., Jr., and Saini, S. S. (2006). Evidence of in vivo basophil activation in chronic idiopathic urticaria. Clin. Exp. Allergy 36, 770. Voehringer, D., Shinkai, K., and Locksley, R. M. (2004). Type 2 immunity reflects orchestrated recruitment of cells committed to IL-4 production. Immunity 20, 267.
Basophils: Beyond Effector Cells of Allergic Inflammation
161
Voehringer, D., Reese, T. A., Huang, X., Shinkai, K., and Locksley, R. M. (2006). Type 2 immunity is controlled by IL-4/IL-13 expression in hematopoietic non-eosinophil cells of the innate immune system. J. Exp. Med. 203, 1435. Vonakis, B. M., Gibbons, S., Jr., Sora, R., Langdon, J. M., and MacDonald, S. M. (2001). Src homology 2 domain-containing inositol 50 phosphatase is negatively associated with histamine release to human recombinant histamine-releasing factor in human basophils. J. Allergy Clin. Immunol. 108, 822. Vonakis, B. M., MacGlashan, D. W., Jr., Vilarino, N., Langdon, J. M., Scott, R. S., and MacDonald, S. M. (2008). Distinct characteristics of signal transduction events by histamine-releasing factor/translationally controlled tumor protein (HRF/TCTP)-induced priming and activation of human basophils. Blood 111, 1789. Wang, Y. H., Angkasekwinai, P., Lu, N., Voo, K. S., Arima, K., Hanabuchi, S., Hippe, A., Corrigan, C. J., Dong, C., Homey, B., Yao, Z., Ying, S., et al. (2007). IL-25 augments type 2 immune responses by enhancing the expansion and functions of TSLP-DC-activated Th2 memory cells. J. Exp. Med. 204, 1837. Wilson, D. R., Irani, A. M., Walker, S. M., Jacobson, M. R., Mackay, I. S., Schwartz, L. B., and Durham, S. R. (2001). Grass pollen immunotherapy inhibits seasonal increases in basophils and eosinophils in the nasal epithelium. Clin. Exp. Allergy 31, 1705. Woolhiser, M. R., Brockow, K., and Metcalfe, D. D. (2004). Activation of human mast cells by aggregated IgG through FcgammaRI: Additive effects of C3a. Clin. Immunol. 110, 172. Wuhrer, M., Balog, C. I., Catalina, M. I., Jones, F. M., Schramm, G., Haas, H., Doenhoff, M. J., Dunne, D. W., Deelder, A. M., and Hokke, C. H. (2006). IPSE/alpha-1, a major secretory glycoprotein antigen from schistosome eggs, expresses the Lewis X motif on core-difucosylated N-glycans. FEBS J. 273, 2276. Yanagihara, Y., Kajiwara, K., Basaki, Y., Ikizawa, K., Ebisawa, M., Ra, C., Tachimoto, H., and Saito, H. (1998). Cultured basophils but not cultured mast cells induce human IgE synthesis in B cells after immunologic stimulation. Clin. Exp. Immunol. 111, 136. Ying, S., Kikuchi, Y., Meng, Q., Kay, A. B., and Kaplan, A. P. (2002). TH1/TH2 cytokines and inflammatory cells in skin biopsy specimens from patients with chronic idiopathic urticaria: Comparison with the allergen-induced late-phase cutaneous reaction. J. Allergy Clin. Immunol. 109, 694. Yoshimura, C., Yamaguchi, M., Iikura, M., Izumi, S., Kudo, K., Nagase, H., Ishii, A., Walls, A. F., Ra, C., Iwata, T., Igarashi, T., Yamamoto, K., et al. (2002). Activation markers of human basophils: CD69 expression is strongly and preferentially induced by IL-3. J. Allergy Clin. Immunol. 109, 817. Yoshimura, A., Naka, T., and Kubo, M. (2007). SOCS proteins, cytokine signalling and immune regulation. Nat. Rev. Immunol. 7, 454. Zhao, W., Kepley, C. L., Morel, P. A., Okumoto, L. M., Fukuoka, Y., and Schwartz, L. B. (2006). Fc gamma RIIa, not Fc gamma RIIb, is constitutively and functionally expressed on skin-derived human mast cells. J. Immunol. 177, 694. Zhu, D., Kepley, C. L., Zhang, M., Zhang, K., and Saxon, A. (2002). A novel human immunoglobulin Fc gamma Fc epsilon bifunctional fusion protein inhibits Fc epsilon RI-mediated degranulation. Nat. Med. 8, 518. Zhu, D., Kepley, C. L., Zhang, K., Terada, T., Yamada, T., and Saxon, A. (2005). A chimeric human-cat fusion protein blocks cat-induced allergy. Nat. Med. 11, 446.
CHAPTER
5 DNA Targets of AID: Evolutionary Link Between Antibody Somatic Hypermutation and Class Switch Recombination Jason A. Hackney,* Shahram Misaghi,* Kate Senger, Christopher Garris, Yonglian Sun, Maria N. Lorenzo, and Ali A. Zarrin1
Contents
1. Introduction 2. Experimental Systems to Study S Regions 3. S regions 4. V Regions 5. Sequence Comparison of V, S, and Non-Ig AID Targets 6. The Susceptibility of Non-S regions to Mediate CSR 7. AID Recruitment to Target Sequences 8. Role of DNA Double Strand Break (DSB) 9. Evolutionary Link between SHM and CSR References
Abstract
As part of the adaptive immune response, B cells alter their functional immunoglobulin (Ig) receptor genes through somatic hypermutation (SHM) and/or class switch recombination (CSR) via processes that are initiated by activation induced cytidine deaminase (AID). These genetic modifications are targeted at specific
164 167 168 174 174 179 180 180 182 183
Genentech, Immunology Discovery Group, South San Francisco, California 94080 * These two authors contributed equally 1 Corresponding author:
[email protected]; Tel.: +650-225-3402 Advances in Immunology, Volume 101 ISSN 0065-2776, DOI: 10.1016/S0065-2776(08)01005-5
#
2009 Elsevier Inc. All rights reserved.
163
164
Jason A. Hackney et al.
sequences known as Variable (V) and Switch (S) regions. Here, we analyze and review the properties and function of AID target sequences across species and compare them with non-Ig sequences, including known translocation hotspots. We describe properties of the S sequences, and discuss species and isotypic differences among S regions. Common properties of SHM and CSR target sequences suggest that evolution of S regions might involve the duplication and selection of SHM hotspots.
1. INTRODUCTION Ig Heavy (IgH) and Light chain (IgL, kappa or lambda) variable region exons are assembled from germline variable (V), diversity (D) and joining (J) gene segments by V(D)J recombination (Fig. 5.1A) (Dudley et al., 2005). This process creates a pool of low affinity IgMþ expressing B cells (Honjo, 2002; Wardemann and Nussenzweig, 2007). Upon activation, primarily as a result of antigenic stimulation and/or cytokines, mature B cells undergo class switch recombination (CSR) and/or somatic hypermutation (SHM) to further diversify the antibody repertoire. During SHM, point mutations are introduced at a high frequency (103–104 nucleotides per cell division) into the V regions of the rearranged IgH and IgL chains, allowing for the production and selection of high affinity antibodies via a process known as affinity maturation (Fig. 5.1B) (Neuberger, 2008). SHM Variable region (~2000 kb)
A
DH region (13)
VH region (~200)
JH region (4) Cm
VDJ recombination (RAG) VDJH
Constant region (~200 kb)
∗∗
Ig 1
Cg1
IgG1
FIGURE 5.1
(Continued)
Ce
Ca
Cg1
CSR ∗∗
Cg2a
AID
SHM
Im
Cg 2b
AID
d
IgM B
Cg 1
Cg3
Cm C
Cm Cd
Cg 3
Excised circle
DNA Targets of AID
165
C V
(n)
J
D
Cm
Shark
~90 kb V
D
J Sm
Frog
Cm
Cd
Sn
Cn
Sn
Cn
Sc
Cc
Sf
Cf
~80 kb V
D
J
Lizard
Sm
Cm
Cd
~200 kb V
D
J
Mouse
Sm
Cm
Cd
Sg3 Cg3
Sg1 Cg1 Sg 2b Cg 2b Sg 2a Cg 2a
Se
Ce
Sa
Ca
~350 kb V
D
J
Human
Sm
Cm Cd Sg 3 Cg 3 Sg 1 Cg 1 Sψ e ψ Ce Sa1 Ca1 Sg 2 Cg 2 Sg 4 Cg 4 Se
Ce
Sa2 Ca2
FIGURE 5.1 Genetic alterations of the mouse IgH locus. (A) Genomic organization of the variable region up to Cm in germ line configuration. V(D)J recombination assembles the functional coding variable region generating a large pool of low affinity IgM producing B cells. (B) Activation of B cells accompanied by induction of AID and germline transcription results in SHM, where point mutations are introduced into assembled V region (asterisks). AID-mediated DSBs (lightning symbol) in Sm and a downstream S region (e.g., Sg1) are joined to generate new isotypes (e.g., IgG1) transcript. In addition, an excised circular fragment is generated by joining the intervening sequence. (C) Genomic organization of shark, frog, lizard, mice, and human IgH loci to emphasize the rapid evolution of S regions and CH. The organization of the IgH locus has evolved toward complex gene duplication and modification of constant regions over time. V, D, J segments are denoted by purple, yellow and blue rectangles, respectively; S regions by ovals; CH by black rectangle; I promoters by arrows.
proceeds CSR evolutionarily and is detected in bony fish before amphibians, where CSR is first observed (Flajnik, 2002; Hsu et al., 2006). In CSR, the IgH constant region (CH), which is initially Cm encoding IgM, can be exchanged for downstream CH regions, yielding B cells that express IgG, IgE, or IgA (Maizels, 2005) (Fig. 5.1B). Recombination of the donor S region (Sm) upstream of Cm with a downstream acceptor S region is accompanied by deletion of the intervening sequences. In mice, CH genes are arranged in the order 50 -V(D)J-Cm-Cd-Cg3-Cg1-Cg2b-Cg2a-Ce-Ca-30 in a locus that spans about 200 kb (Fig. 5.1B). Individual CH genes are
166
Jason A. Hackney et al.
Replication
AID
AGTT TCAA
AGUT TCAA
AGNT TCNA
AG*T TCNA
AGUT TCGA
MSH2/6 Exol/Pol h
AGCT TCGA
A
Nick AGNT TCGA
AG T TCGT
UNG AG*T TCGA APE AG T TCGA
Nick AG T TCGA
B
C G AID
U G
BER MMR
DSB DSB-response pathway NHEJ CSR
Mutation
SHM
FIGURE 5.2 Model for generation of point mutation or DSB in SHM and CSR. (A) AIDmediated deaminated lesion (Uracil, U) in the context of AGCT in the nontemplate strand, is converted to a point mutation or DSB by MMR and/or BER pathways (Di Noia and Neuberger, 2007). The mismatch (dU:dG) lesion is recognized by base excision and/ or mismatch repair pathways or can simply get replicated. The replication/DNA synthesis of the initial DNA lesion yields a dC ! dT and dG ! dA transition (purine to purine; pyrimidine to pyrimidine) mutation. Alternatively, the DNA lesion can be subjected to uracil excision by UNG (generating an abasic site) or recognized as a mismatch by MSH2/MSH6. Replication/DNA synthesis over such an abasic site will result in both transition and transversion (purine to pyrimidine; pyrimidine to purine) mutations. SHM mutations are equally distributed between C:G or A:T basepairs. However, these
DNA Targets of AID
167
organized into germ-line transcription units that consist of an I (intronic) promoter, a noncoding I exon, the S region, and the CH coding exons (Manis et al., 2002) (Fig. 5.1 B). I promoters are normally silent in naı¨ve B cells (except for Im) and are induced upon B cell activation (Manis et al., 2002). Diversification of the constant region via CSR allows for versatile tissue distribution, Fc receptor binding and complement fixation enabling antibody molecules to exert various biological functions, while maintaining antigen-binding specificity (Honjo, 2002; Wardemann and Nussenzweig, 2007). Each species has acquired a different organization of the CH region during evolution (Stavnezer and Amemiya, 2004) (Fig. 5.1C, see below). Activation induced cytidine deaminase (AID) (Muramatsu et al., 2000; Revy et al., 2000) initiates SHM/CSR by deamination of deoxycytidine in the context of single stranded DNA (ssDNA) (Fig. 5.2) (Bransteitter et al., 2003; Chaudhuri et al., 2003; Sohail et al., 2003). Subsequently, this DNA lesion results in point mutation and/or double-strand breaks (DSBs) by employing mismatch repair (MMR) and base excision repair (BER) pathways (Fig. 5.2) (Petersen-Mahrt, 2002). Although seemingly distinct genetic processes, both CSR and SHM are related through their common dependence upon transcription and AID (Muramatsu et al., 2000). While SHM and CSR contribute to the functional diversity of the immune system, the improper targeting of this pathway may lead to production of auto-antibodies (Jiang et al., 2007, 2008; Meffre et al., 2001; Mietzner et al., 2008; Wardemann and Nussenzweig, 2007; Wardemann et al., 2003; Yurasov and Nussenzweig, 2007; Yurasov et al., 2005) or chromosomal translocations (Franco et al., 2006; Klein and Dalla-Favera, 2008; Ramiro et al., 2004, 2006).
2. EXPERIMENTAL SYSTEMS TO STUDY S REGIONS The repetitive composition of S regions, length and the complex transcriptional regulation of the CH locus have made it difficult to create a physiological experimental system to study CSR. Plasmid-based artificial substrates (Kenter et al., 2004; Kinoshita et al., 1998) have provided some mutations at A/T basepairs are still dependent on the initial deamination of the dC entry site (Unniraman and Schatz, 2007). It has been postulated that the DNA nick (strand break) at S regions is generated primarily by an apyrimidinic endonuclease (AP) at the initiating abasic site or through MMR-specific endonuclease (Rada, 2004). (B) Overview of AID-initiated events during SHM/CSR and the contribution of mutation and DSB (Rada, 2004). The low level of CSR in UNG/ mice is attributed to the MMR repair pathway suggesting that the major pathway of CSR requires UNG while MSH2 provides a backup mechanism.
168
Jason A. Hackney et al.
information on the mechanism of CSR. Bacterial artificial chromosomes (BACs) containing rearranged IgH loci has been utilized to study CSR (Dunnick et al., 2004); however, technical difficulties such as copy number, integration site, integrity of final substrate, as well as potential exclusion of unknown regulatory elements have to be considered. Recently, an in vivo experimental system has been established to allow replacement of the endogenous Sg1 region with test sequences (Shinkura et al., 2003; Zarrin et al., 2004, 2005, 2007, 2008) (Fig. 5.3). This has proved to be efficient and informative in analyzing the sequence requirements of CSR in the context of endogenous locus. In addition, given the highly repetitive structure of S regions and the difficulties cloning these regions, the feasibility of assembling S regions in vitro has been questionable until recently. Previous analyses of S regions lacked the ability to readily dissect the function of component motifs within S regions, as most studies use only endogenous S fragments. Recent studies show that a synthetic S region can be optimally generated and provide a similar degree of CSR compared to an endogenous S region (Zarrin et al., 2005, 2008). This model system might allow for the characterization of specific sequences and structures in S regions.
3. S REGIONS Proof for the essential role of S regions in CSR was established by deletion of S regions in mice. Targeted deletion of S regions not only greatly diminishes (Khamlichi et al., 2004; Luby et al., 2001) (Sm) or eliminates F1 ES cells Sg1a Sg1b
Modified ES cells
Gene targeting
ΔSg 1a Sg 1b -/-
G2 RA o t t n ct i cys Inje lasto B
RAG chimera
Mutant B cells
FIGURE 5.3 Gene targeting based experimental system to study S regions. In this system, a desired sequenced is replacing the endogenous Sg1 region in F1 ES cells. F1 ES cells bearing 129 (IgHa allele) and C57B6 (IgHb allele) alleles with sequence polymorphisms across the IgH locus allow for allele-specific identification of CSR and transcriptional events. Different test sequences were knocked in to replace endogenous Sg1a allele by gene targeting (Zarrin et al., 2004, 2005, 2007, 2008). ES cells bearing the modified IgH loci were injected into RAG2/ blastocysts yielding mature B cells in a relatively short time (2 months) (Chen et al., 1993).
DNA Targets of AID
169
(Shinkura et al., 2003) (Sg1) CSR to the associated CH gene, but random intronic sequences (Xeroderma Pigmentosum complementation group F, XPF) also fail to rescue the full activity of S regions (Zarrin et al., 2004). This suggests that S regions are specialized targets of CSR. Complete sequence analyses of S regions in different species have provided a better understanding of the properties of these regions (Table 5.1). S regions are large, repetitive intronic sequences that vary greatly in length (repetitive regions range from 2.0 to 6.5 kb in mice, Table 5.1). CSR breakpoints occur throughout S repetitive regions predominantly at the 50 end of Sm and 30 end of down stream S regions (Dunnick et al., 1993). Mammalian S regions are unusually G-rich on the nontemplate strand (Table 5.1) and are composed primarily of tandem repetitive units within which certain motifs—such as TGGGG, GGGGT, GGGCT, GAGCT, and AGCT predominate (Table 5.1). Among these motifs, AGCT is evolutionarily conserved in amphibians (Mussmann et al., 1997; Ohta and Flajnik, 2006; Zhao et al., 2006) and birds (Lundqvist et al., 2001). The G-rich motifs such as TGGGG seem to have been acquired only more recently in mammals, contributing to the unusual G-richness of the S regions implicated in formation of DNA–RNA hybrid (R-loops) thought to be a primary target of AID (Huang et al., 2007; Roy, 2007; Shinkura et al., 2003; Tian and Alt, 2000; Yu et al., 2003; Zarrin et al., 2004) in CSR. Sequence analysis has shown a marked increase in AGCT motif density from Xenopus to mouse accompanied by an increase in G-richness. This suggests that creation of a better target for AID has been favored over time, perhaps limiting the degree of mutagenic activity AID can elicit. The distribution pattern of individual repeats within each S region can be visualized using dotplot analysis (Fig. 5.4). This program compares sequences by aligning them, counting mismatches, then shifting the sequences one residue relative to one another and counting mismatches again, iteratively, for every possible position. This allows for detection of the repetitive elements within each S region. We analyzed the S regions from four relatively disparate species for which genomic sequence of S regions was available: mouse (strain 129SJ), frog (Xenopus tropicalis) (Ohta and Flajnik, 2006; Zhao et al., 2006), duck (Anas platyrhynchos) (Lundqvist et al., 2001, 2006), and lizard (Anolis carolinensis) (Broad Institute), for which genomic sequences of S regions were available (Fig. 5.4). The length, distribution, and density of the individual repetitive sequences vary among different S regions. Mouse Sm is exceptionally high in the degree of repetitiveness and enrichment of the AGCT motif. Mouse Sg1 is the largest S region and carries the greatest number of 49 bp repeats among 30 acceptor S regions (Mowatt, 1985; Szurek, 1985). On the other hand, mouse SE seems to be one of the shortest and the least repetitive S region. Perhaps the compact organization of the motifs provides a dense target sequence enhancing the probability of a recombination event.
TABLE 5.1
Sequence characteristics of S regions
S region
Repetitive region (kb)
A
G
C
T
Predominant motifs
Mouse Sm Mouse Sg3 Mouse Sgl Mouse Sg2b Mouse Sg2a Mouse Se Mouse Sa Duck Sm Duck Sa Duck Su Lizard Sm Lizard Su Frog Sm Frog Sx Frog Su Frog Sw Mouse random Intron (XPF)*
3.5 2.0 6.5 2.7 2.7 2.0 4.0 4.0 3.0 2.5 4.5 5.0 3.2 1.5 2.5 4.0 0
19 19 28 27 26 21 22 23 21 20 27 29 30 28 30 34 30
44 48 39 39 39 37 39 27 32 47 23 24 19 28 23 23 25
15 15 19 14 15 18 15 33 23 14 21 20 16 15 15 15 20
22 18 14 20 20 24 24 17 24 19 29 27 35 29 32 28 25
gggctgggctg; gagctgact tgggcagct tgggcagct tggggcagctggg ggcagtacagctgtggg gggctgggctg; gagctgagct gagctgagct; ggagaggaga ggaccagta agcacatctaggtgggcttccct agctgtggggcag agct agct aagct ctgtcaaggtaattttggaggcatagca cagtag ggagacag None
S regions were identified based on the dotplot and DGYW density analyses. For each S region, frequency of each nucleotide was determined in nontemplate strand. Repetitive elements were identified using the EMBOSS program etandem (http://emboss.sourceforge.net/apps/release/6.0/emboss/apps/etandem.html) or by visual inspection of aligned regions from the dotplot analysis.
Sm
Sg 3
2500
3000
2000 1500 1000
Sg 1
0 0
500
2000 1500
3000
6000 5000 4000 3000
1000 500
0
0 0
0 0 1000 2000 3000 4000 5000 6000 7000 8000
500 1000 1500 2000 2500 3000 3500
Sg 2a
Mouse Sg1
Se
Sa 3500
2500
Mouse Sa
Mouse Se
3000 2000 1500 1000
2500 2000 1500 1000
1000
500 500
0
0 0
1000
2000
3000
4000
0 0
500
1000
1500
2000
2500
3000
0
500 1000 1500 2000 2500 3000 3500 4000
Mouse Sg2a
Mouse Se
Mouse Sa
Duck Sm
Duck Sa
Duck Su
B 5000
3000
2500
4000
2000
Duck Sn
Duck Sa
Duck Sm
2500 3000
2000 1500
1000
2000
3000
Duck Sm
FIGURE 5.4
0
0 0
(Continued)
4000
5000
1500
500
500 0
2000
1000
1000 1000
0
500
1000 1500 2000 2500 3000
Duck Sa
0
500
1000
1500
2000
Duck Sn
0
500 1000 1500 2000 2500 3000 3500
Mouse Sg2b
4000
3000
2000
1500
1000
Mouse Sg3
3000
2000
500
1000 1500 2000 2500 3000
4000
2500
2000
Mouse Sm
Mouse Sg2a
3500
7000
2500
1000 500
Sg 2b
8000
Mouse Sg 2b
3500
Mouse Sg1
3000
Mouse Sg3
Mouse Sm
A
2500
Xenopus Sm
Xenopus Sc
Xenopus Su
3500
3000
7000 3000
5000 4000 3000
2500 2000 1500
1500 1500
1000
1000
500
500
0
0
0
500 1000 1500 2000 2500 3000 3500
7000
2000
2000
0
8000
2500
Xenopus Su
Xenopus Sc
Xenopus Sm
6000
Xenopus Sf
Xenopus Sf
C
6000 5000 4000 3000 2000
0
Xenopus Sm
D
500
1000 0 0
1000 1500 2000 2500 3000 3500
500
1000
1500
2000
Xenopus Sc
Xenopus Su
Lizard Sm
Lizard Su
2500
3000
0
500 1000 1500 2000 2500 3000 3500 4000
Xenopus Sf
4000 4000
3500
Lizard Su
Lizard Sm
3000 2500 2000
3000
2000
1500 1000
1000
500 0
0 0
500 1000 1500 2000 2500 3000 3500 4000
Lizard Sm
0
1000
2000
3000
4000
Lizard Su
FIGURE 5.4 Dotplot analysis of switch regions. S region sequences from each heavy chain isotype were analyzed using the Dotmatcher program. For mouse and duck, the window size was set to 35 nucleotides and the threshold was 80% identity. For frog and lizard, the window size was again set to 35 nucleotides, but the threshold was lowered to 65% identity. Mouse S regions were identified by their location between the I exon and the first CH exon for each isotype. Duck S regions were identified by proximity to the CH exons in the annotated duck IgH genomic sequence (AJ314754). As the duck Ca exons are in reverse orientation to the Cm exons, we took the region immediately 30 of the most distal Ca exon, relative to the Cm exons. Lizard CH exons were identified in the A. carolinensis draft genome sequence (Broad institute) using homology searches against either IgM sequence (GenBank accession EF683585) or against recombined IgY sequence (GenBank accession EF690360). S regions were identified by their proximity to the aligned CH exons. Frog S regions were also identified by proximity to the CH exons, with Cm, Cx, and Cu all present on X. tropicalis scaffold_928. Frog Cw and the Sw region were found on scaffold_972 (Ohta and Flajnik, 2006; Zhao et al., 2006).
DNA Targets of AID
173
There is only limited data on the function (e.g., CSR junctions) of the down stream Xenopus S regions (Mussmann et al., 1997; Ohta, 2006; Zarrin et al., 2004; Zhao et al., 2006). Similar to Xenopus Sm, they appear to have a higher content of the AGCT primordial target motif; however, they are relatively repeat-poor. A similar situation is observed in the lizard Sm and Su, which are repeat-poor, but rich in AGCT motifs compared to random sequences (Fig. 5.4D). Based on the dotplot analysis depicted in Fig. 5.4D, there are less repetitive sequences in the lizard S regions; attempts to identify tandem repeats using the EMBOSS program etandem (http:// emboss.sourceforge.net/apps/release/6.0/emboss/apps/etandem.html) failed to identify dense tandemly repeated regions. Visual inspection of the repeated segments that are present in Lizard Sm and Su and suggests that there is no strong consensus repeat found within the lizard S regions except for AGCT hotspots. Based on the low number of repeats in their S regions, one might expect the relative efficiency of CSR in Xenopus or lizard to be low. Nevertheless, even if the presence of repeats influences the relative efficiency of CSR, they are not a requirement for an active S region as long as AID hotspots such as AGCT are present. In this context, even a single DSB in place of Sg1 is sufficient to mediate substantial switching (Zarrin et al., 2007). Although both mouse and duck have highly repetitive S regions, the individual repeats in each of the sequences are not very similar to each other, perhaps illustrating an independent evolutionary origin of repeats in each of these species (Lundqvist et al., 2001). Given that some frog and all identified lizard S regions are relatively repeat-poor, this is the likely ancestral condition, with S regions becoming more repeat-rich through evolution. Since we do not fully understand the basis of AID targeting to S regions, further analysis of S regions from additional species will be important to the elucidation of the origin and importance of repetitive sequences in S regions. One interesting evolutionary puzzle is the long repeats identified in the mouse Sg regions. Although Cg evolved from a duplication of the ancestral Cu early in mammalian evolution (Vernersson et al., 2002), the long Sg repeats are highly divergent from those identified in duck Su regions (Lundqvist et al., 2001). The repeats from duck Su are more similar to the short repeats identified in mammalian SE. Identification and analysis of platypus or other early mammal S regions could provide some insight into the origin of Sg repeats. Unfortunately, the current platypus genome assembly (Warren et al., 2008) has a gap in the region predicted to contain the Sg repeats. The variation of S region length (Table 5.1) does not appear to be random, and there seems to be a positive correlation between S region length and the frequency of CSR to individual loci (Pan, 1998). In mouse, the number of S region repeats, is shown to be an important factor in
174
Jason A. Hackney et al.
determining endogenous Sg1 CSR efficiency (Zarrin et al., 2005). Thus, the robust CSR to IgG1 and high serum levels of IgG1 in mice may, at least in part, be attributed to the unusually long endogenous Sg1. IgE is present in the serum in the lowest concentration of all the antibodies, likely due in part to its small S region length, its low degree of repetitiveness, and its relatively far distance from Sm. Increasing the number of repeats might simply enhance the frequency of DSBs and therefore CSR. Supporting this model, artificial creation of an increasing numbers of DSBs using yeast endonuclease ISceI sites (see below) also enhances CSR frequency (Zarrin and Alt, unpublished data).
4. V REGIONS Mutations within the rearranged V gene segments (VDJ of the heavy chain or VJ of the kappa or lambda chains) extend from 200 bp downstream of the V promoter, within the leader intron and continue through the V gene and about 1.5 kb into the J–C intron (reviewed in Martin and Scharff, 2002; Martomo and Gearhart, 2006; Neuberger, 2008; Storb and Stavnezer, 2002). Transcription through the V region is required for SHM and both strands are equally mutated (Dorner et al., 1998; Storb et al., 1999). A consensus sequence DGYW/WRCH (G:C is the mutable position; D ¼ A/G/T, Y ¼ C/T, W ¼ A/T: R ¼ A/G, H ¼ T/C/A; DGYW for nontemplate strand and WRCH for template strand) has been designated as a favored mutational hot spot based on compiled mutation spectra of endogenous V genes and transgenes (Rogozin and Diaz, 2004) in combination with biochemical studies (Bransteitter et al., 2004; Huang et al., 2007; Larijani and Martin, 2007; Larijani et al., 2007; Pham et al., 2003, 2008; Yu, 2004). Among DGYW variants, AGCT is the preferred hotspot for SHM in vivo (Rogozin and Diaz, 2004). AID might preferentially select among a limited number of C residues depending on the context of surrounding nucleotides.
5. SEQUENCE COMPARISON OF V, S, AND NON-Ig AID TARGETS SHM is not limited to V regions, and other transgenic sequences (e.g., beta globin, neomycin, guanyl phosphorybosyl transferase, green fluorescence protein) undergo mutations (Bachl and Olsson, 1999; Betz et al., 1994; Wang, 2004; Yelamos et al., 1995; Yoshikawa et al., 2002). Non-Ig genes are also targets of AID, including oncogenes (e.g., bcl-6 and c-myc), although they show a much lower mutation frequency (Liu et al., 2008; Migliazza et al., 1995; Pasqualucci et al., 2001; Shen et al., 1998). Similar to
DNA Targets of AID
175
SHM, during CSR, S regions are also subject to mutation in both strands predominantly within hotspots (Dorner et al., 1998; Schrader et al., 2003; Xue, 2006). It is unclear whether sequence differences between Ig and non-Ig genes play a role in targeting SHM machinery to these loci. In an effort to better understand the AID target sequences in the genome, we compared Ig and non-Ig sequences for their DGYW, G nucleotide and AGCT content (Figs. 5.5 and 5.6). Mammalian S regions are highly enriched in DGYW- and G residues. The repetitive core of each mammalian switch regions was enriched for both DGYW motifs (between 6.5 and 12%) and G/C base-pairs (between 54 and 61%). By contrast, frog (X. tropicalis) S regions are not G rich but are enriched in DGYW motifs, including the AGCT hotspot. Regions of Xenopus Sm that are AGCT-rich serve as AID targets in mice, suggesting that AGCT might function as a primordial AID target motif (Zarrin et al., 2004). Thus, it would appear as though mammalian switch regions have enriched G nucleotides and DGYW hotspots (including AGCT) to maximize AID recruitment. Mammalian V genes are not G-rich, but several V genes are mildly enriched for the DGYW motif (up to 10%). Intriguingly, the degree of DGYW enrichment in some mammalian V genes is roughly comparable to that seen in the X. tropicalis Sm (G/C content (34–40%); DGYW content (6–7%). Two key differences between the Xenopus Sm region and mouse V regions are the size of the DGYW-rich region and the total number of DGYW repeats. While the V regions tend to be short and have a lower total number of DGYW motifs, the Xenopus Sm region is relatively large with DGYW sequences arranged in tandem repeats. Based on these observations, we posit that density of motifs and the length of the repetitive region might be determining parameters in influencing CSR. Consistent with this model, increasing the length of S region in both physiological and inverted orientations positively affects CSR frequency (Zarrin et al., 2005). The distribution of repeats might simply alter the chromatin structure and nucleosome positioning along S regions, influencing the recruitment or accessibility of AID. As the tetramer sequence DGYW is a known high-efficiency AID targeting motif (Dorner et al., 1998; Rogozin and Diaz, 2004), we also identified occurrences of this sequence, its reverse-complement WRCH (Rogozin and Diaz, 2004), and the ideal motif AGCT (which represents both DGYW and WRCH), in the nontemplate strand of S regions from each of the species described above (Fig. 5.5). We also examined the G and C frequency and strand bias (Fig. 5.5). In each panel, the number of occurrences of each sequence per 500 bp is mapped across each S region. The mouse S region sequences are, as a rule, higher in DGYW content than bulk genomic DNA (with a median frequency ranging from 37/500 bp in Sg1 to 74/500 bp in Sm, compared to 24/500 bp in noncoding DNA). The palindromic AGCT motif is also very highly overrepresented in
Mouse Sm
A
Mouse Sg 3
200
150
150
100
100
50
50
0
0
0
500 1000 1500 2000 2500
0
500 1000 1500 2000 2500 3000
Mouse Sg 2a
200
200
150
150
100
100
50
50
0
0 0
2000
Mouse Se
200
4000
6000
8000
0
500 1000 1500 2000 2500 3000
Mouse Sa
200
200
G-content
150
150
150
C-content
100
100
100
DGYW
50
50
50
WRCH
0
0
1000
2000
3000
4000
0 0
Duck Sm
B
160 140 120 100 80 60 40 20 0
150 100 50
0
FIGURE 5.5
1000
2000 3000
(Continued)
1000
1500
2000
0
0
500 1000 1500 2000 2500 3000
Duck Sa
200
0
500
4000
Duck Su 200 150 100 50
0
500 1000 1500 2000 2500
0
0
500
1000
1500
2000
AGCT
Jason A. Hackney et al.
250
200
Mouse Sg 2b
176
250
Mouse Sg 1
Xenopus Sm
C 100 80 60 40 20 0 0
500 1000 1500 2000 2500 3000
Xenopus Sc
120
100
100
80
80
60
60
40
40
20
20 0
E
1000
2000
3000
80
60
60
40
40
20 0 500 1000 1500 2000 2500 3000
20 0 0
500 1000 1500 2000 2500
0
1000
2000
3000
0
G-content C-content DGYW WRCH 0
1000
Mouse Xpf intron 10
2000
3000
AGCT
4000
Mouse Bc16 intron 1
140
160
120
140
Mouse Myc intron 1 200
120
100
80
60
100
60
40
40
20
20
50 0
0 500 1000 1500 2000 2500 3000
0
2000
4000
6000
8000
0
1000 2000 3000 4000 5000
177
FIGURE 5.5 Analysis of S region sequence composition. The regions identified for dotplot analysis in Fig. 5.4 were analyzed for the frequency of AGCT, DGYW (D ¼ A/G/T, Y ¼ C/T, W ¼ A/T), WRCH (W ¼ A/T, R ¼ A/G, H ¼ A/C/T), and the G and C count. In each case, the nontemplate strand of the IgH locus was analyzed. In the case of the inverted duck Ca, we used the nontemplate strand relative to the Cm exons, that is inverted relative to the Ca exons. In each case, we plotted the frequency of each subsequence and calculated a running total over a distance of 500 nucleotides, with a sliding window of 50 nucleotides.
DNA Targets of AID
150
100
80
0 0
100
80
Lizard Su
120
0
120
100
0
Xenopus Sf 140
120
Lizard Sm
D
Xenopus Su
160 140 120 100 80 60 40 20 0
178
Jason A. Hackney et al.
A
B 0.45
0.45 Sg 3
0.40
Sg 3
Sg1
N-Myc Myc
0.30
Sa
Sg 2b
Se
Bcl6 Pax5
0.25
Sg 1 Se
0.35
Sg 2a
G frequency
G frequency
0.40
Sa
Sg 2b
0.35
Sm
Sm
0.20
Sg 2a Bcl6
0.30
Pax5
N-Myc Myc
0.25 Bcl2
0.20 V regions S regions First introns Translocation hotspots Xenopus S regions Lizard S regions Duck S regions
Bcl2
0.15 0.10 0.00
0.02
0.04
0.06
AGCT frequency
0.08
0.10
V regions S regions First introns Translocation hotspots Xenopus S regions Lizard S regions Duck S regions
0.15 0.10 0.02
0.04
0.06
0.08
0.10
0.12
DGYW frequency
FIGURE 5.6 Comparison of S regions from various species to mouse V regions and intronic sequences. The average G, AGCT, and DGYW frequencies were calculated across the entire S region of each species as defined in Fig. 5.4. The background frequencies of each of these subsequences across bulk noncoding mouse genomic DNA sequence are indicated as dashed lines. V regions were parsed out of the annotated mouse IgH locus (GenBank accession NG_005838, identified as V segment), and the frequency of AGCT, DGYW, and G were calculated for the nontemplate strand. For non-Ig genes, up to 2 kb of sequence containing the first exon and intron was programmatically retrieved from the EnsEMBL annotated mouse genome database. Genes were randomly selected from a subset of the genes analyzed by Schatz group (Liu et al., 2008). A set of known translocation/mutation hotspot genes were also included in the non-Ig genes analyzed.
mouse S regions, ranging from 10 per 500 bp in Sg1 and Sg2a to 67 per 500 bp in mouse Sm, where most DGYW repeats are AGCT. Mouse S regions also show a strong G nucleotide bias on the nontemplate strand. The G content of the nontemplate strand of the mouse S regions range from 37% to 48% (175–242 per 500 bp), compared to an average of 22% in noncoding DNA. Most duck S regions share these two characteristics, though duck Sm is relatively AGCT poor, displaying a high frequency of alternate DGYW and WRCH repeats instead. Interestingly, although the duck Ca exons are in an inverted orientation relative to the Cm and Cu exons (Lundqvist et al., 2001), the Sa region has a sequence bias that is similar to the Su region, not inverted relative to the Sm and Su regions (Fig. 5.5). Also, duck Sm is atypical in that it does not have an obvious G/C bias on the nontemplate strand, unlike other duck S regions. The mechanistic implications for the G/C bias are not currently understood, especially as it does not occur in the S regions from either frog or lizard. In each of these species, S regions are relatively rich for AGCT sequences, and for DGYW and WRCH sequences in general. In all species analyzed so far, the Sm sequence appears to have either more AGCT or DGYW repeats than the downstream S regions, perhaps making it a better target for AID, and
DNA Targets of AID
179
highlighting its role as the donor S region. Based on these results, we favor a model in which the ancestral S regions were relatively rich in DGYW sequences, including the AGCT sequence. Through evolutionary pressure, these sequences became more AGCT rich through repetition of small repeat subunits that vary among different S regions (see below, Fig. 5.7). One potential cause for the expansion of AGCT relative to other DGYW repeats is that as a palindrome, AGCT allows for AID cleavage to occur in both strands. However, reconciling this model with the trend toward G-rich nontemplate sequence and R-loop formation is challenging. Further studies on the mechanism of DSB formation are required to elucidate the role of AGCT motifs versus the ability of R-loops to form ssDNA. AID dependent mutation near transcribed regions is detected outside the Ig locus which might contribute to aberrant SHM and chromosomal translocations (Liu et al., 2008; Migliazza et al., 1995; Pasqualucci et al., 2001; Shen et al., 1998; Ramiro et al., 2004, 2006). We compared the sequence characteristics of mouse S and V regions (efficient substrates of AID) to the first exon and intron of several non-Ig genes (Liu et al., 2008) that have varying degrees of AID-mediated mutation. We included both random genes and oncogenes that are shown to be targets of AID in our analysis based on previous studies (Liu et al., 2008). None of the genes with high AID-mediated mutation rates shows an increase in AGCT or DGYW sequences, with a DGYW frequency of 5%, slightly higher than the 4.8% observed in noncoding DNA. There is no overall difference in AGCT or DGYW frequency between genes that show AID-mediated mutation and those that do not. As a rule, the non-Ig genes have a lower DGYW and AGCT frequency than is observed in the V regions (Fig. 5.6). With the exception of bcl-6, which is neither G/C- nor DGYW-rich, the other non-Ig AID target genes contain relatively short G/C-rich regions (Fig. 5.6). Thus, it is possible that these SHM-target genes have the potential to serve as AID substrates. In fact, it has been recently demonstrated using plasmid substrates and electron microscopy that regions of c-myc corresponding to the hyper-mutable region, form structures in vitro that are capable of binding to gold-conjugated AID (Duquette, 2007; Duquette et al., 2005). The role that such structures play in recruiting AID activity in vivo has yet to be determined.
6. THE SUSCEPTIBILITY OF NON-S REGIONS TO MEDIATE CSR Although S regions appear to have unique sequence characteristics, replacing Sg1 with a 4-kb non-S region (XPF intron 10, Fig. 5.5E), is able to support isotype switching at a reduced but detectable level (1–2%) (Zarrin et al., 2004). This suggests that random sequences can generate low levels
180
Jason A. Hackney et al.
of DNA lesions (most likely DNA strand breaks) at least in the context of the IgH locus, highlighting a potential role for IgH-specific chromatin modifications in targeting of CSR. As the XPF intron does contain a low density of DGYW motifs (Fig. 5.5E), it is conceivable that the combination of transcription with sparse hotspot motifs might be sufficient to cause infrequent strand breaks through AID in activated B cells. It is possible that a similar mechanism could contribute to tumorigenic translocations if they occur in regions adjacent to oncogenes. By replacement of endogenous S regions with translocation hotspots one might measure the recombination ability of these regions.
7. AID RECRUITMENT TO TARGET SEQUENCES In order for the AID to get recruited to target loci, several steps seem to be necessary. Initially, transcription is necessary likely to provide the optimum ssDNA substrate for AID (Bransteitter et al., 2003; Chaudhuri et al., 2003; Pham et al., 2003; Ramiro et al., 2003) and/or mediating synapsis between participating S regions (Wuerffel et al., 2007). Endogenous (Chaudhuri, 2004) or flag-tagged (Nambu et al., 2003) AID interacts with transcribed S regions by using chromatin immunoprecipitation (ChIP) assay. Alteration of germline transcription of the IgH locus by deletion of the regulatory regions (I promoters (Jung, 1993; Seidl et al., 1998), enhancers (Gu, 1993; Perlot et al., 2005; Pinaud et al., 2001; Sakai et al., 1999)), or insertion of heterologous promoters (Bottaro et al., 1994; Cogne et al., 1994; Seidl et al., 1999) significantly reduces the efficiency of CSR (Zhang et al., 1993). However, non-I promoters can still mediate CSR, suggesting that I promoter-specific transcriptional complexes are not essential for CSR (Seidl et al., 1998). Furthermore, AID is shown to directly interact with RNA Polymerase II through an unknown mechanism (Nambu et al., 2003). Recruitment of AID through RNA Pol II might explain why non-Ig genes might be targets of AID, however the nature of AID target sequences, likely determines where primarily AID targets in the genome.
8. ROLE OF DNA DOUBLE STRAND BREAK (DSB) DSBs occur in S regions in an AID-dependent fashion shown by different assays such as phosphorylated H2AX foci(Petersen et al., 2001), intra-S recombination(Dudley et al., 2002) ,and Ligation Mediated-PCR (Rush, 2004; Schrader et al., 2005, 2007). DSBs in S regions preferentially occur at
DNA Targets of AID
181
the AID target hotspots predominantly as staggered 50 or 30 overhangs (Rush, 2004; Schrader et al., 2005; Wuerffel et al., 1997). The current model proposed for creation of DSB by AID suggests that AID deaminates deoxycytidine (dC) residues to generate dU:dG lesions at hotspots (Bransteitter et al., 2003; Chaudhuri et al., 2003; Ramiro et al., 2003; Sohail et al., 2003). The dU:dG lesion is then recognized by BER and/or MMR pathways, followed by uracil excision (by Uracil Nucleoside Glycosylase, UNG) to generate an abasic site, or recognized by MSH2/MSH6 as a mismatch (Fig. 5.2) (Di Noia and Neuberger, 2002, 2007). Since CSR reaction is significantly perturbed in UNG-deficient mice (Rada et al., 2002), UNG seems to be the uracil-DNA glycosylase that initiates the major pathway of CSR (Fig. 5.2). In addition, the double mutation of UNG and MSH2 results in complete abrogation of CSR (Rada, 2004). This suggests that the major pathway of CSR requires UNG while MSH2 provides a separate mechanism (Petersen-Mahrt, 2002; Rada, 2004). One crucial, but poorly understood, aspect of AID function is how it mediates its two disparate activities: point mutations in V regions during SHM, and DSB in S regions during CSR. It is likely that this decision is dependent on the nature of the target sequence. In this context, S regions have acquired a highly repetitive hotspots enriched in G/C base pairs (in mammalians) to ensure efficient AID deamination and subsequently DNA nicks on both strands. The distribution of CSR breakpoints within the 50 of Sm or 30 of acceptor S regions suggests that the density of the hotspots determines the choice between DSB and point mutations, because most DSBs are generated in regions that are highly repetitive such as S regions (Dunnick et al., 1993). Consistent with this model, the frequency of micro-deletions in the V region is very low (1%) (Rada, 2004). In addition, mice deficient in DSB-response repair proteins such as H2AX or 53BP1, do not affect SHM but reduce CSR (Manis et al., 2004; Reina-San-Martin et al., 2003; Ward et al., 2004). DSBs generated by the yeast ISceI endonuclease (Chaudhuri and Jasin, 2007) can replace the function of AID and S regions (Zarrin et al., 2007). In this model, Sm and/or Sg1 sequences were replaced by ISceI sites, an 18 bp sequence that is rare in the mouse genome (Jacquier and Dujon, 1985). Such DSBs are sufficient to support about 10–20% of wildtype isotype switching in primary B cells as well as in hybridomas that do not express AID (Zarrin et al., 2007). This experiment suggests that the major function of AID at S regions is to produce DSBs. Based on this model, CSR could be divided into two steps. During the first phase, AID deaminates DNA and this lesion is converted to DSBs by BER/MMR proteins. Subsequently, DSB response proteins and components of nonhomologous end joining (NHEJ) pathway synapse and join the DSBs, respectively (Yan et al., 2007; Zarrin et al., 2007).
182
Jason A. Hackney et al.
9. EVOLUTIONARY LINK BETWEEN SHM AND CSR SHM is an ancient process detected in all vertebrates including fish, while CSR is seen in higher species such as frogs, lizard, birds, and mammals (Diaz and Flajnik, 1998; Hsu et al., 2006). Recent studies have provided clues on the evolution of CSR (Barreto et al., 2005; Wakae et al., 2006). Fish AID, which is presumably evolved to only mediate SHM, can rescue CSR in AID/ B cells, suggesting that AID did not gain this ability in mammals (Barreto et al., 2005; Wakae et al., 2006). In addition, the function of AID and S regions can be replaced by ISceI-induced DSBs suggesting that neither germline transcription nor S regions are required for synapsis/ joining of two DSBs within IgH locus (Zarrin et al., 2007). This data AID target sequence
GGCATAGCTACTGAAAGTGAATCCAGAGGCAGCAC V regions
CCGTATCGATGACTTTCACTTAGGTCTCCGTCGTG
Duplication of C exons CH upstream intronic sequence TGGTTCGGTTGGTCGTAGAATCCTCGATCATACTA (proto-S region)
ACCAAGCCAACCAGCATCTTAGGAGCTAGTATGAT
BER/MMR to generate point mutations (SHM)
Tissue-specific C exon transcription
Existing ancient pathways
Expansion of AID Target sequences
AGCAAGCCAACCAGCATCGGCAGAGCTAGTATGAT TCGTTCGGTTFFTCGTAGCCGTCTCGATCATACTA
S region (amphibian)
Expansion of individual S region repeats
GGGGTGAGCTGAGCTGAGCTGGGGTAAGCTGGGAT CCCCACTCGACTCGACTCGACCCCATTCGACCCTA
S region (mammalian)
DSB-response proteins and NHEJ to synapse/join DSBs (CSR)
S region specific repeat (G-rich)
FIGURE 5.7 Model for the evolution of CSR from SHM. SHM is an ancient mechanism that is seen in fish where AID is expressed. In SHM, the BER/MMR pathways create mutations from the AID-mediated deamination lesions. The model presented for evolution of CSR presented here proposes that CH exons became duplicated along with upstream AID targeting hotspots. These hotspots of AID activity could easily become hotspots for DSB with an increased number of target sequences increased. The existing DSB-response proteins and NHEJ pathway were coopted for synapses/joining of the distant DSBs. As the CSR system became more established, the AID target motifs were multiplied through the expansion of species- and isotype-specific repetitive sequences.
DNA Targets of AID
183
suggests that an ancient repair mechanism is likely involved in the synapsis/joining phase of the CSR. Such repair mechanisms are likely evolved to avoid chromosomal translocation before evolution of immune system (Zarrin et al., 2007). It has also been established that the spectra of SHM and CSR mutations are very similar, consistent with a common AIDtargeting mechanism for both of these processes (Xue, Rada and Neuberger, 2006). In lower species such as amphibians, S regions consist of arrays of SHM motifs such as AGCT (Figs. 5.5 and 5.6). AGCT motif or other variations of the DGYW tetramer serve as preferred DNA target sites of AID (Zarrin et al., 2004). Xenopus Sm in place of mouse Sg1 can support substantial CSR with breakpoints clustered around AGCT target sites suggesting that CSR substrates are interchangeable and share sequence motifs necessary for CSR (Zarrin et al., 2004). The density of such motifs in the S region is significantly higher than V regions, potentially creating regions highly susceptible to DSB. In addition, in mammals, S regions appear to have further diverged by incorporating additional features, such as R-loop forming ability (Shinkura et al., 2003; Yu et al., 2003), which may serve to maximize switching efficiency. It is tempting to speculate that evolution of CSR involved the duplication and selection of repetitive SHM hotspots (Fig. 5.7). Understanding the similarities and differences of the pathways that contribute to SHM or CSR will help us to dissect mechanisms of antibody regulation and chromosomal translocations in lymphomas.
REFERENCES Bachl, J., and Olsson, C. (1999). Hypermutation targets a green fluorescent protein-encoding transgene in the presence of immunoglobulin enhancers. Eur. J. Immunol. 29, 1383. Barreto, V. M., Pan-Hammarstrom, Q., Zhao, Y., Hammarstrom, L., Misulovin, Z., and Nussenzweig, M. C. (2005). AID from bony fish catalyzes class switch recombination. J. Exp. Med. 202, 733. Betz, A. G., Milstein, C., Gonzalez-Fernandez, A., Pannell, R., Larson, T., and Neuberger, M. S. (1994). Elements regulating somatic hypermutation of an immunoglobulin kappa gene: Critical role for the intron enhancer/matrix attachment region. Cell 77, 239. Bottaro, A., Lansford, R., Xu, L., Zhang, J., Rothman, P., and Alt, F. W. (1994). S region transcription per se promotes basal IgE class switch recombination but additional factors regulate the efficiency of the process. EMBO J. 13, 665. Bransteitter, R., Pham, P., Calabrese, P., and Goodman, M. F. (2004). Biochemical analysis of hypermutational targeting by wild type and mutant activation-induced cytidine deaminase. J. Biol. Chem. 279, 51612. Bransteitter, R., Pham, P., Scharff, M. D., and Goodman, M. F. (2003). Activation-induced cytidine deaminase deaminates deoxycytidine on single-stranded DNA but requires the action of RNase. Proc. Natl. Acad. Sci. USA 100, 4102. Chaudhuri, J., and Jasin, M. (2007). Antibodies get a break. Science 315, 335. Chaudhuri, J., Khuong, C., and Alt, F. W. (2004). Replication protein A interacts with AID to promote deamination of somatic hypermutation targets. Nature 430, 992.
184
Jason A. Hackney et al.
Chaudhuri, J., Tian, M., Khuong, C., Chua, K., Pinaud, E., and Alt, F. W. (2003). Transcriptiontargeted DNA deamination by the AID antibody diversification enzyme. Nature 422, 726. Chen, J., Lansford, R., Stewart, V., Young, F., and Alt, F. W. (1993). RAG-2-deficient blastocyst complementation: An assay of gene function in lymphocyte development. Proc. Natl. Acad. Sci. USA 90, 4528. Cogne, M., Lansford, R., Bottaro, A., Zhang, J., Gorman, J., Young, F., Cheng, H. L., and Alt, F. W. (1994). A class switch control region at the 30 end of the immunoglobulin heavy chain locus. Cell 77, 737. Di Noia, J., and Neuberger, M. S. (2002). Altering the pathway of immunoglobulin hypermutation by inhibiting uracil-DNA glycosylase. Nature 419, 43. Di Noia, J. M., and Neuberger, M. S. (2007). Molecular mechanisms of antibody somatic hypermutation. Annu. Rev. Biochem. 76, 1. Diaz, M., and Flajnik, M. F. (1998). Evolution of somatic hypermutation and gene conversion in adaptive immunity. Immunol. Rev. 162, 13. Dorner, T., Foster, S. J., Farner, N. L., and Lipsky, P. E. (1998). Somatic hypermutation of human immunoglobulin heavy chain genes: Targeting of RGYW motifs on both DNA strands. Eur. J. Immunol. 28, 3384. Dudley, D. D., Chaudhuri, J., Bassing, C. H., and Alt, F. W. (2005). Mechanism and control of V(D)J recombination versus class switch recombination: Similarities and differences. Adv. Immunol. 86, 43. Dudley, D. D., Manis, J. P., Zarrin, A. A., Kaylor, L., Tian, M., and Alt, F. W. (2002). Internal IgH class switch region deletions are position-independent and enhanced by AID expression. Proc. Natl. Acad. Sci. USA 99, 9984. Dunnick, W., Hertz, G. Z., Scappino, L., and Gritzmacher, C. (1993). DNA sequences at immunoglobulin switch region recombination sites. Nucleic Acids Res. 21, 365. Dunnick, W. A., Shi, J., Graves, K. A., and Collins, J. T. (2004). Germline transcription and switch recombination of a transgene containing the entire H chain constant region locus: Effect of a mutation in a STAT6 binding site in the gamma 1 promoter. J. Immunol. 173, 5531. Duquette, M. L., Huber, M. D., and Maizels, N. (2007). G-rich proto-oncogenes are targeted for genomic instability in B-cell lymphomas. Cancer Res. 67, 2586. Duquette, M. L., Pham, P., Goodman, M. F., and Maizels, N. (2005). AID binds to transcription-induced structures in c-MYC that map to regions associated with translocation and hypermutation. Oncogene 24, 5791. Flajnik, M. F. (2002). Comparative analyses of immunoglobulin genes: Surprises and portents. Nat. Rev. Immunol. 2, 688. Franco, S., Gostissa, M., Zha, S., Lombard, D. B., Murphy, M. M., Zarrin, A. A., Yan, C., Tepsuporn, S., Morales, J. C., Adams, M. M., Lou, Z., Bassing, C. H., et al. (2006). H2AX prevents DNA breaks from progressing to chromosome breaks and translocations. Mol. Cell 21, 201. Gu, H., Zou, Y. R., and Rajewsky, K. (1993). Independent control of immunoglobulin switch recombination at individual switch regions evidenced through Cre-loxP-mediated gene targeting. Cell 73, 1155. Honjo, T., Kinoshita, K., and Muramatsu, M. (2002). Molecular mechanism of class switch recombination: Linkage with somatic hypermutation. Annu. Rev. Immunol. 20, 165. Hsu, E., Pulham, N., Rumfelt, L. L., and Flajnik, M. F. (2006). The plasticity of immunoglobulin gene systems in evolution. Immunol. Rev. 210, 8. Huang, F. T., Yu, K., Balter, B. B., Selsing, E., Oruc, Z., Khamlichi, A. A., Hsieh, C. L., and Lieber, M. R. (2007). Sequence dependence of chromosomal R-loops at the immunoglobulin heavy-chain Smu class switch region. Mol. Cell. Biol. 27, 5921. Jacquier, A., and Dujon, B. (1985). An intron-encoded protein is active in a gene conversion process that spreads an intron into a mitochondrial gene. Cell 41, 383.
DNA Targets of AID
185
Jiang, C., Foley, J., Clayton, N., Kissling, G., Jokinen, M., Herbert, R., and Diaz, M. (2007). Abrogation of lupus nephritis in activation-induced deaminase-deficient MRL/lpr mice. J. Immunol. 178, 7422. Jiang, C., Zhao, M. L., and Diaz, M. (2008). Activation-induced deaminase heterozygous MRL/lpr mice are delayed in the production of high-affinity pathogenic antibodies and in the development of lupus nephritis. Immunology. 10, 1365. Jung, S., Rajewsky, K., and Radbruch, A. (1993). Shutdown of class switch recombination by deletion of a switch region control element. Science 259, 984. Kenter, A. L., Wuerffel, R., Dominguez, C., Shanmugam, A., and Zhang, H. (2004). Mapping of a functional recombination motif that defines isotype specificity for mu–>gamma3 switch recombination implicates NF-kappaB p50 as the isotype-specific switching factor. J. Exp. Med. 199, 617. Khamlichi, A. A., Glaudet, F., Oruc, Z., Denis, V., Le Bert, M., and Cogne, M. (2004). Immunoglobulin class-switch recombination in mice devoid of any S mu tandem repeat. Blood 103, 3828. Kinoshita, K., Tashiro, J., Tomita, S., Lee, C. G., and Honjo, T. (1998). Target specificity of immunoglobulin class switch recombination is not determined by nucleotide sequences of S regions. Immunity 9, 849. Klein, U., and Dalla-Favera, R. (2008). Germinal centres: Role in B-cell physiology and malignancy. Nat. Rev. Immunol. 8, 22. Larijani, M., and Martin, A. (2007). Single-stranded DNA structure and positional context of the target cytidine determine the enzymatic efficiency of AID. Mol. Cell. Biol. 27, 8038. Larijani, M., Petrov, A. P., Kolenchenko, O., Berru, M., Krylov, S. N., and Martin, A. (2007). AID associates with single-stranded DNA with high affinity and a long complex half-life in a sequence-independent manner. Mol. Cell. Biol. 27, 20. Liu, M., Duke, J. L., Richter, D. J., Vinuesa, C. G., Goodnow, C. C., Kleinstein, S. H., and Schatz, D. G. (2008). Two levels of protection for the B cell genome during somatic hypermutation. Nature 451, 841. Luby, T. M., Schrader, C. E., Stavnezer, J., and Selsing, E. (2001). The mu switch region tandem repeats are important, but not required, for antibody class switch recombination. J. Exp. Med. 193, 159. Lundqvist, M. L., Middleton, D. L., Hazard, S., and Warr, G. W. (2001). The immunoglobulin heavy chain locus of the duck. Genomic organization and expression of D, J, and C region genes. J. Biol. Chem. 276, 46729. Lundqvist, M. L., Middleton, D. L., Radford, C., Warr, G. W., and Magor, K. E. (2006). Immunoglobulins of the non-galliform birds: Antibody expression and repertoire in the duck. Dev. Comp. Immunol. 30, 93. Maizels, N. (2005). Immunoglobulin gene diversification. Annu. Rev. Genet. 39, 23. Manis, J. P., Dudley, D., Kaylor, L., and Alt, F. W. (2002). IgH class switch recombination to IgG1 in DNA-PKcs-deficient B cells. Immunity 16, 607. Manis, J. P., Morales, J. C., Xia, Z., Kutok, J. L., Alt, F. W., and Carpenter, P. B. (2004). 53BP1 links DNA damage-response pathways to immunoglobulin heavy chain class-switch recombination. Nat. Immunol. 5, 481. Martin, A., and Scharff, M. D. (2002). AID and mismatch repair in antibody diversification. Nat. Rev. Immunol. 2, 605. Martomo, S. A., and Gearhart, P. J. (2006). Somatic hypermutation: Subverted DNA repair. Curr. Opin. Immunol. 18, 243. Meffre, E., Catalan, N., Seltz, F., Fischer, A., Nussenzweig, M. C., and Durandy, A. (2001). Somatic hypermutation shapes the antibody repertoire of memory B cells in humans. J. Exp. Med. 194, 375. Mietzner, B., Tsuiji, M., Scheid, J., Velinzon, K., Tiller, T., Abraham, K., Gonzalez, J. B., Pascual, V., Stichweh, D., Wardemann, H., and Nussenzweig, M. C. (2008). Autoreactive
186
Jason A. Hackney et al.
IgG memory antibodies in patients with systemic lupus erythematosus arise from nonreactive and polyreactive precursors. Proc. Natl. Acad. Sci. USA 105, 9727. Migliazza, A., Martinotti, S., Chen, W., Fusco, C., Ye, B. H., Knowles, D. M., Offit, K., Chaganti, R. S., and Dalla-Favera, R. (1995). Frequent somatic hypermutation of the 50 noncoding region of the BCL6 gene in B-cell lymphoma. Proc. Natl. Acad. Sci. USA 92, 12520. Mowatt, M., Dery, C., and Dunnick, W. (1985). Unique sequences are interspersed among tandemly repeated elements in the murine gamma 1 switch segment. Nucleic Acids Res. 13, 225. Muramatsu, M., Kinoshita, K., Fagarasan, S., Yamada, S., Shinkai, Y., and Honjo, T. (2000). Class switch recombination and hypermutation require activation-induced cytidine deaminase (AID), a potential RNA editing enzyme. Cell 102, 553. Mussmann, R., Courtet, M., Schwager, J., and Du Pasquier, L. (1997). Microsites for immunoglobulin switch recombination breakpoints from Xenopus to mammals. Eur. J. Immunol. 27, 2610. Nambu, Y., Sugai, M., Gonda, H., Lee, C. G., Katakai, T., Agata, Y., Yokota, Y., and Shimizu, A. (2003). Transcription-coupled events associating with immunoglobulin switch region chromatin. Science 302, 2137. Neuberger, M. S. (2008). Antibody diversification by somatic mutation: From Burnet onwards. Immunol. Cell. Biol. 86, 124. Ohta, Y., and Flajnik, M. (2006). IgD, like IgM, is a primordial immunoglobulin class perpetuated in most jawed vertebrates. Proc. Natl. Acad. Sci. USA 103, 10723. Pan, Q., Rabbani, H., and Hammarstrom, L. (1998). Characterization of human gamma 4 switch region polymorphisms suggests a meiotic recombinational hot spot within the Ig locus: influence of S region length on IgG4 production. J. Immunol. 161, 3520. Pasqualucci, L., Neumeister, P., Goossens, T., Nanjangud, G., Chaganti, R. S., Kuppers, R., and Dalla-Favera, R. (2001). Hypermutation of multiple proto-oncogenes in B-cell diffuse large-cell lymphomas. Nature 412, 341. Perlot, T., Alt, F. W., Bassing, C. H., Suh, H., and Pinaud, E. (2005). Elucidation of IgH intronic enhancer functions via germ-line deletion. Proc. Natl. Acad. Sci. USA 102, 14362. Petersen, S., Casellas, R., Reina-San-Martin, B., Chen, H. T., Difilippantonio, M. J., Wilson, P. C., Hanitsch, L., Celeste, A., Muramatsu, M., Pilch, D. R., et al. (2001). AID is required to initiate Nbs1/gamma-H2AX focus formation and mutations at sites of class switching. Nature 414, 660. Petersen-Mahrt, S. K., Harris, R. S., and Neuberger, M. S. (2002). AID mutates E. coli suggesting a DNA deamination mechanism for antibody diversification. Nature 418, 99. Pham, P., Bransteitter, R., Petruska, J., and Goodman, M. F. (2003). Processive AID-catalysed cytosine deamination on single-stranded DNA simulates somatic hypermutation. Nature 424, 103. Pham, P., Smolka, M. B., Calabrese, P., Landolph, A., Zhang, K., Zhou, H., and Goodman, M. F. (2008). Impact of phosphorylation and phosphorylation-null mutants on the activity and deamination specificity of activation-induced cytidine deaminase. J. Biol. Chem. 283, 17428. Pinaud, E., Khamlichi, A. A., Le Morvan, C., Drouet, M., Nalesso, V., Le Bert, M., and Cogne, M. (2001). Localization of the 30 IgH locus elements that effect long-distance regulation of class switch recombination. Immunity 15, 187. Rada, C., Di Noia, J. M., and Neuberger, M. S. (2004). Mismatch recognition and uracil excision provide complementary paths to both Ig switching and the A/T-focused phase of somatic mutation. Mol. Cell. 16, 163. Rada, C., Williams, G. T., Nilsen, H., Barnes, D. E., Lindahl, T., and Neuberger, M. S. (2002). Immunoglobulin isotype switching is inhibited and somatic hypermutation perturbed in UNG-deficient mice. Curr. Biol. 12, 1748.
DNA Targets of AID
187
Ramiro, A. R., Jankovic, M., Callen, E., Difilippantonio, S., Chen, H. T., McBride, K. M., Eisenreich, T. R., Chen, J., Dickins, R. A., Lowe, S. W., et al. (2006). Role of genomic instability and p53 in AID-induced c-myc-Igh translocations. Nature 440, 105. Ramiro, A. R., Jankovic, M., Eisenreich, T., Difilippantonio, S., Chen-Kiang, S., Muramatsu, M., Honjo, T., Nussenzweig, A., and Nussenzweig, M. C. (2004). AID is required for c-myc/IgH chromosome translocations in vivo. Cell 118, 431. Ramiro, A. R., Stavropoulos, P., Jankovic, M., and Nussenzweig, M. C. (2003). Transcription enhances AID-mediated cytidine deamination by exposing single-stranded DNA on the nontemplate strand. Nat. Immunol. 4, 452. Reina-San-Martin, B., Difilippantonio, S., Hanitsch, L., Masilamani, R. F., Nussenzweig, A., and Nussenzweig, M. C. (2003). H2AX is required for recombination between immunoglobulin switch regions but not for intra-switch region recombination or somatic hypermutation. J. Exp. Med. 197, 1767. Revy, P., Muto, T., Levy, Y., Geissmann, F., Plebani, A., Sanal, O., Catalan, N., Forveille, M., Dufourcq-Labelouse, R., Gennery, A., et al. (2000). Activation-induced cytidine deaminase (AID) deficiency causes the autosomal recessive form of the Hyper-IgM syndrome (HIGM2). Cell 102, 565. Rogozin, I. B., and Diaz, M. (2004). Cutting edge: DGYW/WRCH is a better predictor of mutability at G:C bases in Ig hypermutation than the widely accepted RGYW/WRCY motif and probably reflects a two-step activation-induced cytidine deaminase-triggered process. J. Immunol. 172, 3382. Roy, D., Yu, K., and Lieber, M. R. (2007). The Mechanism of R-Loop Formation at Immunoglobulin Class Switch Sequences. Mol. Cell. Biol. 28, 50. Rush, J. S., Fugmann, S. D., and Schatz, D. G. (2004). Staggered AID-dependent DNA double strand breaks are the predominant DNA lesions targeted to S mu in Ig class switch recombination. Int. Immunol. 16, 549. Sakai, E., Bottaro, A., Davidson, L., Sleckman, B. P., and Alt, F. W. (1999). Recombination and transcription of the endogenous Ig heavy chain locus is effected by the Ig heavy chain intronic enhancer core region in the absence of the matrix attachment regions. Proc. Natl. Acad. Sci. USA 96, 1526. Schrader, C. E., Bradley, S. P., Vardo, J., Mochegova, S. N., Flanagan, E., and Stavnezer, J. (2003). Mutations occur in the Ig Smu region but rarely in Sgamma regions prior to class switch recombination. EMBO J. 22, 5893. Schrader, C. E., Guikema, J. E., Linehan, E. K., Selsing, E., and Stavnezer, J. (2007). Activationinduced cytidine deaminase-dependent DNA breaks in class switch recombination occur during G1 phase of the cell cycle and depend upon mismatch repair. J. Immunol. 179, 6064. Schrader, C. E., Linehan, E. K., Mochegova, S. N., Woodland, R. T., and Stavnezer, J. (2005). Inducible DNA breaks in Ig S regions are dependent on AID and UNG. J. Exp. Med. 202, 561. Seidl, K. J., Bottaro, A., Vo, A., Zhang, J., Davidson, L., and Alt, F. W. (1998). An expressed neo(r) cassette provides required functions of the 1gamma2b exon for class switching. Int. Immunol. 10, 1683. Seidl, K. J., Manis, J. P., Bottaro, A., Zhang, J., Davidson, L., Kisselgof, A., Oettgen, H., and Alt, F. W. (1999). Position-dependent inhibition of class-switch recombination by PGKneor cassettes inserted into the immunoglobulin heavy chain constant region locus. Proc. Natl. Acad. Sci. USA 96, 3000. Shen, H. M., Peters, A., Baron, B., Zhu, X., and Storb, U. (1998). Mutation of BCL-6 gene in normal B cells by the process of somatic hypermutation of Ig genes. Science 280, 1750. Shinkura, R., Tian, M., Smith, M., Chua, K., Fujiwara, Y., and Alt, F. W. (2003). The influence of transcriptional orientation on endogenous switch region function. Nat. Immunol. 4, 435.
188
Jason A. Hackney et al.
Sohail, A., Klapacz, J., Samaranayake, M., Ullah, A., and Bhagwat, A. S. (2003). Human activation-induced cytidine deaminase causes transcription-dependent, strand-biased C to U deaminations. Nucleic Acids Res. 31, 2990. Stavnezer, J., and Amemiya, C. T. (2004). Evolution of isotype switching. Semin. Immunol. 16, 257. Storb, U., Peters, A., Kim, N., Shen, H. M., Bozek, G., Michael, N., Hackett, J., Jr., Klotz, E., Reynolds, J. D., Loeb, L. A., and Martin, T. E. (1999). Molecular aspects of somatic hypermutation of immunoglobulin genes. Cold Spring Harb Symp Quant Biol. 64, 227. Storb, U., and Stavnezer, J. (2002). Immunoglobulin genes: generating diversity with AID and UNG. Curr. Biol. 12, R725. Szurek, P., Petrini, J., and Dunnick, W. (1985). Complete nucleotide sequence of the murine gamma 3 switch region and analysis of switch recombination sites in two gamma 3-expressing hybridomas. J. Immunol. 135, 620. Tian, M., and Alt, F. W. (2000). Transcription-induced cleavage of immunoglobulin switch regions by nucleotide excision repair nucleases in vitro. J. Biol. Chem. 275, 24163. Unniraman, S., and Schatz, D. G. (2007). Strand-biased spreading of mutations during somatic hypermutation. Science 317, 1227. Vernersson, M., Aveskogh, M., Munday, B., and Hellman, L. (2002). Evidence for an early appearance of modern post-switch immunoglobulin isotypes in mammalian evolution (II); cloning of IgE, IgG1 and IgG2 from a monotreme, the duck-billed platypus, Ornithorhynchus anatinus. Eur. J. Immunol. 32, 2145. Wakae, K., Magor, B. G., Saunders, H., Nagaoka, H., Kawamura, A., Kinoshita, K., Honjo, T., and Muramatsu, M. (2006). Evolution of class switch recombination function in fish activation-induced cytidine deaminase, AID. Int. Immunol. 18, 41. Wang, C. L., Harper, R. A., and Wabl, M. (2004). Genome-wide somatic hypermutation. Proc. Natl. Acad. Sci. USA 101, 7352. Ward, I. M., Reina-San-Martin, B., Olaru, A., Minn, K., Tamada, K., Lau, J. S., Cascalho, M., Chen, L., Nussenzweig, A., Livak, F., et al. (2004). 53BP1 is required for class switch recombination. J. Cell. Biol. 165, 459. Wardemann, H., and Nussenzweig, M. C. (2007). B-cell self-tolerance in humans. Adv. Immunol. 95, 83. Wardemann, H., Yurasov, S., Schaefer, A., Young, J. W., Meffre, E., and Nussenzweig, M. C. (2003). Predominant autoantibody production by early human B cell precursors. Science 301, 1374. Warren, W. C., Hillier, L. W., Marshall Graves, J. A., Birney, E., Ponting, C. P., Grutzner, F., Belov, K., Miller, W., Clarke, L., Chinwalla, A. T., et al. (2008). Genome analysis of the platypus reveals unique signatures of evolution. Nature 455, 256. Wuerffel, R., Wang, L., Grigera, F., Manis, J., Selsing, E., Perlot, T., Alt, F. W., Cogne, M., Pinaud, E., and Kenter, A. L. (2007). S-S synapsis during class switch recombination is promoted by distantly located transcriptional elements and activation-induced deaminase. Immunity 27, 711. Wuerffel, R. A., Du, J., Thompson, R. J., and Kenter, A. L. (1997). Ig Sgamma3 DNA-specifc double strand breaks are induced in mitogen-activated B cells and are implicated in switch recombination. J. Immunol. 159, 4139. Xue, K., Rada, C., and Neuberger, M. S. (2006). The in vivo pattern of AID targeting to immunoglobulin switch regions deduced from mutation spectra in msh2-/- ung-/mice. J. Exp. Med. 203, 2085. Yan, C. T., Boboila, C., Souza, E. K., Franco, S., Hickernell, T. R., Murphy, M., Gumaste, S., Geyer, M., Zarrin, A. A., Manis, J. P., et al. (2007). IgH class switching and translocations use a robust non-classical end-joining pathway. Nature 449, 478.
DNA Targets of AID
189
Yelamos, J., Klix, N., Goyenechea, B., Lozano, F., Chui, Y. L., Gonzalez Fernandez, A., Pannell, R., Neuberger, M. S., and Milstein, C. (1995). Targeting of non-Ig sequences in place of the V segment by somatic hypermutation. Nature 376, 225. Yoshikawa, K., Okazaki, I. M., Eto, T., Kinoshita, K., Muramatsu, M., Nagaoka, H., and Honjo, T. (2002). AID enzyme-induced hypermutation in an actively transcribed gene in fibroblasts. Science 296, 2033. Yu, K., Chedin, F., Hsieh, C. L., Wilson, T. E., and Lieber, M. R. (2003). R-loops at immunoglobulin class switch regions in the chromosomes of stimulated B cells. Nat. Immunol. 4, 442. Yu, K., Huang, F. T., and Lieber, M. R. (2004). DNA substrate length and surrounding sequence affect the activation-induced deaminase activity at cytidine. J. Biol. Chem. 279, 6496. Yurasov, S., and Nussenzweig, M. C. (2007). Regulation of autoreactive antibodies. Curr. Opin. Rheumatol. 19, 421. Yurasov, S., Wardemann, H., Hammersen, J., Tsuiji, M., Meffre, E., Pascual, V., and Nussenzweig, M. C. (2005). Defective B cell tolerance checkpoints in systemic lupus erythematosus. J. Exp. Med. 201, 703. Zarrin, A. A., Alt, F. W., Chaudhuri, J., Stokes, N., Kaushal, D., Du Pasquier, L., and Tian, M. (2004). An evolutionarily conserved target motif for immunoglobulin class-switch recombination. Nat. Immunol. 5, 1275. Zarrin, A. A., Del Vecchio, C., Tseng, E., Gleason, M., Zarin, P., Tian, M., and Alt, F. W. (2007). Antibody class switching mediated by yeast endonuclease-generated DNA breaks. Science 315, 377. Zarrin, A. A., Goff, P. H., Senger, K., and Alt, F. W. (2008). Sgamma3 switch sequences function in place of endogenous Sgamma1 to mediate antibody class switching. J. Exp. Med. 205, 1567. Zarrin, A. A., Tian, M., Wang, J., Borjeson, T., and Alt, F. W. (2005). Influence of switch region length on immunoglobulin class switch recombination. Proc. Natl. Acad. Sci. USA 102, 2466. Zhang, J., Bottaro, A., Li, S., Stewart, V., and Alt, F. W. (1993). A selective defect in IgG2b switching as a result of targeted mutation of the I gamma 2b promoter and exon. EMBO J. 12, 3529. Zhao, Y., Pan-Hammarstrom, Q., Yu, S., Wertz, N., Zhang, X., Li, N., Butler, J. E., and Hammarstrom, L. (2006). Identification of IgF, a hinge-region-containing Ig class, and IgD in Xenopus tropicalis. Proc. Natl. Acad. Sci. USA 103, 12087.
CHAPTER
6 Interleukin 5 in the Link Between the Innate and Acquired Immune Response Kiyoshi Takatsu,*,† Taku Kouro,‡ and Yoshinori Nagai*
Contents
1. Introduction 2. IL-5 and Signal Transduction 2.1. Regulation of IL-5 expression 2.2. IL-5 receptor expression and its regulation 3. IL-5-Receptor-Mediated Signaling 3.1. JAK2 and STAT5 pathway 3.2. Btk activation 3.3. Ras/ERK activation 4. IL-5 Augments Innate Immune Response 4.1. Promotion of B-1 cell growth and differentiation 4.2. IL-5 and eosinophil function 4.3. Innate immune responses influence IL-5 production 5. IL-5 Modulates Acquired Immune Response 5.1. IL-5 enhances differentiation of B-2 cells into AFC 5.2. IL-5 and class switch recombination 6. IL-5 Links Innate and Acquired Immunity In Disease Model 6.1. Contact sensitivity model
193 196 196 197 201 201 202 204 204 204 207 207 208 208 209 216 216
* Department of Immunobiology and Genetics, Graduate School of Medicine and Pharmaceutical Science for { {
Research, University of Toyama, Toyama 930-0194, Japan Toyama Prefectural Institute for Pharmaceutical Research, Imizu-shi, Toyama 939-0363, Japan National Institute of Biomedical Innovation, 7-6-8 Asagi Saito Ibaraki-City, Osaka 567-0085, Japan
Advances in Immunology, Volume 101 ISSN 0065-2776, DOI: 10.1016/S0065-2776(08)01006-7
#
2009 Elsevier Inc. All rights reserved.
191
192
Kiyoshi Takatsu et al.
6.2. Atherosclerotic model 6.3. IL-5 in allergy 7. Future Perspectives Acknowledgments References
Abstract
217 218 220 222 222
Interleukin-5 (IL-5) is an interdigitating homodimeric glycoprotein that is initially identified by its ability to support the in vitro growth and differentiation of mouse B cells and eosinophils. IL-5 transgenic mouse shows two predominant features, remarkable increase in B-1 cells resulting in enhanced serum antibody levels, predominantly IgM, IgA, and IgE classes and in expansion of eosinophil numbers in the blood and eosinophil infiltration into various tissues. Conversely, mice lacking a functional gene for IL-5 or IL-5 receptor alpha chain (IL-5Ra) display a number of developmental and functional impairments in B cells and eosinophils. IL-5 receptor (IL-5R) comprises a and bc chains. IL-5 specifically binds to IL-5Ra and induces the recruitment of bc to IL-5R. Although precise mechanisms on cell-lineage-specific IL-5Ra expression remain elusive, several transcription factors including Sp1, E12/E47, Oct-2, and c/EBPb have been shown to regulate its expression in B cells and eosinophils. JAK2 and JAK1 tyrosine kinase are constitutively associated with IL-5Ra and bc, respectively, and are activated by IL-5 stimulation. IL-5 activates at least three different signaling pathways including JAK2/STAT5 pathway, Btk pathway, and Ras/ERK pathway. IL-5 is one of key cytokines for mouse B cell differentiation in general, particularly for fate-determination of terminal B cell differentiation to antibody-secreting plasma cells. IL-5 critically regulates homeostatic proliferation and survival of and natural antibody production by B-1 cells, and enhances the AID and Blimp-1 expression in activated B-2 cells leading to induce m to g1 class switch recombination and terminal differentiation to IgM- and IgG1-secreting plasma cells, respectively. In humans, major target cells of IL-5 are eosinophils. IL-5 appears to play important roles in pathogenesis of asthma, hypereosinophilic syndromes, and eosinophil-dependent inflammatory diseases. Clinical studies will provide a strong impetus for investigating the means of modulating IL-5 effects. We will discuss the role of IL-5 in the link between innate and acquired immune response, particularly emphasis of the molecular basis of IL-5-dependent B cell activation, allergen-induced chronic inflammation and hypereosinophilic syndromes on a novel target for therapy.
IL-5 in the Link Between the Innate and Acquired Immune Response
193
1. INTRODUCTION Immune systems fall into at least two categories, innate and acquired immune responses. Innate immune responses are present in all animals and responsible for the first line of defense against many common microorganisms or tissue injury ( Janeway and Medzhitov, 2002). They are mediated by macrophage/dendritic cells, NK cells and certain leukocytes such as eosinophils, neutrophils, basophils, and mast cells that recognize pathogen-associated molecular patterns (PAMPs) through germlineencoded pattern recognition receptors, toll-like receptor (TLR) family, or Nod-like receptor (NLR) family (Akira et al., 2006, Medzhitov, 2001, Takeda et al., 2003). The TLR family has important roles in microbial recognition and dendritic cell activation (Takeda et al., 2006). TLR, expressed on a diverse variety of cells and tissues, recognize PAMPs derived from various classes of pathogens, including Gram-positive and -negative bacteria, DNA and RNA viruses, fungi, and protozoa. Ligand recognition induces a conserved host defense program, which includes production of inflammatory cytokines and interferon-alpha (IFN-a), upregulation of costimulatory molecules, and induction of antimicrobial defenses. TLRs 7 and 9 can recognize nucleic acids and trigger signaling cascades that activate plasmacytoid dendritic cells to produce IFN-a (Akira et al., 2006; Honda et al., 2005; Lund et al., 2004; Kaisho et al., 2008; Tanaka et al., 2007). The NLR family is also important for inflammation and tissue damage that is activated by various crystals, ATP, and amyloid-b and PAMPs (Eisenbarth, et al., 2008; Hornung et al., 2008; Inohara et al., 2005; Martinon and Tschopp, 2005). Acquired immune responses are involved in the late phase of infection and the generation of immunological memory that are mediated by a specialized group of lymphocytes including T and B cells. These lymphocytes recognize antigen via cell surface antigen receptors. The activated T cells release cytokines and chemokines which activate the phagocytosis by the innate cells and provide increased protection against pathogens (Pasare and Medzhitov, 2005). Activation of dendritic cells by TLR ligands plays a critical role necessary for maturation and consequent ability to initiate and activate acquired immune responses. Mature B cells expressing surface IgM as B cell receptor (BCR) are consisted of B-1 cells and conventional B (B-2) cells that regulate the innate and acquired immune responses, respectively (Haas et al., 2005). There are phenotypically distinct progenitors for mouse B-1a and B-1b for B-1 cells and B-2 cells at early developmental stage before rearrangement of the gene encoding Igh is complete (Montecino-Rodriguez et al., 2006). Although B-1a cells can be distinguished from B-1b and B-2 cells by their expression of CD5, both B-1a and B-1b have numerous noteworthy characteristics from B-2 cells, such as their self-replenishing ability, particular
194
Kiyoshi Takatsu et al.
tissue distribution (abundant in the peritoneal and pleural cavity), VH gene usage of IgM, and production of autoantibodies (Berland and Wortis, 2002; Hardy and Hayakawa, 2001; Hayakawa and Hardy, 1988; Herzenberg, 2000; Kantor and Herzenberg, 1993). B-1 cells form a minor population of the total splenic B cell pool and are absent from lymph nodes. Moreover, the published data demonstrates failure of bone marrow cells to reconstitute B-1 cells, whereas either fetal liver (presumably precursors) or B-1 cells from the peritoneum (mature cells) can reconstitute (Kantor and Herzenberg, 1993). As we will discuss later, B-1 cells constitutively express three different markers, namely Mac-1, CD43, and the IL-5Ra (Hitoshi et al., 1990; Yamaguchi et al., 1990). B-1 cells are the major source of natural antibody in the IgM, IgG3, and IgA classes. Coupled to the observation that autoimmune mice have a higher number of B-1 cells as compared to normal mice, this has led to the suggestion that B-1 cells play roles in the innate immune responses (Berland and Wortis, 2002) and in the development of autoimmune diseases. Mature B-2 cells respond to protein antigens and interact with T helper (Th) cells which express a particular T cell receptor (TCR) for proliferation and differentiation into antibody-producing plasma cells (ASC). Th cells recognize the peptide-MHC complex presented on the B cells and transiently express CD40 ligand (CD40L) on their surface that is required for interaction with B cells through CD40 and LMP1 on B cells and production of a defined set of cytokines (Bauman and Paul, 1992; Burdin et al., 1995; Calame, 2005; Casola et al., 2004; Paul and Ohara, 1987; Rastelli et al., 2008; Shapiro-Shelef and Calame, 2005). Antigen stimulation of B-2 cells induces genetic events in their IgH gene loci that are essential for the generation of functional diversity in the humoral immune response and for efficient antigen elimination (Rolink and Melchers, 1991). Class-switch recombination (CSR) replaces the heavy chain constant region (CH) from Cm to other CH regions to diversify the effector function of the Ig (Honjo and Kataoka, 1978). The process of CSR is highly regulated by cytokines, B cell activators or both (Allison et al., 1991; Dudley, et al., 2004; Melchers and Andersson 1986; Stavnetzer et al., 2008). In the mouse, it is well documented that IL-4 is a survival factor for B-2 cells and an inducer of CSR, primarily to IgG1 and IgE (Esser et al., 1989; Noma et al., 1986; Paul and Ohara, 1987; Rothman et al., 1988; Severinson et al., 1990). IFN-g and TGF-b are cytokines for CSR-inducing cytokines for IgG2a and IgA respectively (Coffman et al., 1989a,b; Sonoda et al., 1989; Snapper et al., 1988, 1992, 1993). The efficiency of antigen elimination is also augmented by affinity maturation, which is accomplished by excessive point mutations in the V-region gene by somatic hypermutation (SHM). Activation-induced cytidine deaminase (AID) is the essential and sole B cell-specific factor required for CSR and SHM
IL-5 in the Link Between the Innate and Acquired Immune Response
195
(Dudley et al., 2004; Kinoshita and Honjo, 2001; Muramatsu et al., 1999, 2000, 2007; Revy et al., 2000). Many groups have identified essential transcriptional regulators, including Blimp-1, Bach 2, Bcl6, IRF4, Xbp-1, and Pax5 (Busslinger, 2004; Kallies et al., 2004, 2007; Mittrucker et al., 1997; Nera et al., 2006; Niu et al., 1998; Reimold et al., 2001; Schebesta et al., 2007; Sciammas et al., 2006; Shaffer et al., 2000, 2002; Shapiro-Shelef et al., 2003, 2005; Tunyaplin et al., 2004; Turner et al., 1994), whose activities organize the transition from the mature switched B cell genetic programs to high level antibody synthesis and secretion (Calame, 2006). Blimp-1, a transcriptional repressor is essential for the terminal differentiation of ASC. Eosinophils are produced in bone marrow under influences of Th2 cytokines, and pulmonary allergen exposure results in both increased output of eosinophils from hemopoietic tissues and increased migration to the lung in both mice and humans. Eosinophilia is associated with a wide variety of conditions, including allergic diseases, helminthes infections, drug hypersensitivity, and neoplastic disorders. Allergic diseases including asthma and atopic diseases are characterized by inflammation with pronounced infiltration of Th2 cells and granulocytes such as mast cells, basophils, eosinophils, and neutrophils (Cohn et al., 2004; Galli et al., 2008; Kay, 2001). Regarding the inflammatory cells implicated in asthma, IgE-mediated degranulation of mast cells contributes to inflammatory infiltrates and acute bronchoconstriction in the early phase of allergic inflammation, whereas recruitment of CD4þ Th2 cells and eosinophils is a central feature of the late-phase response (Galli et al., 2008; Kay, 2001; Wills-Karp, 1999). Classical Th2 cell-derived cytokines (e.g., IL-3, IL-4, IL-5, IL-9, IL-13, and GM–CSF) and eosinophils are thought to play critical roles in the induction of airway hyperreactivity and the development of lesions that underpin chronic airway wall remodeling (Cohn et al., 2004; Nakajima and Takatsu, 2007). In particular, IL-4, IL-5, IL-9, and IL-13 together with eotaxin, play critical roles in orchestrating and amplifying allergic inflammation in asthma (Asquith et al., 2008; Foster et al., 1996; Mattes et al., 2002; Rothenberg et al., 2008; Sanderson, 1992; Tanaka et al., 2000). In addition, newly identified cytokines including thymic stromal lymphopoietin (TSLP), IL-17, IL-22, IL-25, and IL-33 are thought to play roles in the induction of allergic inflammation including asthma (Min and Paul, 2008; Sokol et al., 2008). IL-5 is a glycoprotein with the four helical bundle motifs that is conserved among several hematopoietic cytokines that is mainly produced by Th2 cells after stimulation with antigens such as Mycobacterium tuberculosis, Toxocara canis, or with allergens and mast cells upon stimulation with allergen/IgE complex or calcium ionophore (Kinashi et al., 1986; Plaut et al., 1989; Takatsu et al., 1980a, 1980b, 1988, 1997). Dimeric IL-5 acts on target cells by binding to its specific IL-5 receptor (IL-5R) that consists of a
196
Kiyoshi Takatsu et al.
unique a chain (IL-5Ra) and a common b chain (bc) (Harada et al., 1987; Milburn et al., 1993; Mita et al., 1989a; Takatsu et al., 1992). IL-5Ra specifically binds to IL-5 and induces the recruitment of bc to IL-5R (Kitamura et al., 1990, 1991; Murata et al., 1992; Takaki et al., 1990, 1991; Tavernier et al., 1991). The bc is a signal-transducing molecule shared with IL-3R and GM– CSFR (Miyajima et al., 1992; Murata et al., 1992; Ogata et al., 1998; Takatsu et al., 1992; Takaki et al., 1991, 1993). The membrane proximal proline-rich sequence (PPXP motif) of the cytoplasmic domain of both IL-5Ra and the bc are essential for IL-5-induced signal transduction (Kouro et al., 1996; Moon et al., 2001; Takaki et al., 1994; Watanabe et al., 1993). IL-5 activates mouse B cells and eosinophils for their proliferation and differentiation resulting to regulate the innate and acquired immune responses (Takatsu et al., 1987, 1997; Yamaguchi et al., 1988a). In humans, the biologic effects of IL-5 are best characterized for eosinophils (Sanderson, 1992; Yamaguchi et al., 1988b). In addition to inducing terminal maturation of eosinophils, IL-5 prolongs eosinophil survival by delaying apoptotic death, possesses eosinophil chemotactic activity, increases eosinophil adhesion to endothelial cells, and enhances eosinophil effector function. IL-5 appears to play important roles in pathogenesis of asthma, hypereosinophilic syndromes (HES), and eosinophil-dependent inflammatory diseases (Liu et al., 2002; Nakajima and Takatsu, 2007; Nakajima et al., 1992). However, recent attempts to inhibit accumulation of eosinophils in the airways of asthmatics by targeting IL-5 have only had limited success. As we have discussed in several reviews about genes and protein structure of IL-5 and IL-5R, IL-5 signal transduction, and activities on B cells and eosinophils (Takatsu and Nakajima, 2008; Takatsu et al., 1994, 1997), we will focus in this review on recent advances of IL-5 roles in the immune system and disease control, including IL-5-dependent class switch recombination, contact sensitivity, and atherosclerosis through antigen-specific B-1 cell activation and IgM production and allergeninduced IL-5-dependent eosinophilic inflammation in a novel target for therapy.
2. IL-5 AND SIGNAL TRANSDUCTION 2.1. Regulation of IL-5 expression While IL-5 was initially identified through its ability to support the growth and differentiation of murine B cells, IL-5 is now known to augment the ability of proliferation and survival of eosinophil progenitors and mature eosinophils in the immune system and inflammation. The major cellular sources of IL-5 are Th2 cells, Tc2 cells, mast cells, eosinophils, and gdT cells
IL-5 in the Link Between the Innate and Acquired Immune Response
197
(Mosmann and Coffman, 1989; Tominaga et al., 1988). It becomes clear that NK cells, NK T cells, or nonhematopoietic cells including epithelial cells may produce IL-5 (Desreumaux et al., 1992; Moon et al., 2004; Sakuishi et al. 2007; Warren et al., 1995). Importantly, the administration of anti-IL-5 mAb to wild-type mice, TCRb/d/ mice or W/Wv mice resulted in reduction in the total cell number and cell size of B-1 cells to an extent similar to that of IL-5Ra-deficient mice. Cell transfer experiments have demonstrated that B-1 cell survival in wild-type mice and homeostatic proliferation in RAG2/ mice are impaired in the absence of IL-5Ra (Moon et al., 2004). Results suggest that IL-5 expression is occurred in cells other than T and mast cells. RT–PCR analysis revealed that significant IL-5 mRNA expression is detectable in the lungs, spleen, and small intestine of wild-type mice, RAG-2/ mice, and TCRb/d/ mice. IL-5 mRNA expression is not observed in the liver. Furthermore, high levels of IL-5 mRNA expression are detected in c-Kit IL-5Ra/ cells in the lungs and small intestine of RAG-2/ mice (Moon et al., 2004). These results imply that IL-5 is also produced by non-T/non-mast/noneosinophil cells. Kuraoka and his colleagues reported that CD4 c-kit CD3e IL-2Raþ cells in the Peyer’s patch (designated PP CD3 IL-2Rþ cells) produce high level of IL-5 when stimulated with IL-2 (Kuraoka et al., 2004). PP CD3 IL2Rþ cells do not express CD3e, TCRb and TCRgd, CD23, c-kit, DX5, or NK1.1, suggesting that PP CD3 IL-2Rþ cells are not T cells, mast cells, NK cells, or NK T cells, and may be a novel subset which produce high level of IL-5. PP CD3 IL-2Rþ cells express TLRs, respond to polyinosinic– polycytidylic acid (poly I:C, TLR3 ligand) stimuli, leading to secrete IL-5 and enhance IgA production.
2.2. IL-5 receptor expression and its regulation In normal mice, IL-5 specifically binds to IL-5Ra and induces the recruitment of bc, which is shared with the cytokine-specific a subunit of the receptor for IL-3 and GM–CSF. IL-5Ra is constitutively expressed on mouse B-1 cells, and eosinophils and basophils in both mouse and human. In particular, IL-5Ra expression in the mouse is readily demonstrated on B-1 cells that reside largely in the peritoneum and respond to IL-5 for survival, proliferation, and differentiation to ASC (Hitoshi et al., 1991; Takatsu, 1998). In contrast, most resting B-2 cells express bc but not IL5Ra, and do not respond to the IL-5. Once B cells are activated by Th cells and antigen through BCR and CD40, they express IL-5Ra and become responsive to IL-5 resulting in integration into the plasma cell differentiation program. CD38 ligation on B cells by mAb CS/2, anti-mouse CD38 mAb (aCD38), induced proliferation, IgM secretion, tyrosine phosphorylation of Btk, and NF-kB activation in B cells from
198
Kiyoshi Takatsu et al.
wild-type mice (Kaku et al., 2001; Kikuchi et al., 1995). The aCD38 stimulation of B-2 cells induces increase in the expression of IL-5Ra. More than 60% of B cells expressed IL-5Ra after 48 h culture, while 3–5% of splenic naı¨ve B cells express IL-5Ra. We have analyzed transcription factors that bind to promoter of the mouse IL-5Ra gene. Results revealed that there are several initiation sites for transcription and the region between bp 250 and 111 from proximal to the transcriptional start site is involved in the regulation of IL-5Ra expression. We found that a complex of transcription factor including E12, E47, Sp1, c/EBPb, and Oct2 coordinately regulate the IL-5Ra expression (Ashizawa, 2002; Imamura et al., 1994). We did not get evidence for the dimer formation of RFX protein and its involvement in the regulation of IL-5Ra expression. IL-5Ra expression is also inducible on B-2 cells upon stimulation with CD40 or LPS. Importantly, IL-4 up-regulates the IL-5Ra expression on CD40- and LPS-stimulated B cells (Emslie et al., 2008; Weber et al., 1996), although IL-4 does not induce IL-5Ra. Corcoran and his colleagues reported that Oct2 deficient B cells failed to completely up-regulate IL-5Ras under above conditions (Corcoran et al., 1993; Emslie et al., 2008). Thus Oct-2 contributes to, but does not entirely control IL-5Ra levels. Oct2 enhances the ability of activated B-2 cells to differentiate to ASC under T cell-dependent conditions, through direct regulation of the gene encoding IL-5Ra. Oct2 binds directly to the promoter of the IL-5Ra gene to activate its transcription specifically in B cells (Emslie et al., 2008). Eosinophilic progenitors as well as mature eosinophils in the mouse and human constitutively express IL-5Ra (Hitoshi et al., 1991; Iwasaki et al., 2005, 2006). There are several reports on the human IL-5Ra gene regulation in human eosinophil development. Ackerman and his colleagues identified a unique cis element that acts like an enhancer in regulating activity of the IL-5Ra promoter (Sun et al., 1995). Iwama and his colleagues identified an enhancer-like cis element in the IL-5Ra promoter that is important for both full promoter function and lineage-specific activity. They also identified RFX2 protein that belongs to the RFX DNA-binding protein family specifically binds to the cis element (Iwama et al., 1999). They further showed that RFX1, RFX2, and RFX3 homodimers and heterodimers specifically bind to the cis element of the IL-5Ra promoter and contribute to the activity and lineage specificity of the IL-5Ra promoter through activation and repression domains. The AP-1 site in the promoter of the human IL-5Ra gene was shown to be necessary for promoter activity in eosinophilic HL60 cells (Baltus et al., 1998). The AP-1 site of the IL-5Ra promoter binds multiple proteins, including c-Jun, CREB, and CREM. As a whole, we still uncover regulatory mechanisms of IL-5Ra gene expression specific for eosinophil lineage. Martinez–Moczygemba and his colleagues demonstrated that following cytokine ligation, bc signaling is terminated partially by ubiquitination
IL-5 in the Link Between the Innate and Acquired Immune Response
199
and proteasome degradation of its cytoplasm demain, resulting in the generation of truncated bc products, termed bc intracytoplasmic proteolysis (bIP) (Martinez-Moczygemba et al., 2007). The truncated IL-5R complex (IL-5Ra and bIP) is degraded in the lysosome. Moreover, inhibition of bc proteasome degradation resulted in prolonged activation of bc, JAK2, STAT5, and SHP-2. By using biochemical and flow cytometric methods, they also reported that JAK kinase activity is required for the direct ubiquitination of the bc cytoplasmic domain and proteasome degradation (Martinez-Moczygemba et al., 2001). They also reported that IL-5Rs on human eosinophils reside in and are internalized by clathrin- and lipid raft-dependent endocytic pathways (Lei and Martinez-Moczygemba, 2008).
2.2.1. IL-5R expression on progenitors for B-1 cell and eosinophil The progenitors of B-1 cells are abundant in the fetal omentum and liver but are missing in the bone morrow of adult animals (Hardy and Hayakawa, 2001). The B-1a cells are developed in vitro along with a stromal cell-dependent IL-5-sensitive pathway (Katoh et al., 1990, 1993; Tominaga et al., 1989), which can bifurcate to CD5þ macrophages under the influence of GM–CSF. IL-5 transgenic mice show marked increase in proportion and numbers of B-1a and B-1b cells in the spleen with concomitant hypergammaglobulinemia and autoantibody production (Katoh et al., 1993; Tominaga et al., 1991). Likewise, IL-5 responsive B-1 cells are increased in the spontaneously autoimmune NZB and (NZB NZW) F1 mice. Recently, B-1 cell-specified progenitor was identified in the lineage marker negative (Lin) CD19þ B220lo-neg cell in fetal bone marrow preferentially that reconstitutes functional sIgMhi, CD11bþ CD5lo-neg B-1 cells in vivo (Montecino-Rodriguez et al., 2006). Their data support models proposing distinct developmental pathways for B-1 cells from B-2 cells. We examined the IL-5Ra expression of B cell progenitor in fetal liver and found that IL-5Raþ cell were in Lin cell fraction in the fetal liver but not in CD19 B220þ cell fraction. We transferred the Lin IL-5Raþ cells in the fetal liver into lightly irradiated SCID mice, and found that those cells did not differentiate into B-1 cells. In contrast, IL-5Ra CD19þ B220 fetal liver cells became B-1 cells. Rather, IL-5Raþ cells in the fetal liver were able to differentiate into eosinophils in vitro culture under the influence of cytokine cocktails including IL-5 (Kouro et al., submitted for publication). These results suggest that CD19þ B220 B-1 progenitors in the fetal liver do not express IL-5Ra at least at a level detectable by FACS analysis, while eosinophil progenitors do express IL-5Ra. (Fig. 6.1). Eosinophils are categorized as granulocytes together with neutrophils, and granulocyte/monocyte progenitors (GMPs) give rise to eosinophils as well as neutrophils and monocytes at the single cell level (Iwasaki et al., 2005, 2006). Eosinophil development is supported by GM–CSF,
200
Kiyoshi Takatsu et al.
Population IgH Lin− c-kitLo IL-5Ra + Eosinophil progenitors
IL-5Rα +
CLP B-1P
Eosinophils CD19+ B220− cells IL-5Rα −
B-2P(?) IL-5Rα + EosP
HSC B-1 Cells
Gene expression
EBF+, Pax5+ EBF+, BM: DJ Pax5+, FL: DJ EoPO− proB: DJ EBF+, preB: VDJ Pax5+ None EBF+/−, Pax5−, EoPO+ DJ
B-1 differentiation signal?
CLP
ProB
PreB
B-2 Cells
FIGURE 6.1 Expression of IL-5Ra on progenitors of B-1 cells and eosinophils. It becomes clear that IL-5 plays a role in the generation of B-1 cells and eosinophil, because both B-1 cells and eosinophils constitutively express IL-5Ra. In vitro and in vivo analysis revealed that mouse eosinophil progenitors in the fetal liver express IL-5Ra. However B-1 cell progenitors in the fetal liver do not express IL-5a, although B-1 cell progenitors in the bone marrow express IL-5a.
IL-3 and IL-5. Among these cytokines, IL-5 signaling is especially critical to develop eosinophilia. Therefore, IL-5Ra should be expressed in putative eosinophil progenitors (EoPs). In this regard, Iwasaki and his colleagues have demonstrated that in the normal bone marrow, Lin Sca-1 CD34þ fraction contains a small number of cells expressing IL-5Ra and a low level of c-Kit and that purified Lin Sca-1 IL-5Raþ CD34þ c-Kitlo cells, which are blastic cells with scattered eosinophilic granules, respond to IL-5 alone or Slf, IL-3, IL-5, IL-9, GM–CSF, Epo and Tpo, leading to differentiate exclusively into eosinophils (Iwasaki et al., 2005, 2006). These results indicate that Lin Sca-1 IL-5Raþ CD34þ c-Kitlo cells might be EoPs. Mice infected with Trichinella spiralis displayed accumulation of mature eosinophils in the intestine and the lung within 5 days after infection. In the bone marrow of mice infected with Trichinella spirali, on day 5, Lin Sca-1 IL-5Raþ CD34þ c-Kitlo EoPs significantly expanded by 3-fold in number, while numbers of GMPs and common myeloid progenitors (CMPs) were not affected. Purified EoPs from T. spiralis-infected mice again differentiated exclusively to eosinophils. Lin Sca-1 IL-5Raþ CD34þ c-Kitlo EoPs were not found in the spleen or the intestine of normal or helminth-infected mice (Iwasaki et al., 2005), suggesting that the Lin Sca-1 IL-5Raþ CD34þ c-Kitlo EoPs in the bone marrow are involved in the physiological eosinophil development.
IL-5 in the Link Between the Innate and Acquired Immune Response
201
3. IL-5-RECEPTOR-MEDIATED SIGNALING IL-5 stimulation induces rapid tyrosine phosphorylation of various cellular proteins including the bc, SH2/SH3-containing proteins such as Vav, HS1 and Shc, Btk and Btk-associated molecules, Jak1/Jak2 and STAT1/STAT5, PI3K, and MAP kinases, and activates downstream signaling molecules (Kouro et al., 1996; Ogata et al., 1998; Sato et al., 1994; Takaki et al., 1994). Treatment of IL-5-dependent cell lines with herbimycin A completely inhibits IL-5 dependent cell growth, indicating that tyrosine phosphorylation of cellular proteins is critical for IL-5 signaling. The activated STAT5 can induce the gene expression of Oncostatin M, a cytokine inducible SH2 protein (CIS) and JAK2-binding SH2-containing protein ( JAB). IL-5 induces the expression of CIS and JAB in eosinophils that are one of the feedback loops of negative regulation of IL-5 signaling (Zahn et al., 2000). The involvement of the Ras-Raf-1-MEK pathway has been shown in IL-5 signaling in human eosinophils (Adachi and Alam, 1998; Hall et al., 2001; Pazdrak et al., 1995, 1998). IL-5 enhances gene expression of c-Myc, c-Fos, c-Jun, Cis, Cish1/Jab, and pim-1 in B cells (Sakamaki et al., 1992; Sato et al., 1993; Takaki et al., 1994; Takatsu, 1998; Watanabe et al., 1993).
3.1. JAK2 and STAT5 pathway JAK2 and JAK1 tyrosine kinases are constitutively associated with IL-5Ra and bc, respectively and activated upon IL-5 stimulation. The activation of Jak2 and the STAT5 are essential for IL-5-dependent signal transduction both in B cells and eosinophils (Alam et al., 1995; Horikawa et al., 2001; Kagami et al., 2000; Miyajima et al., 1992). We elucidated the human IL-5Ra (hIL-5Ra) cytoplasmic domain regulating the JAK kinase activation for IL-5, regarding associations of JAK1 and JAK2 with hIL-5R and bc. Results revealed that JAK2 is constitutively associated with hIL-5Ra regardless of IL-5 stimulation. In contrast, JAK1 is constitutively associated with bc regardless of IL-5 stimulation and is associated with hIL5Ra only when cells are stimulated with IL-5 (Ogata et al., 1998). Both JAK1 and JAK2 are activated upon stimulation with IL-5. These results clearly indicate that JAK2 and JAK1 are constitutively associated with hIL-5Ra and bc, respectively, and construct functional hIL-5Ra–bc complex in the presence IL-5. The region of hIL–5Ra necessary for JAK2 binding is located in amino acid residues 346–387 including proline-rich sequences of the cytoplasmic domain. (Fig. 6.2) By using COS7 transfectants expressing intact bc and a kinasenegative form of JAK1 and JAK2 (DN–JAK1 and DN–JAK2, respectively), we found that overexpression of DN–JAK2 inhibits IL-5-induced activation of JAK2 and JAK1 and cell proliferation (Ogata et al. unpublished).
202
Kiyoshi Takatsu et al.
bc IL-5
IL-5Ra
Pro-rich
JAK2
JAK1
Box 1
Ras JAK1
JAK1
JAK2
JAK2
Box 2 SHC
Y P
Grb2
Sos
PTP1D
Raf-1 Spred-1 MEK
Pl 3-kinase STAT5 MAPK Lyn
STAT1
Nucleus c-fos, c-jun, c-myc, cis, oncostatin-M, jab,...
FIGURE 6.2 Molecular basis of IL-5 signal transduction. IL-5 stimulation of human eosinophils activates at least two different signaling pathways, namely Jak2/STAT5 pathway and Ras–MAP kinase pathway leading to induce the expression of genes involved in eosinophil growth, survival, and activation. Activation of Jak2 is critical for IL-5 signaling. Spred-1 is a negative regulator of Erk activation and regulates IL-5-induced eosinophil activation.
In contrast, DN–JAK1 overexpression inhibits JAK1 activation, but not suppresses JAK2 activation. IL-5-induced tyrosine phosphorylation of bc is diminished only when by DN–JAK2 is overexpressed. These results indicate that JAK2 activation is essential and enough to transduce IL-5 signals.
3.2. Btk activation There are several evidence for supporting the involvement of Btk in IL-5 signaling in B cell. First, IL-5 stimulation enhances Btk kinase activity in a murine early B cell line, Y16 (Sato et al., 1994). Second, Y16 transfectants of a gain of function mutant of Btk (Btk*) cDNA proliferate in an IL-5 independent manner (Li et al., 1995). Third, B cells from Xid mouse respond poorly to IL-5 and showed a decrease in the number of peritoneal IL-5Raþ B cells (Hitoshi et al., 1993). IL-5 activates Btk that is essential for IL-5 signaling in B cells. Btk is the gene responsible for human X-linked agammaglobulinemia (XLA), which is characterized by a near absence of peripheral B cells, low concentrations of serum Igs and varying degrees of bacterial infections (Tsukada et al., 1993; Vetrie et al., 1993). Btk is a cytoplasmic tyrosine kinase expressed in myeloid, erythroid, and B lineage cells except
IL-5 in the Link Between the Innate and Acquired Immune Response
203
plasma cells. A spontaneous Btk mutation (R28C) in XID mice produces X-linked immunodeficiency (xid) (Rawlings et al., 1993; Thomas et al., 1993). The B cells from XID mice as well as Btk/ mice show impaired B cell development and function (Khan et al., 1995). XID B cells are hyporesponsive to IL-5, IL-10, and LPS (Hitoshi et al., 1990, 1993; Koike et al., 1995) and fail to proliferate in response to stimulation via the BCR or CD38 (Kikuchi et al., 1995). We generated IL-5Ra transgenic (5Ra-Tg) mice carrying the mouse IL-5Ra gene ligated with the human IgH enhancer and mouse VH promoter (Koike et al., 1996). Although majority of spleen B cells in the Xid-5Ra-Tg mice express functional IL-5R, but they do not respond to IL-5. Thus, low-responsiveness of the Xid B cells to IL-5 is intrinsic due to the impaired Btk signaling pathway. Btk belongs to the Tec family of nonreceptor PTKs and is composed of pleckstrin homology (PH), unique Tec homology (TH), Src homology 3 (SH3), Src homology 2 (SH2), and a kinase domain in this order from the NH2- to COOH-terminus (Tsukada et al., 1993). Despite the biological importance of Btk in B-cell differentiation and its important role in calcium signaling, the precise function of Btk at the biochemical level remains unclear. We isolated a protein called BAM11 that binds to PHdomain of Btk (Kikuchi et al., 2000). BAM11 is murine homologue of human LTG19/ENL, a fusion partner of MLL/ALL-1/HRX, in infantile leukemia cells. Forced expression of BAM11 inhibits not only IL-5induced proliferation of early B cells but also the Btk activity both in vivo and in vitro. Analysis using GFP-fused Btk protein demonstrated that Btk localizes both in the nucleus and in the cytoplasm. The nucleocytoplasmic shuttling of human Btk is also reported (Hirano et al., 2004). Potential targets may reside inside the nucleus, which may be critical in gene regulation during B cell development and differentiation. The enforced expression of BAM11 in COS cells enhances transcriptional activity of the synthetic reporter gene. Regions essential for the transcriptional coactivation activity of BAM11 are different from Btkbinding motifs. Btk enhances transcriptional coactivation activity of BAM11 through both intact PH domain and kinase activity of Btk (Hirano et al., 2004). This ‘‘positive-negative mutual regulation system’’ between BAM11 and Btk may elucidate a novel mechanism on B cell signaling through BCR and IL-5R. Furthermore, the enforced expression of TFII-I, another Btk-binding protein with transcriptional activity, together with BAM11 and Btk, augments BAM11- and Btk-dependent transcriptional coactivation. BAM11 was coimmunoprecipitated with the INI1/SNF5 protein, a member of the SWI/SNF complex that remodels chromatin and activates transcription. IL-5 may regulate gene transcription in B cells by activating Btk, BAM11, and the SWI/SNF transcriptional complex via TFII-I activation. The schematic models Btk involvement in IL-5 signaling is depicted in Fig. 6.3.
204
Kiyoshi Takatsu et al.
3.3. Ras/ERK activation Although the molecular mechanisms for IL-5 signal transduction in eosinophils are not fully characterized, IL-5 activates Btk, JAK2, Lyn, and Raf-1 as well as SHP2 (Kagami et al., 2000; Kouro et al., 1996; Ogata et al., 1998; Takaki et al., 1994). In addition to the Jak2/STAT5 pathway, the Ras-extracellular signal-regulated kinase (ERK) pathway has also been implicated in signaling of IL-5 and other cytokines for maintaining cellsurvival, proliferation, and differentiation of eosinophils (Coffer et al., 1998; Hall et al., 2001; Pazdrak et al., 1995). JAK2 and Lyn appear to be important for cell proliferation and survival, whereas Raf-1 seems to play a central role in regulating cell function, such as degranulation (Pazdrack et al., 1995, 1998). Sprouty family proteins were identified as negative regulators for several growth factor-induced ERK activation including FGF and EGF. Yoshimura and his colleagues cloned the Sprouty-related Ena/VASP homology 1-domain containing protein (Spred)-1 and identified as a negative regulator of growth factor-mediated, Ras-dependent ERK activation (Wakioka et al., 2001). Using Spred-1-deficient mice, Inoue et al. (2005) demonstrated that Spred-1 negatively regulates allergen-induced airway eosinophilia and hyperresponsiveness, without affecting Th cell differentiation. Biochemical assays indicate that Spred-1 suppresses IL-5dependent cell proliferation and ERK activation. Moreover, Spred-1 deficiency shows overexpression of IL-13 in eosinophils (Inoue et al., 2005). These data indicate that Spred-1 is a negative regulator of ERK activation and modulates eosinophil activation normally mediated by IL-5.
4. IL-5 AUGMENTS INNATE IMMUNE RESPONSE 4.1. Promotion of B-1 cell growth and differentiation B-1 cells are the primary source of natural antibody (Ab), although they can become Ig-producing cells for all isotypes. Consistent with a major role of B-1 cells in IgM production, a number of specificities of natural IgM Ab have been identified in the B-1 repertoire. These include specificities for LPS, phosphorylcholine (PC), undefined determinants on Escherichia coli and Salmonella spp., phosphatidylcholine, and complement-binding Abs (Hayakawa and Hardy, 1998; Herzenberg et al., 1986). Furthermore, B-1 cells in the peritoneal cavity serve as an important source of IgA-producing plasma cells at mucosal sites (Fagarasan, 2008, Fagarasan et al., 2000, 2001). Antibody repertoire of B-1 cells is dominated by a restricted set of V genes, and has been considered carriers of ‘‘natural’’ immunity (Berland and Wortis, 2002; Hardy and Hayakawa, 2001). We noticed that all B-1 cells in the peritoneal cavity from wild-type mice constitutively express IL-5Ra (Hitoshi et al., 1990). Furthermore, IL-5
A
Xid mice has a mutation in Btk PH domain
B
Murine BAM11 and human LTG19 Y Y
Pro
Ser
Pro
Pro
Ser
Pro
Y
BAM11 1
71 78
483 547 NLS
Btk
PH
TH
SH3 SH2
Kinase
LTG19/ ENL 1
Break point
Zn finger
trx
1406
3969 YY
Pro Ser Pro Y
LTG19
Reduced serum levels of IgM and IgG3
1406 5 Break point YY LTG19 /ENL (19p13) 1 5
1
Defective BCR-, IL-5R-, and CD38-mediated signaling
Mutual regulation between BAM11 and BTK
D
PH
559 Pro Ser Pro Y 559
SWI/SNF complex
BAM11
Activation
Y 495 559
Sequence-specific regulatory proteins
ATPase
BTK Ac
Suppression Ac
BAM11 Btk P
TFII-I
Ac Ac
BS Ac
Suppressed signal transduction
Ac
Ac
Ac
Transcription
205
FIGURE 6.3 Schematic illustration of Btk and Btk-associated molecule BAM11 and their sites of action. (A) Domain structure of mouse Btk and its mutant (xid). (B) BAM11has 89% homology to human LTG19/ENL fusion partners in chromosomal translocation of MLL. (C) Mutual regulation between BAM11 and Btk. (D) Btk enhances transcriptional coactivation activity of BAM11 that is a subunit of SWI/SNF
IL-5 in the Link Between the Innate and Acquired Immune Response
AT hook MLL (11q23) 1 MLL- AT hook
Decreased number of B-1 cells No response to TI-II antigen
Upregulated transcriptional activity
71 78
NLS Leukemia translocation
R28C xid mutation
C
Y Y
206
Kiyoshi Takatsu et al.
transgenic mice provided enormous numbers of CD5þ B-1 cells in the spleen (Tominaga et al., 1991). Moreover, total numbers of B-1 cells, derived from the peritoneal cavity of the IL-5Ra/ mice are significantly lower (less than 10%) at 3-weeks of age than those in wild-type littermates (Yoshida et al., 1996). IL-5–/– mice also show a severe reduction in B-1 cells in neonate in the peritoneal cavity (Kopf et al., 1996). B-1 cell numbers come back to normal range in the adult life by their self-replenishing activity. Interestingly, the administration of anti-IL-5 mAb into wildtype adult mice results in reduction in the total number and cell size of B-1 cells to an extent similar to that of IL-5Ra/ mice (Moon et al., 2004). Furthermore, cell transfer experiments in RAG2/ mice demonstrated that B-1 cell survival and homeostatic proliferation are impaired in the absence of IL-5Ra. Serum levels of IgM, IgA, and IgE are increased in IL-5 transgenic mice (Tominaga et al., 1991), while IgM and IgG3 in the IL-5Ra/ mice are about half and one-third, respectively, of those in age-matched wild-type littermates (Yoshida et al., 1996). These results illuminate important roles of IL-5 and IL-5R system in the early development of B-1 cells, the homeostatic proliferation and survival of mature B-1 cells in the peritoneal cavity. However, B cellspecific deletion of protein-tyrosine phosphatase SHP1 promotes B-1a cell development and causes systemic autoimmunity (Pao et al., 2007). Oct-2 and Lck seem to be also important in the B-1 cell development and function (France´s et al., 2005; Humbert and Corcoran, 1997). We should emphasize that IL-5 is not essential for and other signals are also involved in the B-1 cell development and activation. B-1 cells serve as an important source of IgA-producing plasma cells at mucosal sites. Up to 40% of IgA-producing cells in the murine intestinal lamina propria (LP) arise from a pool of B-1 precursors derived from the peritoneal cavity (Kroese and Bos, 1999). The role of B-1 cells in IgA production in the gut is further supported by evidence that mice with selective B-1 cell reduction causes the decreased frequencies of IgA-producing cells in the LP and B-1-cell-derived IgA specific for commensal bacteria (Fagarasan et al., 2002; Macpherson et al., 2000), indicating that B-1 cells are an important source for IgA-producing cells in mucosal tissues. In IL-5Ra/ mice, the number of sIgAþ B-1 cells from the effector sites and IgA levels in mucosal secretions are significantly reduced (Hiroi et al., 1999). We propose the important involvement of the IL-5/IL-5R
complexes. Btk regulates transcriptional activity of both BAM11 and TF-II by interacting them through the PH domain of Btk. Btk is also able to interact with the INI1/SNF5 protein, a member of the SWI/SNF complex that remodels chromatin and activates transcription. We propose a model in which Btk regulates gene transcription in B cells by activating BAM and the SWI/SNF transcriptional complex via TFII-I activation.
IL-5 in the Link Between the Innate and Acquired Immune Response
207
system in IgA secretion in mucosal tissues for the common mucosal immune system-independent sIgAþ B-1 cell development. The vitamin A-mediated mucosal IgA response is also impaired in IL-5Ra/ mice (Nikawa et al., 2001), suggesting that IL-5 plays an important role in an action of vitamin A on mucosal IgA system. IL-5-dependent B-1 cells are involved in the IgA production in mucosal tissues. Levels of serum and fecal IgA in LPS-treated IL-5R/ mice are significantly lower than those in wild-type mice. The expression levels of TLR4/MD2 and RP105, the sensor of LPS signals on wild-type B-1 cells are comparable with on IL-5Ra/ B-1 cells, although the IL-5Ra/ B-1 cells show defective proliferation and Ig production upon LPS stimulation in vitro (Moon et al., 2004). The IL-5 stimulation of B-1 cells enhances CD40 expression and augments IgM and IgG production after stimulation with CD40L or Th cells. The IL-5-mediated signaling pathway may couple or crosstalk with the LPS-induced signaling pathway or CD40 signaling in B-1 cells. Taking all results together, we propose a simplified model for the involvement of IL-5 in homeostatic proliferation, cell survival, and differentiation of B-1 cells into ASCs and the innate B-cell response in the mucosal immune system (Fig. 6.4).
4.2. IL-5 and eosinophil function In humans, the biologic effects of IL-5 are best characterized for eosinophils. In several pathophysiological conditions, an increase in serum and tissue levels of IL-5 and eosinophil numbers have been described. IL-5 is crucial for the development and release of eosinophils from the bone marrow, prolongs eosinophil survival, increases eosinophil adhesion to endothelial cells, and enhances eosinophil effector function (Nakajima and Takatsu, 2007; Rothenberg and Hogan, 2006). The IL-5/ and IL-5Ra/ mice produced basal levels of eosinophils, while their bone marrow cells failed to form eosinophilic colonies in response to IL-5, although the IL-5/ and IL-5Ra/ mice unexpectedly have morphologically normal eosinophils (Kopf et al., 1996; Yoshida et al., 1996). Impaired eosinophilopoiesis in IL-5Ra/ mice enhances the survival of intracranial worms, Angiostrongylus cantonensis, while intracranial worms in IL-5 transgenic mice are expelled (Yoshida et al., 1996), indicating that IL-5-induced eosinophils serve as potent effector cells in the killing of intracranial worms in mice. There may be other cytokines than IL-5 for eosinophil development.
4.3. Innate immune responses influence IL-5 production It is widely believed that consequence of innate activation via TLRs is induction of an acquired immunity. TLR activation is proposed to induce expression of APCs-derived cytokines, such as IL-12, IL-23, and IL-27,
208
Kiyoshi Takatsu et al.
ab T
gdT Mast
IL-5R
ckit/CD45/IL-5Ra −
Mac1
CD40 IL-5
B-1
B-1
Homeostatic proliferation
Survival
IL-5
Activation
IL-5 Mac 1
IL-5R
B-1
IL-5
LPS IgM, IgG3, IgA
Th
pB-1
Natural antibody
FIGURE 6.4 Schematic illustration of site of actions of IL-5 in the B-1 cell development, homeostatic proliferation, survival, and triggering. IL-5 appears to be expressed not only Th2 cells and mast cells, but also nonhematopoietic cells in various tissues.
which promote the differentiation of Th1 cells and inhibit the differentiation of Th2 cells, which is preferentially produce IL-4, IL-5, and IL-13. Although there has been little evidence to suggest that TLRs can regulate Th2 type immune responses including IL-5 production, several reports suggest that Th2 development may be instructed by TLR stimulation. Stimulation of mast cells by LPS induces significant amount of IL-5 and IL-13 via MAPK pathway (Masuda et al., 2002). Eosinophil-derived neurotoxin, a member of the RNase A superfamily, activates DCs via TLR2 pathway and enhances the production of IL-5, IL-6, IL-10, and IL-13 (Yang et al., 2008). Since mast cells and eosinophils are major players in the development of allergic inflammation such as asthma, these results indicate a clue to understanding the mechanisms how bacterial infection occasionally worsens allergic inflammation.
5. IL-5 MODULATES ACQUIRED IMMUNE RESPONSE 5.1. IL-5 enhances differentiation of B-2 cells into AFC Signaling through CD40 in combination with Th cell-derived cytokines enhances B-2 cell proliferation and differentiation accompanied with CSR to the generation of ASCs. In mice, ASCs formed in vivo can be identified by
IL-5 in the Link Between the Innate and Acquired Immune Response
209
their high expression of syndecan-1 (CD138) in conjunction with low B220. Syndecan-1þ cells display a gene expression profile of plasma cells, with increased expression of the J chain, B lymphocyte-induced maturation protein 1 (Blimp-1) and X-box-binding protein 1 (Xbp-1), while the expression of AID, B cell lymphoma 6 (Bcl-6), and Pax5 are decreased (Allman et al., 1996; Busslinger, 2007; Iwakoshi et al., 2003; Shaffer et al., 2002). IL-5 induces the maturation of activated B-2 cells into IgM-, IgG-, and IgA-producing ASC. Intriguingly, IL-5 acts on sIgAþ B-2 cells, but not on sIgA B cells in Peyer’s patches and to a lesser extent in the spleen to induce IgA production (Matsumoto et al., 1989; Sonoda et al., 1989). As IL-5 induces neither the expression of germ-line Ca transcripts nor the formation of IgA-specific switch circular DNA, it becomes clear that IL-5 is not a class switching factor for IgA and acts on the B cells committed to become IgA-secreting cells for terminal differentiation.IL-5 enhances IgA production by LPS-stimulated murine B cells with TGF-b that induces CSR from Cm to Ca.
5.2. IL-5 and class switch recombination Naive B cells undergo CSR and develop into ASC to generate the appropriate class and amount of antibody necessary for effective immunity. CSR in B cells is an important process for generation of functional diversity of the humoral immune response (Stavnetzer et al., 2008). CSR results in replacement of the Cm heavy chain constant region with other CH sequences in activated B cells. Cytokines and mitogens are able to rapidly and selectively upregulate steady-state levels of specific germline CH RNA. CSR to the expression of a particular CH gene isotype is preceded by transcriptional activity at the respective Ig gene locus (Gu et al., 1993; Jung et al., 1993; Lutzker et al., 1988; Rothman et al., 1988, 1990; Stavnetzer, 1996). This hypothesis, known as the accessibility model (Sanpper et al., 1997; Stavnetzer-Norgren and Sirlin, 1986; Yancopoulos et al., 1986), is based on extensive study of the activity of cytokines such as IL-4 (Esser and Radbruch, 1989; Lutzker et al., 1988; Noma et al., 1986; Rothman et al., 1988; Severinson et al., 1990), IFN-g (Coffman et al., 1989a, Snapper et al., 1988, 1992), and TGF-b (Coffman et al., 1989b; Islam et al., 1991; Sonoda et al., 1989). These cytokines are able to rapidly and selectively upregulate steady-state levels of specific germline CH RNA. The mode of B cell activation, whether T-independent, as invoked by LPS, or T-dependent after exposure to intact T cells or CD40L, also affects the outcome of cytokine stimulation with respect to the efficiency and direction of CSR. CSR involves breakage and subsequent repair of two DNA sequences, known as switch (S) regions. CSR between Sm and another S region 50 to a CH sequence is mediated by a DNA recombination event that moves the VDJ-segments to a new position upstream of the isotype being expressed
210
Kiyoshi Takatsu et al.
(Harriman et al., 1993; Honjo and Kataoka, 1987; Stavnetzer et al., 2008). It includes looping out and deletion of all CH genes except for the one being expressed. The deleted DNA forms circular structures termed ‘‘switch circles’’ that contain reciprocal recombination products consisting of the 30 section of an S region joined to the 50 section of the S region of the new isotype (Iwasato et al., 1990; Jung et al., 1993; Matsuoka et al., 1990; von Schwedler et al., 1990; Zhang et al., 1994). The involvement of AID that attacks DNA directly or indirectly through RNA editing has been demonstrated in the regulation or catalysis of the DNA modification step of CSR (Honjo, 2008; Muramatsu et al., 1999, 2000, 2007; Revy et al., 2000). It is demonstrated the involvement of several proteins besides AID such as Bach2, uracil-DNA glycosylase (UNG), and 53BP1 in CSR (Manis et al., 2004; Muto et al., 2004; Petersen-Mahrt et al., 2002; Rada et al., 2002). CSR-associated breaks require the nonhomologous end-joining (NHEJ) DNA repair pathway in which several proteins including DNAdependent protein kinase catalytic subunit (DNA–PKcs) are required for DNA double strand break repair (Manis et al., 2002; Rolink et al., 1996; Wuerfell et al., 1997). Besides DNA––PKcs, gene products of Ku70 and Ku80 that forms a DNA end-binding complex, DNA ligase IV, and DNArepair protein XRCC4 are also required for the completion of CSR (Blunt et al., 1995; Casellas et al., 1998; Manis et al., 1998; Rathwell and Chu, 1994; Yan et al., 2007; Zelazowsky et al., 1997). IL-5 can elicit the maturation of CD40-activated B cells to IgM- and IgG1-secreting cells and IgG1 production in LPS-activated B cells (Mizoguchi et al., 1999). It was reported that IL-5 provides a signal that is required in addition to IL-4 for CSR to IG1 and IgE (Mandler et al., 1993; Purkerson and Isakson, 1992). However, it has remained elusive whether IL-5 itself has ability to induce m to g1 CSR in B-2 cells. To get more definitive evidence for CSR-inducing ability of IL-5, we established the system for analyzing CSR by culturing CD38-activated mouse B-2 cells with various cytokines. The agonistic anti-CD38 mAb (aCD38) stimulation of mouse splenic B-2 cells induces potent proliferation and moderate IgM production, while it does not induce detectable level of IgG1 production. IL-5 enhances proliferation of and production of high levels of IgG1 by aCD38-stimulated B cells (Mizoguchi et al., 1999; Moon et al., 2001). The B cells stimulated with other cytokines such as IL-4, GM–CSF, IFN-g, and TGF-b do not produce detectable levels of IgG1 or other Ig isotypes. Both Stat5a/ and Stat5b/ B cells produced a very low level of IgM and IgG1 upon stimulation with CD38 plus IL-5. In contrast, IgM and IgG1 production in response to LPS stimulation is similar to that produced by the wild-type B cells (Horikawa et al., 2001). Importantly, Stat6/ B cells respond to CD38 plus IL-5 stimulation and produce IgG1 to an extent similar to wild-type B cells, indicating no involvement
IL-5 in the Link Between the Innate and Acquired Immune Response
211
of IL-4. IL-5-dependent m-g1 CSR and IgG1 production are not observed in splenic B cells from p50/ mice, c-Rel/ mouse or Btk-deficient mouse. As discussed in the previous section, CSR from IgM to IgG1 requires B-cell proliferation, g1 germline expression, a m to g1 DNA recombination, and DNA repair. Stimulation of B cells with aCD38 induces the significant expression of germline g1 transcripts, the activation of NF-kB/Rel proteins including c-Rel, p65, and p50 and enhanced IL-5Ra expression (Harriman et al., 2001; Kaku et al., 2002; Kikuchi et al., 1995; Mizoguchi et al., 1999). The activation of NF-kB member proteins in the CD38-ligated B-2 cells is essential for the induction of germline g1 transcripts, because both p50/ B cells and c-Rel/ B cells express little germline g1 transcripts by aCD38 stimulation (Kaku et al., 2002). IL-5 stimulation enhances cell cycle progression of CD38-activated B-2 cells to five and six division cycles. To analyze CSR frequencies, we applied systems for detecting frequencies of CSR events regardless of subsequent proliferation, by amplifying deleted g1-m circular DNA fragments containing reciprocal junctions (Mizoguchi et al., 1999). We found the enhanced frequencies of m to g1 CSR only when the aCD38-activated B-2 cells are stimulated with IL-5 (Fig. 6.5A and B). As IL-4 stimulation does not induce m to g1 CSR at all in aCD38-stimulated B-2, we conclude that IL-5 is able to induce m to g1 DNA CSR in CD38-activated B cells in an IL-4 independent manner. IL-5 also induces m to g1 CSR and IgG1 production in activated B-2 cells activated with aCD40 or aBCR. The quantity of g1-m switch circle is not detected in Stat5a/ and Stat5b/ B cells upon stimulation with aCD38 plus IL-5. IL-5-dependent m-g1 CSR and IgG1 production are not observed in splenic B cells from p50/ mouse, c-Rel/ mouse, or Btk-mutant mouse (Kaku et al., 2002). The frequency of CSR of B cells with five and six division cycles is as much as 20 times higher than that of nondivided cells (Hasbold et al., 1998, 2004). As we reported, the m to g1 CSR is detectable in B-2 cells after four divisions of cell cycle, and peaks following six to seven division cycles (Horikawa et al., 2001, 2006). The B cells from Stat5b/ mice showed similar cell division cycles, but switching to IgG1 is virtually undetectable even after six cell division cycles. As IL-5 stimulation induces activation of STAT5, we conclude that both Stat5a and Stat5b are essential for IL-5dependent m-g1 CSR and IgG1 secretion. IL-5 by itself does not induce expression of germline g1 transcripts. These extend the understanding of CSR beyond the ‘‘accessibility’’ model (Snapper et al., 1997). We propose molecular basis of IL-5-induced CSR that a simply illustrated in Fig. 6.6. IL-5 stimulation induces the gene expression of AID, UNG, Bach2, and 53BP1 (Tsukamoto et al., 2005) that are involved in CSR. IL-5 activates Ku70, Ku80, and DNA-PKcs that are essential for DNA repair (data not shown). Genes induced by IL-5 have been extensively studies in various types of cell line, including c-Myc, c-Fos, c-Jun (Takaki et al., 1994), Cis
212
Kiyoshi Takatsu et al.
A
Stat5a+/+
Stat5a–/–
Stat5b+/+
Stat5b–/–
aCD38 aCD38 + IL-5 + IL-5 + IL-5 + IL-5 + IL-4 + IL-4
1 2 3 4 5 6 7 8 9 10 11 12
1 2 3 4 5 6 7 8 9 10 11 12
C Preculture
kb
B
aCD38 aCD38 + IL-5 + IL-5 + IL-5 + IL-5 + IL-4 + IL-4
aCD40 aCD38 + IL-4
aCD38 + 0.1 mM 8sGuo
aCD38 aCD38 + + 1 mM IL-4 8sGuo
aCD38 + IL-4 + 0.1 mM 8sGuo
aCD38 + IL-4 + 1 mM 8sGuo
IL-4 + 1 mM 8sGuo
23.1 9.4 6.6 4.3 2.3 2.0
FIGURE 6.5 Induction of m to g1 CSR in B cells activated with aCD38 and IL-5 from Stat5a/ mouse (A) or Stat5b/ mouse (B). Splenic B cells were stimulated with aCD38 and IL-5 for 3 days. After the culture, DNA prepared from the cells were amplified using 50 Sg1 and 30 Sm primers and LA–Taq polymerase, and hybridized with a 50 Sg1 probe. (C) Induction of m to g1 CSR in B cells activated with aCD38, IL-4, and 8-SGuo. Splenic B cells were cultured in the presence of aCD38 or aCD38 and IL-4, aCD38 and 8-SGuo, or aCD38, IL-4, and 8-SGuo for 3 days.
(Bhattacharya et al., 2001), Gish/Jab (Zahn et al., 2000), and pim-1 (Sato et al., 1993; Temple et al., 2001). Although the results of microarray analysis of IL-5-induced genes in eosinophils have been reported (Bystrom et al., 2004; Temple et al., 2001), there are no available data on target IL-5 target genes in primary B cell. We applied cDNA microarray technology to investigate the molecular basis for IL-5-dependent B-cell maturation and IL-5-induced m-g1 CSR. (Horikawa and Takatsu, 2006). As IL-4 does not induce m-g1 CSR or IgG1 secretion in aCD38-activated B-2 cell, we also carried out cDNA microarray analysis using the B cells stimulated with aCD38 plus IL-4. We found numerous IL-5-inducible gene genes, many of which have been previously described to be regulated by IL-5, such as those encoding IL-2Ra, cyclibn D2, Cis, Gish1, Gish2/Socs2, Pim-1, Blimp-1
IL-5 in the Link Between the Innate and Acquired Immune Response
213
IgM production
IL-5 XBP-1 Blimp-1 aBCR aCD38 aCD40
B-2
IL-5 NF-kB Oct-2 Btk PI3-K PLC-g 2 Fyn/Lyn
IL-5 B-2 Activation Sterile g 1 IL-5Ra
B-2 2
Btk STAT5a
IL-5
IL-5 AID Bcl6 UNG, 53BP1 STAT5b
B-2
Blimp-1 XBP-1
Ku70/80 DNA-PKcs Growth Cell fate decision
Survival m to g 1 CSR
B-2
IgG1 production
Survival Memory?
FIGURE 6.6 Schematic illustration of molecules involved in IL-5-induced CSR of m to g1 CSR and IgG1 production by aCD38-activated B-2 cells.
(Prdm1), and so on. Genes exclusively regulated by IL-5 include Ig-related genes such as J chain and Igk, and genes involved in B cell maturation such as BCL6, Aid (Aicda), and Blimp-1 (Fig. 6.7). These genes are deeply involved in IL-5-dependent B-cell terminal regulation. The BCL6 mRNA levels declined within hours of IL-5 addition, and the Blimp-1 and Aid expression is upregulated from 24 h after the IL-5 stimulation. Significant levels of the J chain and g1-m reciprocal circular DNA expression are detectable around 48 h after IL-5 stimulation (Horikawa et al., 2006) (Fig. 6.8). Retroviral induction of Blimp-1 and Aid in CD38-activated B cells could induce IL-4-dependent maturation to Syndecan-1-expressing plasma cells and m-g1 CSR, respectively, in CD38-activated B cells. Results suggest that coordinated expression of Blimp-1 and Aid genes can be induced with B-cell maturation to Ig-secreting cells and m to g1 CSR, respectively. IL-4 has multiple enhancing effects on CD40L-stimulated B cells, increasing proliferation, survival, switching rate, and the frequency of AFC development per division. IL-5, in contrast, increases the frequency of AFC development per division, but does not affect the rates of survival or proliferation (Hasbold et al., 1998, 2004). IL-5 stimulation of activated B-2 cells greatly enhances IgG1 production costimulation with IL-4 (Mizoguchi et al., 1999; Tsukamoto et al., 2005). IL-5 potently increases Blimp-1 expression that leads to enhance terminal differentiation of switched B-2 cells and increase immunoglobulin secretion solely by enhancing the rate of ASC commitment per division round. The IL-4dependent augmentation of IgG1 production in combination with IL-5 is
214
Kiyoshi Takatsu et al.
Genes induced IL-4
340
IL-5
78
211
Immunoglobulin Class switch Cell cycle Receptor Transcription factor Signaling chemokine Metabolism
Transporter Miscellaneous
J chain, k light chain AID Cyclin D2, Cdc20 IL-2Ra, IL-1R2, CFSRb1, Blimp-1, Zfp14, Hermes ROG, CIS, Serine/threonine kinase, pEL98 CCR10, CCL22 Asparagine synthetase, Glycerol-3-phosphate acyltransferase protein tyrosine phosphatase, non-receptor type 11 Pyruvatekinase 3 Cationic amino acid transporter, Potassium channel beta 2 subunit Solute carrier family 7 b7 integrin, Lymphotoxin A, Purkinje cell protein 4, Cysteine rich intestinal protein, Programmed cell death 2, Stromal cell-derived factor 2-like 1
Repressed genes IL-5
IL-4
222
97
228
Receptor Transcription factor Signaling Metabolism Transporter Miscellaneous
Hepatitis A virus cellular receptor 1 (TIMD1), Fc e receptor 2 BCL-6, Zfp318, Gfi1i VAV3, RelB Apolipoprotein E, Transglutaminase 2, Dipeptidyl peptidase 7, Lipoprotein lipase Solute carrier family 39 Gelsorin, IL-4 inducible gene 1, cAMP inducible gene, CD83 Complement component 1, Platelet factor 4
FIGURE 6.7 Number of genes regulated by IL-5 and/or IL-4 on CD38-stimulated B cells. IL-5 induced 289 probe sets, 78 of which were shared with the genes upregulated by IL-4. IL-5 repressed 325 probe sets, while IL-4 downregulated 319 probe sets (Horikawa et al., 2006). Representative genes upregulated by IL-5 and genes repressed by IL-5 are listed.
due to the enhancing effect on IL-5Ra expression and Blimp-1 expression (Emslie et al., 2008). IL-4 is able to partially rescue the IL-5-induced m-g1 CSR in Stat5b/ B cells, but not in Stat5a/ B cells. Stimulation of CD38-activated Stat5b/ B cells with IL-5 induces enhancement in the AID gene expression to an extent similar to wild-type B cells, while the Blimp-1 gene expression is significantly impaired (Horikawa et al., 2001). As there is a consensus DNA element for the Stat5-binding site in the 50 region of the Blimp-1 gene, the STAT5 gene deletion may be involved in the impaired Blimp-1 expression in Stat5b/ B cells. Oct2 is a well-known regulator of blimp1 transcription and IL-5 rapidly upregulates blimp1 transcription in activated B-2 cells in the absence of new protein synthesis (Emslie et al., 2008), most likely through activation and nuclear transport of Stat5. IL-4 may induce or enhance DNA repair machinery and survival of the IgG1switched Stat5b/ B cells.
5.2.1. IL-5 mimics TLR7 and IL-4 signals that are essential for CSR in CD38- and BCR-activated B cells
Although IL-4 does not induce m to g1 CSR in aCD38-activated B-2 cells, the costimulation of aCD38-activated B cells with 8-mercaptoguanosine (8-SGuo) and IL-4 induces m to a1 CSR and IgG1 production. 8-SGuo is a
IL-5 in the Link Between the Innate and Acquired Immune Response
215
C8-substituted guanosine analog and has been shown to have potent adjuvant activities. For example, the stimulation of 8-SGuo induces potent B cell activation (Goodman and Weigle, 1983, 1985) and supports CSR to IgE in anti-IgM plus IL-4-stimulated B cells (Hikida et al., 1996). The stimulation of CD38-activated B cells with 8-SGuo induces AID expression without showing m-g1 CSR and IgG1 production (Tsukamoto et al., 2005). Intriguingly, 8-SGuo by itself induces AID expression and DNA double strand breaks in CD38-activated B cells. In addition, 8-SGuo induced Blimp-1 expression in CD38-activated B cells. However, it does not induce m to g1 CSR or mounts little DNA repair. Further addition of IL-4 is required to induce m to g1 CSR and IgG1 production (Fig. 6.5C). To assess receptors for 8-SGuo, we analyzed the AID expression in CD38activated B cells from various gene-disrupted mice. Results revealed that 8-SGuo did not induce the AID expression in CD38-stimulated splenic B cells from TLR7/ and MyD88/ mice, while it induces cell cycle progression (Tsukamoto et al., 2009). Intriguingly, IL-5 could not induce m to g1 CSR and IgG1 production by the CD38-stimulated B cells from both TLR7/ and MyD88/ mice. Similar results were obtained upon stimulation with loxoribine, a well-known TLR7 ligand in activated B cells with aCD38 or aBCR. We speculate that IL-5 mimics signals provided by TLR7 and IL-4 that are involved in the DNA repair and cell survival for the completion of CSR (Fig. 6.9). This culture system should provide additional information about novel molecules required for CSR together with AID and terminal B cell maturation.
A
B
Duration of IL-5 stimulation 0
3
6
12
24
Anti-CD38 None + IL-4
48 hr
Blimp-1
Blimp-1
XBP-1
XBP-1
BCl-6
Bcl-6
AID
AID
J chain
53BP1
HPRT
UNG
m-g 1 CSR
+ IL-5
J chain HPRT
FIGURE 6.8 (A) Kinetics of expression of genes induced or repressed by IL-5. Splenic B cells were stimulated with aCD38 for 48 h and then stimulated with IL-5. Semi-quantitative RT–PCR was performed with sets of primers specific for genes induced or repressed by IL-5. (B) IL-5 stimulation induces Blimp-1 and Aid expression in aCD38-stimulated B cells.
216
Kiyoshi Takatsu et al.
Anti-CD38
IL-5 IL-5Ra
bc
CD38
TLR7 ligand
IL-4 IL-4Ra
gc
CD38
TLR7/MyD88
Stat5 Proliferation
Factor X Proliferation
Germline g1
Germline g1 AID
AID m to g1 CSR Survival signal?
Anti-CD38
DNA repair Blimp-1
IgG1-producing cells
m to g1 CSR Survival signal?
DNA repair
Blimp-1 IgG1-producing cells
FIGURE 6.9 Comparison of representative signaling pathway for IL-5-induced m to g1 CSR with that for TLR7 ligand and IL-4.
6. IL-5 LINKS INNATE AND ACQUIRED IMMUNITY IN DISEASE MODEL 6.1. Contact sensitivity model Contact sensitivity (CS) is a form of delayed-type hypersensitivity that is a classic example of in vivo T cell-mediated immunity. The skin sensitization of mice with a reactive antigen (Ag) such as a hapten induces contact sensitivity responsiveness. Subsequent challenge at a separate skin site with the immunized Ag elicits an inflammatory response in which Agspecific T cells are recruited locally and mediate Ag-specific inflammation. Askenase and his colleagues described contact sensitivity being impaired in B cell-deficient mice (Tsuji et al., 2002). They also showed that Ag-specific IgM antibody is required to recruit effector T cells to the site of inflammation. Furthermore, they demonstrated that activated CD5þ B-cells in the spleen and lymph nodes from Day-1 post-immunized mice are able to reconstitute the defective contact sensitivity response in B cell-deficient mice (Itakura et al., 2005; Tsuji et al., 2002). These results clearly indicate the involvement of CD5þ B-cells and Ag-specific IgM antibody in contact hypersensitivity. Recently, they found that CD5þ B cells involved in CS induction is not B-1 cells but distinct B cell subset whose action depends on AID (Kerfoot et al., 2008). Together with their
IL-5 in the Link Between the Innate and Acquired Immune Response
217
previous evidence, they postulated that the IgM and Ag challenge form local complexes that activate the complement, generating C5a, leading to local vascular activation to recruit the antigen-primed effector T cells that mediate the CS response. Their findings overturn widely accepted immune response paradigms. We examined the role of IL-5 in contact sensitivity by immunizing IL-5Ra/ mice with oxazolone (OX) by skin painting, followed by challenge with OX by ear painting to elicit contact sensitivity. We found that IL-5Ra/ mice showed impaired contact sensitivity to OX compared with wild-type mice regarding ear swelling, infiltration of inflammatory cells including eosinophils into the inflammatory skin site (Itakura et al., 2006). The impaired elicitation of contact sensitivity to OX in OXimmunized IL-5Ra/ mice was partially reconstituted by the transfer of lymphoid cells from OX-immunized wild-type mice. We propose a positive role of IL-5 in contact sensitivity and hypothesize that IL-5 plays role in B-cell-mediated Ag-specific IgM production and the induction of eosinophil production (Fig. 6.4).
6.2. Atherosclerotic model Atherosclerosis is a chronic inflammatory disease caused by the uptake of oxidized LDL (OxLDL) by macrophages on the artery wall, which in turn can form neo-self determinants recognized by specific innate and adaptive immune responses (Binder et al., 2002). During atherogenesis, LDL is oxidized, generating various oxidation-specific neoepitopes, such as malondialdehyde-modified (MDA-modified) LDL (MDA-LDL) or the PC headgroup of oxidized phospholipids (OxPLs). IL-5 has been detected in human atherosclerotic lesions (Scho¨nbeck et al., 2002), although it is irregularly expressed. Genetic analysis indicated that EO6, the prototypic IgM anti-OxLDL antibody, is a natural antibody secreted by innate B-1 cells possessing the germline-encoded T15 clonotype (Shaw et al., 2000). Binder and his colleagues demonstrated that MDA–LDL immunization induces not only MDA–LDL–specific Th2 cells that prominently secrete IL-5, but also an innate T cell independent B-1 response associated with the production of IL-5 leading to the increased secretion of antiphosphorylcholine T15/EO6 antibody (Binder et al., 2004). They also showed that IL-5 deficiency leads to decreased titers of T15/EO6 and accelerated atherosclerosis. Their data strongly suggest that IL-5 links acquired and innate immunity specific to the epitopes of OxLDL, providing protection from atherosclerosis, in part by stimulating the expansion of atheroprotective natural IgM specific for OxLDL. Therefore, IL-5 seems to be pivotally involved in the expansion of natural antibodies derived from B-1 cells (Binder et al., 2003; Daugherty et al., 2004).
218
Kiyoshi Takatsu et al.
6.3. IL-5 in allergy Over the past two decades, it has been suggested that eosinophils are key effector cells in asthma (Corrigan et al., 1993; Hamelmann and Gelfand, 2001; Kay, 2005; Rothenberg et al., 2006). The lack of eosinophil recruitment into the airways and airway hyperresponsiveness of antigen-sensitized IL-5/ mice or IL-5Ra/ mice upon inhaled antigen challenge further demonstrates the importance of IL-5 in eosinophil accumulation in the airways in asthma (Foster et al., 1996; Tanaka et al., 2000, 2004). Administration of a neutralizing mAb to IL-5 before antigen inhalation suppresses the airway hyperreactivity of mouse, guinea pig, and monkey models (Akutsu et al., 1995; Mauser et al., 1995), and appears to be applicable to inhibit the development of allergen provoked airway eosinophilia and hyperreactivity. Early case reports and small series of treatment of patients having disorders with eosinophilia with anti-IL-5 mAbs (mepolizumab and reslizumab (SCH557000)) showed promising results.
6.3.1. Clinical trials of anti-IL-5 mAb in bronchial asthma In asthmatic patients, eosinophil was detected in high numbers in peripheral blood, in bronchial mucosa, and in the bronchoalveolar lavage fluid after allergen challenge (Bousquet et al., 1990). In addition, IL-5 levels are elevated in the serum and the bronchoalveolarlavage fluid (Robinson et al., 1992). Moreover, increased eosinophil numbers and airway hyperresponsiveness are observed upon IL-5 inhalation by asthmatic patients (Shi et al., 1997). Therefore, we believed that IL-5 is deeply involved in the pathogenesis of asthma and is chosen as a potentially attractive target to prevent eosinophil-mediated inflammation in asthmatic patients. Leckie and coworkers have shown that although peripheral blood and sputum eosinophil numbers are significantly decreased by an administration of anti-IL-5 mAb (mepolizumab), it exhibits no significant improvement in asthma symptoms (Leckie et al., 2000). A group of patients with severe asthma were treated with another humanized antiIL-5 mAb (reslizumab). Results revealed the decreases of blood eosinophil counts and no significant improvement in either asthma symptoms or lung function (Kips et al., 2003). Significant reduction of blood eosinophil counts with no significant improvement of asthma symptoms has been confirmed by a large-scale trial of mepolizumab in patients with moderate persistent asthma (Flood-Page et al., 2007). Thus, the results with humanized anti-IL-5 mAb cast doubt on the pathogenicity of eosinophils in asthma. Since eosinophils themselves could produce IL-5 (Rothenberg and Hogan, 2006), tissue eosinophils may fail to undergo apoptosis with IL-5 deprivation because of autocrine stimulation by IL-5. Because eosinophils downregulate their IL-5R surface expression after entering the airway
IL-5 in the Link Between the Innate and Acquired Immune Response
219
lumen (Liu et al., 2002) or upon stimulation with IL-5 (Gregory et al., 2003), tissue eosinophils may lose IL-5 responsiveness and survive with IL-3 and GM-CSF. It is desirable to test a benefit of stronger intervention such as a combination of anti-IL-5 antibody and a CCR3 antagonist by which both eosinophil maturation and survival (an IL-5-dependent effect) and tissue accumulation (a CCR3-dependent effect) seem to be inhibited.
6.3.2. Clinical trials of anti-IL-5 mAb in HES Effect of anti-IL-5 treatment on HES and eosinophilic esophagitis is promising. HES comprises a heterogeneous group of disorders characterized by persistent peripheral eosinophilia for a minimum of 6 months, lack of evidence for other causes of eosinophilia, and organ damage and dysfunction associated with eosinophil infiltration (Wilkins, 2005). The lymphoproliferative subtype of HES is associated with high levels of serum IL-5, which is frequently produced by a clonal T cell (Cogan et al., 1994; Simon et al., 1999). Standard treatment of HES is limited to corticosteroids, hydroxyurea, interferon-a, and imatinib mesylate (Simon et al., 1999). In a pilot study, mepolizumab was administered to three patients with HES and eosinophilic dermatitis, resulting in a rapid relief of skin symptoms and in normalization of blood eosinophil numbers (Plo¨tz et al., 2003). The elevated IL-5 levels in the peripheral blood were normalized completely and the number of eosinophils in skin biopsy specimens was significantly decreased by mepolizumab. Anti-IL-5 therapy was effective in patients with HES who exhibited diverse manifestations involving lungs, heart, skin, and gastrointestinal tract (Garrett et al., 2004). A multicenter randomized, placebo-controlled trial of mepolizumab for the treatment of HES was undertaken. The trial confirmed the safety and efficacy of anti-IL-5 therapy for the treatment of patients with HES and provided the first example of successful therapy targeting eosinophils in eosinophil-mediated disorders (Rothenberg et al., 2008).
6.3.3. Clinical trials of anti-IL-5 mAb in eosinophilic esophagitis Eosinophilic esophagitis has largely been called idiopathic HESs, emphasizing the poor understanding of its pathogenesis. Over the past several years, an increasing number of patients with eosinophilic esophagitis were reported in adult and pediatric populations. Eosinophilic esophagitis is a severe inflammatory disease of the esophagus characterized by accumulation of eosinophils in the esophagus and epithelial hyperplasia, and is highly associated with atopic disease (Blanchard et al., 2006). A variety of treatments including oral and topical corticosteroids and leukotriene-receptor antagonists effectively improve symptoms and histology in the majority of patients with eosinophilic esophagitis (Blanchard et al., 2006). Recently, an open-label phase I/II safety and efficacy study of
220
Kiyoshi Takatsu et al.
mepolizumab in four adult patients with eosinophilic esophagitis and longstanding dysphagia and esophageal strictures was conducted (Stein et al., 2006). The study showed that mepolizumab decreased peripheral blood eosinophils and percent of CCR3þ cells. Importantly, mean and maximal esophageal eosinophilia was also significantly reduced in patients treated with mepolizumab. The improved quality of life measurements as well as better clinical outcome suggests that anti-IL-5 therapy is a promising therapeutic intervention for eosinophilic esophagitis.
6.3.4. Effect of anti-IL-5 antibody on other eosinophilic disorders Chronic rhinosinusitis with nasal polyps is characterized by an eosinophilic inflammation and high IL-5 levels. It was reported that in a doubleblind, placebo-controlled, randomized studies, 24 subjects with bilateral nasal polyps were randomized to receive a single intravenous infusion of reslizumab or placebo (Gevaert et al., 2006). Blood eosinophil numbers and concentrations of eosinophil cationic protein were reduced up to 8 weeks after a single injection of reslizumab. Reslizumab reduced the size of nasal polyps for 4 weeks in half of the patients. Therefore, anti-IL-5 antibody could be applicable to patients with nasal polyps if nasal IL-5 levels are increased. In a placebo-controlled trial investigating the effect of mepolizumab on atopic dermatitis, mepolizumab decreased peripheral blood eosinophil numbers, but only a moderate clinical improvement of skin symptoms and pruritus was achieved as assessed by physician’s global assessment and severity scores (Oldhoff et al., 2005). However, in accordance with the findings in asthma, anti-IL-5 antibody reduced tenascinpositive cells during the cutaneous late-phase reaction (Phipps et al., 2004). Therefore, anti-IL-5 antibody could be an approach to prevent remodeling processes in atopic dermatitis.
7. FUTURE PERSPECTIVES IL-5 has pleiotropic effects on various target cells, as do other cytokines and induces cell proliferation, survival, and differentiation. The successful generation and breeding of mice in which the genes for IL-5, IL-5Ra, or bc are disrupted indicates that none of these mutations is lethal. Furthermore, significant proportions of B-1 cells and eosinophils are detectable in neonatal IL-5 / and IL-5Ra/ mice, although those proportions are remarkably decreased. Because anti-IL-5 treatment of adult mice induces impairment of survival and homeostatic proliferation of mature B-1 cell and eosinophil, other signals than IL-5 may provide signals in place of IL-5 or in combination with IL-5. IL-5 may be a priming factor of B-1 cell and eosinophil and cooperate with other cytokines for augmenting signal
IL-5 in the Link Between the Innate and Acquired Immune Response
221
transduction beyond a critical threshold that drives cell proliferation and differentiation. It is required for further precise biochemical analysis how IL-5 and IL-5R expression is regulated in various tissues and cells at appropriate developmental stages for understanding IL-5 physiology and to line up what genes for transcription factors are involved. Stat5a and Stat5b are essential for IL-5-dependent m to g1 CSR and IgM and IgG1 production in aCD38-activated B cells, although Stat5a and Stat5b do not affect cell division number. Molecules that are induced by Stat5 are required for driving CSR machinery including AID expression and ASC differentiation in response to IL-5. IL-5 directly activates the plasma cell differentiation program by enhancing Blimp-1 expression. Oct2 augments the ability of activated B cells to differentiate to ASCs under T cell -dependent conditions through direct regulation of the gene encoding IL-5Ra, indicating that the IL-5Ra gene is a B cell-specific Oct2 target gene. IL-5 signaling directly accelerates the ASC differentiation program through increased expression of Blimp-1. As Stat5 is a major transducer of signals from the IL-5Ra, Bcl6, and Stat5 may compete as negative and positive regulators of the Blimp-1 expression. Recently, the importance of the combined influences of Blimp-1 and IRF4 during ASC differentiation is postulated (Kallis et al., 2004, 2007; Klein et al., 2006; Scimmas et al., 2006). Thus, T-cell dependent ASC differentiation in vivo may incorporate the combined effects of BCR signaling, and T cell signals through the NF-kB pathway, and cytokines such as IL-5. Once Blimp-1 and IRF4 levels reach a critical threshold, the ASC differentiation program is pursued forward (Emslie et al., 2008). This proposed model should be evaluated. Although the molecular mechanisms of IgH CSR remain unclear in many respects, 8-SGuo will be a useful tool for analyzing signals leading to IgH CSR in B cells stimulated by IL-5, IL-4 or specific Ags. The CD38activated B cells respond to 8-SGuo through TLR7 and induces the expression of AID and DNA double strand breaks without showing m to g1 CSR and igG1 production. Our preliminary data suggest that 8-SGuo stimulation does not induce the DNA repair in CD38-activated B cells that is accomplishment by additional stimulation with IL-4. Further analysis of IL-5-dependent gene expression should provide us with important additional information about the mechanisms by which IL-5 induces CSR. As it is well documented, IL-3, IL-5, and GM–CSF make up a subfamily of cytokines displaying a variety of overlapping actions during eosinophilopoiesis. These three hematopoietic factors bind to distinct specificity-determining a chain, but share the bc as a common signaltransducer; the unique distributions of the individual receptor a subunit determines which hematopoietic cells are capable of responding to each of the factors. If we speculate that there are some functional differences of IL-5 from IL-3 and GM–CSF, it should be answered how the IL-5 signals
222
Kiyoshi Takatsu et al.
are transduced differently from that of GM–CSF and IL-3. The signals generated by these cytokines may be equivalent and different functions of these cytokines may be due to the stage of development of cells expressing each receptor. Alternatively, different signal-transducing molecules, which generate a specific signal for each cytokine, might be associated with respective a subunit of each receptor. It is quite surprising anti-IL5mAb treatment of patients with hyper eosinophilic syndrome or asthma remarkably decreases eosinophil numbers in serum. There may be at least two eosinophil subsets, in which tissue distribution and growth factor requirement are different. One of eosinophil subset is over produced in allergic inflammation in an exclusively IL-5 dependent manner, and the other one does not require IL-5 for growth. If in such a case a potential of humanized anti-human anti-hIL-5Ra mAb treatment for would be beneficial to eliminate eosinophils localized in the inflammatory tissues by antibody-dependent cell-mediated cytotoxicity (ADCC). In conclusion, the structural, functional, and clinical studies described herein provide insight into the role of IL-5 in the innate immune response and disease control and provide a strong impetus for investigating the means of IL-5 regarding linkage between natural and adaptive immunity specific to the epitope of natural ligands and exogenous antigens.
ACKNOWLEDGMENTS We thank all of the collaborators for their tremendous contribution, sharing data and helpful discussion. Our project was supported in part by a Grant-in-Aid for Scientific Research for Special Project Research, Cancer Bioscience from the Ministry of Education, Science, Sports and Culture; by Special Coordination Funds for promoting Science and Technology from the Japanese Ministry of Science and Technology; by research funds from Uehara Memorial Foundation; and by Long-term Research Initiatives from Foundation of Japan Industrial Association.
REFERENCES Adachi, T., and Alam, R. (1998). The mechanism of IL-5 signal transduction. Am. J. Physiol. 275, C623–C633. Akira, S., Uematsu, S., and Takeuchi, O. (2006). Pathogen recognition and innate immunity. Cell 124, 783–804. Akutsu, I., Kojim, T., Kariyone, A., Fukuda, T., Makino, S., and Takatsu, K. (1995). Antibody against interleukin-5 prevents antigen-induced eosinophil infiltration and bronchial hyper- reactivity in the guinea pig airways. Immunol. Lett. 4, 109–116. Alam, R., Pazdrak, K., Stafford, S., and Forsythe, P. (1995). The interleukin-5/receptor interaction activates Lyn and Jak2 tyrosine kinases and propagates signals via the RasRaf-1-MAP kinase and the Jak-STAT pathways in eosinophils. Int. Arch. Allergy Immunol. 107, 226–227. Allison, K. C., Strober, W., and Harriman, G. R. (1991). Induction of IL-5 receptors on normal B cells by cross-linking surface Ig with anti-Igdextran. J. Immunol. 146, 4197–4203.
IL-5 in the Link Between the Innate and Acquired Immune Response
223
Allman, D., Jain, A., Dent, A., Maile, R. R., Selvaggi, T., Kehry, M. R., and Staudt, L. M. (1996). BCL-6 expression during B-cell activation. Blood 87, 5257–5268. Ashizawa, Y. (2002). Transcriptional regulation of the Il-5R a chain expression of mouse B cells. Thesis, the University of Tokyo. Asquith, K. L., Ramshaw, H. S., Hansbro, P. M., Beagley, K. W., Lopez, A. F., and Foster, P. S. (2008). The IL-3/IL-5/GM-CSF common b receptor plays a pivotal role in the regulation of Th2 immunity and allergic airway inflammation. J. Immunol. 180, 1199–1206. Baltus, B., van Dijk, T. B., Caldenhoven, E., Zanders, E., Raaijmakers, J. A., Lammers, J. W., Koenderman, L., and de Groot, R. P. (1998). An AP-1 site in the promoter of the human IL-5R alpha gene is necessary for promoter activity in eosinophilic HL60 cells. FEBS Lett. 434, 251–254. Bauman, M. A., and Paul, C. C. (1992). Interleukin-5 is an autocrine growth factor for Epstein-Barr virus-transformed B lymphocytes. Blood 79, 1763–1767. Berland, R., and Wortis, H. H. (2002). Origins and functions of B-1 cells with notes on the role of CD5 Annu. Rev. Immunol. 20, 253–300. Bhattacharya, S., Stout, B. A., Bates, M. E., Bertis, P. J., and Malter, J. S. (2001). Granulocyte macrophage colony-stimulating factor and interleukin-5 activate STAT5 and induce CIS1 mRNA in human peripheral blood eosinophils. Am. J. Resp. Cell Mol. Biol. 24, 312–316. Binder, C. J. S., Horkko, A., Dewan, A., Chang, Mi-K., Kieu, E. P., Goodyear, S., Shaw, P., Palinski, W., Witztman, J. I., and Silverman, J. I. (2003). Pneumococcal vaccination decreases atherosclerotic lesion formation: Molecular mimicry between Streptococcus pneumoniae and oxidized LDL. Nat. Med. 9, 736–743. Binder, C. J., Hartvigsen, K., Chang, Mi-K., Miller, M., Broide, D., Palinski, W., Curtiss, L. K., Corrr, M., and Witztman, J. I. (2004). IL-5 links adaptive and natural immunity specific for epitopes of oxidized LDL and protects from atherosclerosis. J. Clin. Invest. 114, 427–437. Blanchard, C., Wang, N., and Rothenberg, M. E. (2006). Eosinophilic esophagitis: pathogenesis, genetics, and therapy. J. Allergy Clin. Immunol. 118, 1054–1059. Blunt, T., Finnie, N. J., Taccioli, G. E., Smith, G. C. M., Demengeot, J., Gottlieb, T. M., Mizuta, R., Varghese, A. J., Alt, F. W., Jeggo, P. A., and Jackson, S. P. (1995). Defective DNA-dependent protein kinase activity is linked to V(D)J recombination and DNA repair defects associated with the murine scid mutation. Cell 80, 813–823. Bousquet, J., Chanez, P., Lacoste, J. Y., Barneon, G., Ghavanian, N., Enander, J., Venge, P., Ahlstedt, S., Simony Lafontaine, J., Godrad, P., and Francois-Bernard, M. (1990). Eosinophilic inflammation in asthma. N. Eng. J. Med. 323, 1033–1039. Burdin, N., Van Kooten, C., Galibert, L., Abrams, J. S., Wijdenes, J., Banchereau, J., and Rousset, F. (1995). Endogenous IL-6 and IL-10 contribute to the differentiation of CD40activated human B lymphocytes. J. Immunol 154, 2533–2544. Busslinger, M. (2004). Transcriptional control of early B cell development. Annu. Rev. Immunol. 22, 55–79. Schebesta, A., McManus, S., Salvagiotto, G., Delogu, A., Busslinger, G. A., and Busslinger, M. (2007). Transcription factor Pax5 activates the chromatin of key genes involved in B cell signaling, adhesion, migration, and immune function. Immunity 27, 49–63. Bystrom, J., Wynn, T. A., Domachowske, J. B., and Rosenberg, H. F. (2004). Gene microarray analysis reveals interleukin-5-dependent transcriptional targets in mouse bone marrow. Blood 103, 868–877. Calame, K. (2006). Transcription factors that regulate memory in humoral responses. Immunol. Rev., 211 269, 279. Casellas, R., Nussenzweig, A., Wuerffel, R., Pelanda, R., Reichlin, A., Suh, H., Qin, X.-F., Besmer, E., Kenter, A., Rajewsky, K., and Nussenzweig, M. C. (1998). Ku80 is required for immunoglobulin isotype switching. EMBO J. 17, 2404–2411. Casola, S., Otipoby, K. L., Alimzhanov, M., Humme, S., Uyttersport, N., Kurok, J. L., Caroll, M. C., and Rajewsy, K. (2004). B cell receptor signal strength determines B cell fate. Nat. Immunol. 5, 317–327.
224
Kiyoshi Takatsu et al.
Coffer, P. J., Schweizer, R. C., Dubois, G. R., Maikoe, T., Lammers, J. W., and Koenderman, L. (1998). Analysis of signal transduction pathways in human eosinophils activated by chemottractants and the T-helper 2-derived cytokines interleukin-4 and interleukin-5. Blood 91, 2547–2557. Coffman, R. L., Seymour, B. W. P., Hudak, S., Jackson, J., and Rennick, D. (1989a). Antibody to interleukin-5 inhibits helminth-induced eosinophilia in mice. Science 245, 308–310. Coffman, R. L., Lebman, D. A., and Shrader, B. (1989b). Transforming growth factor b specifically enhances IgA production by lipopolysaccharide-stimulated B lymphocytes. J. Exp. Med. 170, 1039–1043. Cogan, E., Schandene´, L., Crusiaux, A., Cochaux, P., Velu, T., and Goldman, M. (1994). Clonal proliferation of type 2 helper T cells in a man with the hypereosinophilic syndrome. N. Engl. J. Med. 330, 535–538. Cohn, L., Elias, J. A., and Chupp, G. L. (2004). Asthma: Mechanisms of disease persistence and progression. Annu. Rev. Immunol. 22, 789–815. Corcoran, L. M., Karvelas, M., Nossal, G. J., Ye, Z. S., Jacks, T., and Baltimore, D. (1993). Oct-2, although not required for early B-cell development, is critical for later B-cell maturation and for postnatal survival. Genes Dev. 7, 570–582. Corrigan, C. J., Haczku, A., Gemou, E. V., Doi, S., Kikuchi, Y., Takatsu, K., Durham, S. R., and Kay, A. B. (1993). CD4 T-lymphocyte activation in asthma is accompanied by increased serum concentrations of interleukin-5. Effect of glucocorticoid therapy. Am. Rev. Respir. Dis. 147, 540–547. Daugherty, A., Rateri, D. L., and King, V. L. (2004). IL-5 links adaptive and natural immunity in reducing atherosclerotic disease. J. Clin. Invest. 114, 317–319. Desreumaux, P., Janin, A., Colombel, J. E., Prin, L., Pulmas, J., Emilie, D., Torpier, G., Capron, A., and Capron, M. (1992). Interleukin 5 messenger RNA expression by eosinophils in the intestinal mucosa of patients with coeliac disease. J. Exp. Med. 175, 293–296. Dudley, D. D., Chaudhuri, J., Bassing, C. H., and Alt, F. W. (2004). Mechanism and Control of V(D)J Recombination versus class switch recombination: Similarities and differences. Adv. Immunol. 86, 43–11. Eisenbarth, S. C., Colegio, O. R., O’Connor, W., Jr., Sutterwale, F. S., and Flavell, R. A. (2008). Crucial role for the Nalp3 inflammasome in the immunostimulatory properties of aluminium adjuvants. Nature 453, 1122–1126. Emslie, D., D’Costa, K., Hasbold, J., Metcalf, D., Takatsu, K., Hodgkin, P. O., and Corcoran, L. M. (2008). Oct2 enhances antibody secreting cell differentiation through regulation of IL-5 receptor alpha chain expression on activated B cell. J. Exp. Med. 205, 409–421. Esser, C., and Radbruch, A. (1989). Rapid induction of transcription of unrearranged Sg1 switch regions in activated murine B cells by interleukin-4. EMBO J. 8, 483–488. Fagarasan, S. (2008). Evolution, development, mechanism and function of IgA in the gut. Curr. Opin. Immunol. 20, 170–177. Fagarasan, S., Watanabe, N., and Honjo, T., S. (2000). Generation, expansion, migration and activation of mouse B1 cells. Immunol. Rev. 176, 205–215. Fagarasan, S., Kinoshita, K., Muramatsu, M., Ikuta, K., and Honjo, T. (2001). In situ class switching and differentiation to IgA-producing cells in the gut lamina propria. Nature 413, 639–643. Fagarasan, S., Muramatsu, M., Suzuki, K., Nagaoka, H., Hiai, H., and Honjo, T. (2002). Critical roles of activation-induced cytidine deaminase (AID) in the homeostasis of gut flora. Science 298, 1424–1427. Flood-Page, P., Swenson, C., Faiferman, I., Matthews, J., Williams, M., Brannick, L., Robinson, D., Wenzel, S., Busse, W., Hansel, T. T., and Barnes, N. C.International Mepolizumab Study Group (2007). A study to evaluate safety and efficacy of mepolizumab in patients with moderate persistent asthma. Am. J. Respir. Crit. Care Med. 176, 1062–1071.
IL-5 in the Link Between the Innate and Acquired Immune Response
225
Foster, P. S., Hogan, S. P., Ramsay, A. J., Matthaei, K. I., and Young, I. G. (1996). Interleukin 5 deficiency abolishes eosinophilia, airways hyperreactivity, and lung damage in a mouse asthma model. J. Exp. Med. 183, 195–201. France´s, R., Tumang, J. R., and Rothstein, T. L. (2005). B-1 cells are deficient in Lck: Defective B cell receptor signal transduction in B-1 cells occurs in the absence of elevated Lck expression. J. Immunol. 175, 27–31. Galli, S. J., Tsai, M., and Piliponsky, A. M. (2008). The development of allergic inflammation. Nature 454, 445–454. Garrett, J. K., Jameson, S. C., Thomson, B., Collins, M. H., Wagoner, L. E., Freese, D. K., Beck, L. A., Boyce, J. A., Filipovich, A. H., Villanueva, J. M., Sutton, S. A., Assa’ad, A. H., et al. (2004). Anti-interleukin-5 (mepolizumab) therapy for hypereosinophilic syndromes. J. Allergy. Clin. Immunol. 113, 115–119. Gevaert, P., Lang-Loidolt, D., Lackner, A., Stammberger, H., Staudinger, H., Van Zele, T., Holtappels, G., Tavernier, J., van Cauwenberge, P., and Bachert, C. (2006). Nasal IL-5 levels determine the response to anti-IL-5 treatment in patients with nasal polyps. J. Allergy Clin. Immunol. 118, 1133–1141. Goodman, M. G., and Weigle, W. O. (1983). T cell-replacing activity of C8-derivatized guanine ribonucleosides. J. Immunol. 130, 2580–2585. Goodman, M. G., and Weigle, W. O. (1985). Enhancement of the human antibody response by C8-substituted guanine ribonucleosides in synergy with interleukin 2. J. Immunol. 135, 3284–3288. Gregory, B., Kirchem, A., Phipps, S., Gevaert, P., Pridgeon, C., Rankin, S. M., and Robinson, D. S. (2003). Differential regulation of human eosinophil IL-3, IL-5, and GMCSF receptor a-chain expression by cytokines: IL-3, IL-5, and GM-CSF down-regulate IL-5 receptor a expression with loss of IL-5 responsiveness, but up-regulate IL-3 receptor a expression. J. Immunol. 170, 5359–5366. Gu, H., Zou, Y. R., and Rajewsky, K. (1993). Independent control of immunoglobulin switch recombination at individual switch regions evidenced through Cre-loxP-mediated gene targeting. Cell 73, 1155–1164. Hall, D. J., Cui, J., Bates, M. E., Stout, B. A., Koenderman, L., Coffer, P. J., and Bertics, P. J. (2001). Transduction of a dominant-negative H-Ras into human eosinophils attenuates extracellular signal-regulated kinase activation and interleukin-5-mediated cell viability. Blood 98, 2014–2021. Hamelmann, E., and Gelfand, E. W. (2001). IL-5-induced airway eosinophilia-the key to asthma? Immunol. Rev. 179, 182–191. Harada, N., Takahashi, T., Matsumoto, M., Kinashi, T., Kikuchi, Y., Koyama, N., Severinson, E., Yaoita, Y., Honjo, T., Yamaguchi, N., Tominaga, A., and Takatsu, K. (1987). Production of a monoclonal antibody useful in the molecular characterization of murine T-cell-replacing factor/B-cell growth factor II. Proc. Natl. Acad. Sci., USA 84, 4581–4585. Hardy, R. R., and Hayakawa, K. (2001). B cell developmental pathway. Annu. Rev. Immunol. 19, 595–621. Harriman, W., Volk, H., Defranoux, N., and Wabl, M. (1993). Immunoglobulin class switch recombination. Annu. Rev. Immunol. 11, 361–384. Hasbold, J., Lyons, A. B., Kehry, M. R., and Hodgkin, P. D. (1998). Cell division number regulates IgG1 and IgE switching of B cells following stimulation by CD40 ligand and IL-4. Eur. J. Immunol. 28, 1040–1051. Hasbold, J., Corcoran, L. M., Tarlinton, D. M., Tangye, S. G., and Hodgkin, P. D. (2004). Evidence from the generation of immunoglobulin G-secreting cells that stochastic mechanisms regulate lymphocyte differentiation. Nat. Immunol. 5, 55–63. Haas, K. M., Poe, J. C., Steeber, D. A., and Tedder, T. F. (2005). B-1a and B-1b cells. Immunity 23, 7–18. Hayakawa, K., and Hardy, K. (1988). Normal, autoimmune, and malignant CD5+ B cells: The Ly-1 B lineage. Annu. Rev. Immunol. 6, 197–218.
226
Kiyoshi Takatsu et al.
Herzenberg, L. A. (2000). B-1 cells: The lineage question revisited. Immunol Rev. 175, 9–22. Herzenberg, L. A., Stall, A. M., Lalor, P. A., et al. (1986). The Ly-1 B cell lineage. Immunol. Rev. 93, 81–102. Hikida, M., Takai, T., and Ohmori, H. (1996). Requirements of a costimulus for IL-4-induced IgE class switching in murine B cells activated via antigen receptors: effectiveness of 8-mercaptoguanosine. J. Immunol. 156, 2730–2736. Hirano, M., Kikuchi, Y., Nisitani, S., Yamaguchi, A., Sato, A., Ito, T., Iba, H., and Takatsu, K. (2004). Bruton’s tyrosine kinase (Btk) enhances transcriptional co-activation activity of BAM11, a Btk-associated molecule of a subunit of SWI/SNF complexes. Int. Immunol. 16, 747–757. Hiroi, T., Yanagida, M., Iijima, H., Iwatani, K., Yoshida, T., Takatsu, K., and Kiyono, H. (1999). Deficiency of IL-5 receptor alpha-chain selectively influences the development of the common mucosal immune system independent IgAproducing B-1 cell in mucosaassociated tissues. J. Immunol. 162, 821–828. Hitoshi, Y., Yamaguchi, N., Mita, S., Takaki, S., Tominaga, A., and Takatsu, K. (1990). Distribution of IL-5 receptor-positive B cells. Expression of IL-5 receptor on Ly-1(CD5)+ B cells. J. Immunol. 144, 4218–4225. Hitoshi, Y., Yamaguchi, N., Korenaga, M., Mita, M., Tominaga, A., and Takatsu, K. (1991). In vivo administration of antibody to murine IL-5 receptor inhibits eosinophilia of IL-5 transgenic mice. Int. Immunol. 3, 135–139. Hitoshi, Y., Sonoda, E., Kikuchi, Y., Yonehara, S., Nakauchi, H., Tominaga, A., and Takatsu, K. (1993). Interleukin-5 receptor positive B cells, but not eosinophils are functionally and numerically influenced in the mice carried with X-linked immunodeficiency. Int. Immunol. 5, 1183–1190. Honda, K., Yanai, H., Negishi, H., Asagiri, M., Sato, M., Mizutani, T., Shimada, N., Ohba, Y., Takaoka, N., and Taniguchi, T. (2005). IRF-7 is the master regulator of type-I interferondependent immune responses. Nature 434, 772–777. Honjo, T. (2008). A memoir of AID, which engraves antibody memory on DNA. Nat. Immunol. 9, 335–337. Honjo, T., and Kataoka, T. (1978). Organization of immunoglobulin heavy chain genes and allelic deletion model. Proc. Natl. Acad. Sci. USA 75, 2140–2144. Horikawa, K., Kaku, H., Nakajima, H., Davey, H. W., Hennighausen, L., Iwamoto, I., Yasue, T., Kariyone, A., and Takatsu, K. (2001). Essential role of Stat5 for IL-5-dependent IgH switch recombination in mouse B cells. J. Immunol. 167, 5018–5026. Horikawa, K., and Takatsu, K. (2006). Interleukin-5 regulates genes involved in B cell terminal maturation. Immunology 118, 497–508. Hornung, V., BauernFeind, F., Halle, A., Samstadt, E. O., Kono, H., Rock, K. I., Fitzgerald, K. A., and Latz, E. (2008). Silica crystals and aluminum salts activate the NALP3 inflammasome through phagosomal destabilization. Nat. Immunol. 9, 847–856. Humbert, P. O., and Corcoran, L. M. (1997). oct-2 gene disruption eliminates the peritoneal B1 lymphocyte lineage and attenuates B-2 cell maturation and function. J. Immunol. 159, 5273–5284. Imamura, F., Takaki, S., Akagi, K., Ando, M., Yamamura, K.-I., Takatsu, K., and Tominaga, A. (1994). The murine interleukin-5 receptor alpha-subunit gene: Characterization of the gene structure and chromosome mapping. DNA Cell Biol. 13, 283–292. Inohara, N., Chamaillard, M., McDonald, C., and Munez, G. (2005). NOD-LRR PROTEINS: Role in host-microbial interactions and inflammatory disease. Annu. Rev. Biochem. 74, 355–383. Inoue, H., Kato, R., Fukuyama, S., Nonami, A., Taniguchi, K., Matsumoto, K., Nakano, T., Tsuda, M., Matsumura, M., Kubo, M., Ishikawa, F., Moon, B.-G., et al. (2005). Spred-1 negatively regulates allergen-induced airway eosinophilia and hyperresponsiveness. J. Exp. Med. 201, 73–82.
IL-5 in the Link Between the Innate and Acquired Immune Response
227
Islam, K. B., Nilsson, L., Sideras, P., Hammarstrom, L., and Smith, C. I. E. (1991). TGF-b1 induces germ-line transcripts of both lgA subclasses in human B Lymphocytes. Int. Immunol. 3, 1099–1106. Itakura, A. M., Szczepanik, M., Campos, R. A., Paliwal, V., Majewska, M., Matsuda, H., Takatsu, K., and Askenase, P. W. (2005). An hour after immunization peritoneal B-1 cells are activated to migrate to lymphoid organs where within 1 day they produce IgM antibodies that initiate elicitation of contact sensitivity. J. Immunol. 175, 7170–7178. Itakura, A., Kikuchi, Y., Kouro, T., Ikutani, M., Takaki, S., Askenase, P. W., and Takatsu, K. (2006). Interleukin 5 plays an essential role in elicitation of contact sensitivity through dual effects on eosinophils and B-1 cells. Int. Arch. Allergy Immunol. 140(Suppl. 1), 8–16. Iwakoshi, N. N., Lee, A. H., Vallabhajosyula, P., Otipoby, K. L., Rajewsky, K., and Glimcher, L. H. (2003). Plasma cell differentiation and the unfolded protein response intersect at the transcription factor XBP-1. Nat. Immunol. 4, 321–329. Iwama, A., Pan, J., Zhang, P., Reith, W., Mach, B., Tenen, D. G., and Sun, Z. (1999). Dimeric RFX proteins contribute to the activity and lineage specificity of the interleukin-5 receptor alpha promoter through activation and repression domains. Mol. Cell. Biol. 19, 3940–3950. Iwasaki, H., Mizuno, S., Mayfield, R., Shigematsu, H., Arinobu, Y., Seed, B., Gurish, M. F., Takatsu, K., and Akashi, K. (2005). Identification of eosinophil lineage-committed progenitors in the murine bone marrow. J. Exp. Med. 201, 1891–1897. Iwasaki, H., Mizuno, S., Arinobu, Y., Shigematsu, H., Takatsu, K., Tenen, T. G., and Akashi, K. (2006). The order of expression of transcription factors directs hierarchical specification of hematopoietic lineages. Genes. Dev. 20, 3010–3021. Iwasato, T., Shimizu, A., Honjo, T., and Yamagishi, H. (1990). Circular DNA is excised by immunoglobulin class switch recombination. Cell 62, 135–142. Janeway, C. A., Jr., and Medzhitov, R. (2002). Innate immune recognition. Annu. Rev. Immunol. 20, 197–216. Jung, S., Rajewsky, K., and Radbruch, A. (1993). Shutdown of class switch recombination by deletion of a switch region control element. Science 259, 984–987. Kagami, S., Nakajima, H., Kumano, K., Suzuki, K., Suto, A., Imada, K., Davey, H. W., Saito, Y., Takatsu, K., Leonard, W. J., and Iwamoto, I. (2000). Both Stat5a and Stat5b are required for antigen-induced eosinophil and T-cell recruitment into the tissue. Blood 95, 1370–1377. Kaisho, T. (2008). Type I interferon production by nucleic acid-stimulated dendritic cells. Front. Biosci. 13, 6034–6042. Kaku, H., Horikawa, K., Obata, Y., Kato, I., Okamoto, H., Sakaguchi, N., Gerondakis, S., and Takatsu, K. (2002). NF-kB is required for CD38-mediated induction of Cg1 germline transcripts in murine B lymphocytes. Int. Immunol. 14, 1055–1064. Kallies, A., Hasbold, J., Tarlinton, D. M., Dietrich, W., Corcoran, L. M., Hodgkin, P. D., and Nutt, S. L. (2004). Plasma cell ontogeny defined by quantitative changes in blimp-1 expression. J. Exp. Med. 200, 967–977. Kallies, A., Hasbold, J., Fairfax, K., Pridans, C., Emslie, D., McKenzie, B. S., Lew, A. M., Corcoran, L. M., Hodgkin, P. D., Tarlinton, D. M., and Nutt, S. L. (2007). Initiation of plasma-cell diff erentiation is independent of the transcription factor Blimp-1. Immunity 26, 555–566. Kantor, A. B., and Herzenberg, L. A. (1993). Origin of murine B cell lineages. Annu. Rev. Immunol. 11, 501–538. Katoh, S., Tominaga, A., Migita, M., Kudo, A., and Takatsu, K. (1990). Conversion of Ly-1positive B-lineage cells into Ly-1-positive macrophages in long-term bone marrow cultures. Dev. Immunol. 1, 113–125. Katoh, S., Bendig, M. M., Kanai, Y., Schultz, L. D., Hitoshi, Y., Takatsu, K., and Tominaga, A. (1993). Maintenance of CD5+ B cells at an early developmental stage by interleukin-5: Evidence from immunoglobulin gene usage in interleukin-5 transgenic mice. DNA Cell. Biol. 12, 481–491.
228
Kiyoshi Takatsu et al.
Kay, A. B. (2001). Allergy and allergic diseases. First of two parts. N. Eng. J. Med. 344, 30–37. Kay, A. B. (2005). The role of eosinophils in the pathogenesis of asthma. Trends Mol. Med. 11, 148–152. Kerfoot, S. M., Szczepanik, M., Tung, J. W., and Askenase, P. W. (2008). Identification of initiator B cells, a novel subset of activation-induced deaminase-dependent B-1-like cells that mediate initiation of contact sensitivity. J Immunol. 181, 1717–1727. Khan, W. N., Alt, F. W., Gerstein, R. M., Malynn, B. A., Larsson, I., Rathbun, G., Davidson, L., Muller, S., Kantor, A. B., Herzenberg, L. A., Rosen, F. S., and Sideras, P. (1995). Defective B cell development and function in Btk-deficient mice. Immunity 3, 283–299. Kikuchi, Y., Yasue, T., Miyake, K., Kimoto, M., and Takatsu, K. (1995). CD38 ligation induces tyrosine phosphorylation of Bruton tyrosine kinase and enhanced expression of interleukin 5-receptor alpha chain: synergistic effects with interleukin 5. Proc. Natl. Acad. Sci. USA 92, 11814–11818. Kikuchi, Y., Hirano, M., Seto, M., and Takatsu, K. (2000). Identification and characterization of a molecule, BAM11, that associates with the pleckstrin homology-domain of mouse Btk. Int. Immunol. 12, 1397–1408. Kinashi, T., Harada, N., Severinson, E., Tanabe, T., Sideras, P., Konishi, M., Azuma, C., Tominaga, A., Bergstedt-Lindqvist, S., Takahashi, M., Matsuda, F., Yaoita, Y., et al. (1986). Cloning of complementary DNA encoding T-cell replacing factor and identity with Bcell growth factor II. Nature 324, 70–73. Kinoshita, K., and Honjo, T. (2001). Linking class-switch recombination with somatic hypermutation. Nat. Rev. Mol. Cell. Biol. 2, 493–503. Kips, J. C., O’Connor, B. J., Langley, S. J., Woodcock, A., Kerstjens, H. A., Postma, D. S., Danzig, M., Cuss, F., and Pauwels, R. A. (2003). Effect of SCH55700, a humanized antihuman interleukin-5 antibody, in severe persistent asthma: A pilot study. Am. J. Respir. Crit. Care Med. 167, 1655–1659. Kitamura, T., Hayashida, K., Sakamaki, K., Yokota, T., Arai, K., and Miyajima, A. (1990). Reconstitution of functional receptors for human granulocyte/macrophage colony-stimulating factor (GM-CSF): Evidence that the protein encoded by the AIC2B cDNA is a subunit of the murine GM-CSF receptor. Proc. Natl. Acad. Sci. USA 88, 5082–5086. Kitamura, T., Sato, N., Arai, K., and Miyajima, A. (1991). Expression cloning of the human IL-3 receptor cDNA reveals a shared beta subunit for the human IL-3 and GM-CSF receptors. Cell 66, 1165–1174. Klein, U., Casola, S., Cattoretti, G., Shen, Q., Lia, M., Mo, T., Ludwig, T., Rajewsky, K., and Dalla-Favera, R. (2006). Transcription factor IRF4 controls plasma cell diff erentiation and class-switch recombination. Nat. Immunol. 7, 773–782. Koike, M., Kikuchi, Y., Tominaga, A., Takaki, S., Akagi, K., Miyazaki, J., Yamamura, K., and Takatsu, K. (1995). Defective IL-5-receptor-mediated signaling in B cells of X-linked immunodeficient mice. Int. Immunol. 7, 21–30. Kopf, M., Brombacher, F., Hodgkin, P. D., Ramsay, A. J., Milbourne, E. A., Dai, W. J., Ovington, K. S., Behm, C. A., Kohler, G., Young, I. G., and Matthaei, K. I. (1996). IL-5deficient mice have a developmental defect in CD5+ B-1 cells and lack eosinophilia but have normal antibody and cytotoxic T cell responses. Immunity 4, 15–24. Kouro, T., Kikuchi, Y., Kanazawa, H., Hirokawa, K., Harada, N., Shiiba, M., Wakao, H., Takaki, S., and Takatsu, K. (1996). Critical proline residues of the cytoplasmic domain of the IL-5 receptor a chain and its function in IL-5-mediated activation of JAK kinase and STAT5. Int. Immunol. 8, 237–245. Kuraoka, M., Hashiguchi, M., Hachimura, S., and Kaminogawa, S. (2004). CD4 c-kit CD3e IL-2Raþ Peyer’s patch cells are a novel cell subset which secrete IL-5 in response to IL-2: Implications for their role in IgA production. Eur. J. Immunol. 34, 1920–1929.
IL-5 in the Link Between the Innate and Acquired Immune Response
229
Kroese, F. G., and Bos, N. A. (1999). Peritoneal B-1 cells switch in vivo to IgA and these IgA antibodies can bind to bacteria of the normal intestinal microflora. Curr. Top. Microbiol. Immunol. 246, 343–349. Leckie, M., ten Brinke, A., Khan, J., Diamant, Z., O’Connor, B. J., Walls, C. M., Mathur, A. K., Cowley, H. C., Chung, K. F., Djukanovic, R., Hansel, T. T., Holgate, S. T., et al. (2000). Effects of an interleukin-5 blocking monoclonal antibody on eosinophils, airway hyperresponsiveness, and the late asthmatic response. Lancet 356, 2144–2148. Lei, J. T., and Martinez-Moczygemba, M. (2008). Separate endocytic pathways regulate IL-5 receptor internalization and signaling. J. Leukoc. Biol. 84, 499–509. Li, T., Tsukada, S., Satterthwaite, A., Havlik, M. H., Park, H., Takatsu, K., and Witte, O. N. (1995). Activation of Bruton’s tyrosine kinase (BTK) by a point mutation in its pleckstrin homology (PH) domain. Immunity 2, 451–460. Liu, L. Y., Sedgwick, J. B., Bates, M. E., Vrtis, R. F., Gern, J. E., Kita, H., Jarjour, N. N., Busse, W. W., and Kelly, E. A. (2002). Decreased expression of membrane IL-5 receptor a on human eosinophils: I. Loss of membrane IL-5 receptor a on airway eosinophils and increased soluble IL-5 receptor a in the airway after allergen challenge. J. Immunol. 169, 6452–6458. Lund, J. M., Alexopoulou, L., Sato, A., Karow, M., Adams, N. C., Gale, N. W., Iwasaki, A., and Flavell, R. A. (2004). Recognition of single-stranded RNA viruses by Toll-like receptor 7. Proc. Natl Acad. Sci. USA 101, 5598–5603. Lutzker, S., Rothman, P., Pollock, R., Coffman, R., and Alt, F. W. (1988). Mitogen- and IL-4regulated expression of germ-line Ig gamma 2b transcripts: evidence for directed heavy chain class switching. Cell 53, 177–184. Macpherson, A. J., Gatto, D., Sainsbury, E., Harriman, G. R., Hengartner, H., and Zinkernagel, R. M. (2000). A primitive T cell-independent mechanism of intestinal mucosal IgA responses to commensal bacteria. Science 288, 2222–2226. Mandler, R., Chu, C. C., Paul, W. E., Max, E. E., and Snapper, C. M. (1993). Interleukin 5 induces Sm-Sg1 DNA rearrangement in B cells activated with dextran-anti-IgD antibodies and interleukin 4: A three component model for Ig class switching. J. Exp. Med. 178, 1577–1586. Manis, J. P., Gu, Y., Lansford, R., Sonoda, E., Ferrini, R., Davidson, L., Rajewsky, K., and Alt, F. W. (1998). Ku 70 is required for late B cell development and immunoglobulin heavy chain class switching. J. Exp. Med. 187, 2021–2029. Manis, J. P., Dudley, D., Kaylor, L., and Alt, F. W. (2002). IgH class switch recombination to IgG1 in DNA-PKcs-deficient B cells. Immunity 16, 607–617. Manis, J. P., Morales, J. C., Xia, Z., Kutok, J. L., Alt, F. W., and Carpenter, P. B. (2004). 53BP1 links DNA damage-response pathways to immunoglobulin heavy chain class-switch recombination. Nat. Immunol. 5, 481–487. Martinon, F., and Tschopp, J. (2005). NLRs join TLRs as innate sensors of pathogens. Trends Immunol. 26, 447–454. Martinez-Moczygemba, M., and Huston, D. P. (2001). Proteasome regulation of bc signaling reveals a novel mechanism for heterotypic desensitization. J. Clin. Invest. 108, 1797–1806. Martinez-Moczygemba, M., Huston, D. P., and Lei, J. T. (2007). JAK kinases control IL-5 receptor ubiquitination, degradation and internalization. J. Leuk, Biol., 2007 81, 1137–1148. Masuda, A., Yoshikai, Y., Aiba, K., and Matsuguchi, T. (2002). Th2 cytokine production from mast cells is directly induced by lipopolysaccharide and distinctly regulated by c-Jun N-terminal kinase and p38 pathways. J. Immunol. 169, 3801–3810. Matsumoto, R., Matsumoto, M., Mita, S., Hitoshi, Y., Ando, M., Araki, S., Yamaguchi, N., Tominaga, A., and Takatsu, K. (1989). Interleukin-5 induces maturation but not class switching of surface IgA-positive B cells into IgA-secreting cells. Immunology 66, 32–38. Matsuoka, M., Yoshida, K., Maeda, T., Usuda, S., and Sakano, H. (1990). Switch circular DNA formed in cytokine-treated mouse splenocytes: evidence for intramolecular DNA deletion in immunoglobulin class switching. Cell 62, 135–142.
230
Kiyoshi Takatsu et al.
Mattes, J., Yang, M., Mahalingam, S., Kuehr, J., Webb, D. C., Simson, L., Hogan, S. P., Koskinen, A., McKenzie, A. N. J., Dent, L. A., Rothenberg, M. C., Matthaei, K. I., et al. (2002). Intrinsic defect in T cell production of interleukin (IL)-13 in the absence of both IL5 and eotaxin precludes the development of eosinophilia and airways hyperreactivity in experimental asthma. J. Exp. Med. 195, 1433–1444. Mauser, P. J., Pitman, A. M., Fernandez, X., Foran, S. K., Adams, G. K., III, Kreutner, W., Egan, R. W., and Chapman, R. W. (1995). Effects of an antibody to IL-5 in a monkey model of asthma. Am. J. Respir. Crit. Care Med. 152, 467–472. Medzhitov, R. (2001). Toll-like receptors and innate immunity. Nat. Rev. Immunol. 1, 135–145. Melchers, F., and Andersson, J. (1986). Factors controlling the B-cell cycle. Annu. Rev. Immunol. 4, 13–36. Milburn, M. V., Hassell, A. M., Lambert, M. H., Jordan, S. R., Proudfoot, A. E. I., Graber, P., and Wells, T. N. C. (1993). A novel dimer configuration revealed by the crystal structure at 2.4 A resolution of human interleukin-5. Nature 363, 172–176. Min, B., and Paul, W. E. (2008). Basophils in the spotlight at last. Nat. Immunol. 9, 223–225. Mittrucker, H. W., Matsuyama, T., Grossman, A., Kundig, T. M. J., Potter, J., Shahinian, A., Wakeham, A., Patterson, B., Ohashi, P. S., and Mak, T. W. (1997). Requirement for the transcription factor LSIRF/IRF4 for mature B and T lymphocyte function. Science 275, 540–543. Mita, S., Tominaga, A., Hitoshi, Y., Sakamoto, K., Honjo, T., Akagi, M., Kikuchi, Y., Yamaguchi, Y., and Takatsu, K. (1989a). Characterization of high-affinity receptors for interleukin 5 on interleukin 5-dependent cell lines. Proc. Natl. Acad. Sci. USA 86, 2311–2315. Miyajima, A., Kitamura, T., Harada, N., Yokota, T., and Arai, K- I. (1992). Cytokine receptors and signal transduction. Annu. Rev. Immunol. 10, 295–311. Mizoguchi, C., Uehara, S., Akira, S., and Takatsu, K. (1999). IL-5 induces IgG1 isotype switch recombination in mouse CD38-activated sIgD-positive B lymphocytes. J. Immunol. 162, 2812–2819. Moon, B.-G., Yoshida, T., Shiiba, M., Nakao, K., Katsuki, M., Takaki, S., and Takatsu, K. (2001). Functional dissection of the cytoplasmic subregions of the interleukin-5 receptor alpha chain in growth and immunoglobulin G1 switch recombination of B cells. Immunology 102, 289–300. Moon, B.-G., Miayake, K., Takaki, S., and Takatsu, K. (2004). The role of IL-5 for mature B-1 cells in homeostatic proliferation, cell survival, and Ig production. J. Immunol. 172, 6020–6029. Montecino-Rodriguez, E., Leathers, H., and Dorshkind, K. (2006). Identification of a B-1 B cell-specified progenitor. Nat. Immunol. 7, 293–301. Mosmann, T. R., and Coffman, R. L. (1989). TH1 and TH2 cells: different patterns of lymphokine secretion lead to different functional properties. Annu. Rev. Immunool. 7, 145–173. Muramatsu, M., Sankaranand, V. S., Anant, S., Sugai, M., Kinoshita, K., Davidson, N. O., and Honjo, T. (1999). Specific expression of activationinduced cytidine deaminase (AID), a novel member of the RNAediting deaminase family in germinal center B cells. J. Biol. Chem. 274, 18470–18476. Muramatsu, M., Kinoshita, K., Fagarasan, S., Yamada, S., Shinkai, Y., and Honjo, T. (2000). Class switch recombination and hypermutation require activation-induced cytidine deaminase (AID), a potential RNA editing enzyme. Cell 102, 553–563. Muramatsu, M., Nagaoka, H., Shinkura, R., Begum, N. A., and Honjo, T. (2007). Discovery of activation-induced cytidine deaminase, the engraver of antibody memory. Adv. Immunol. 94, 1–36. Murata, Y., Takaki, S., Migita, M., Kikuchi, Y., Tominaga, A., and Takatsu, K. (1992). Molecular cloning and expression of the human interleukin 5 receptor. J. Exp. Med. 175, 341–351.
IL-5 in the Link Between the Innate and Acquired Immune Response
231
Muto, A., Tashiro, S., Nakajima, O., Hoshino, H., Takahashi, S., Sakoda, S., Ikebe, D., Yamamoto, M., and Igarashi, K. (2004). The transcriptional programme of antibody class switching involves the repressor Bach2. Nature, 429, 566–571. Nakajima, H., Iwamoto, I., Tomoe, S., Matsumura, R., Tomioka, H., Takatsu, K., and Yoshida, S. (1992). CD4þ T-lymphocytes and interleukin-5 mediate antigen-induced eosinophil infiltration into the mouse trachea. Amr. Rev. Respir. Dis. 146, 374–377. Nakajima, H., and Takatsu, K. (2007). Role of cytokines in allergic inflammation. Int. Arch. Allergy Immunol. 142, 265–273. Nera, K. P., Kohonen, P., Narvi, E., Peippo, A., Mustonen, L., Terho, P., Koskela, K., Buerstedde, J. M., and Lassila, O. (2006). Loss of Pax5 promotes plasma cell differentiation. Immunity 24, 283–293. Nikawa, T., Ikemoto, M., Kano, M., Tokuoka, K., Hirasaka, K., Uehara, S., Takatsu, K., Rokutan, K., and Kishi, K. (2001). Impaired vitamin A-mediated mucosal IgA response in IL-5 receptor-knockout mice. Biochem. Biophys. Res. Commun. 13, 546–549. Niu, H., Ye, B. H., and Dalla-Favera, R. (1998). Antigen receptor signaling induces MAP kinase-mediated phosphorylation and degradation of the BCL-6 transcription factor. Genes Dev. 12, 1953–1961. Noma, T., Sideras, P., Naito, T., Bergstedt-Lindqvist, S., Azuma, C., Severinson, E., Tanabe, T., Kinashi, T., Matsuda, F., Yaoita, Y., and Honjo, T. (1986). Cloning of cDNA encoding the murine IgG1 induction factor, by a novel strategy using SP6 promoter. Nature 319, 640–646. Ogata, N., Kouro, T., Yamada, A., Koike, M., Hanai, N., Ishikawa, T., and Takatsu, K. (1998). JAK2 and JAK1 constitutively associate with an interleukin-5 (IL-5) receptor a and bc subunit, respectively, and are activated upon IL-5 stimulation. Blood 91, 2264–2271. Oldhoff, J. M., Darsow, U., Werfel, T., Katzer, K., Wulf, A., Laifaoui, J., Hijnen, D. J., Plo¨tz, S., Knol, E. F., Kapp, A., Bruijnzeel-Koomen, C. A., Ring, J., and de Bruin-Weller, M. S. (2005). Anti-IL-5 recombinant humanized monoclonal antibody (mepolizumab) for the treatment of atopic dermatitis. Allergy 60, 693–696. Pao, L. I., Lam, K. P., Henderson, J. M., Kutok, J. L., Alimzhanov, M., Nitschke, L., Thomas, M. L., Neel, B. G., and Rajewsky, K. (2007). B cell-specific deletion of proteintyrosine phosphatase Shp1 promotes B-1a cell development and causes systemic autoimmunity. Immunity 27, 35–48. Pasare, C., and Medzhitov, R. (2005). Control of B-cell responses by Toll-like receptors. Nature 438, 364–368. Paul, W. E., and Ohara, J. (1987). B-cell stimulatory factor-1/interleukin 4. Annu. Rev. Immunol. 5, 429–460. Pazdrak, K., Schreiber, D., Forsythe, P., Justement, L., and Alam, R. (1995). The intracellular signal transduction mechanism of interleukin 5 in eosinophils: the involvement of lyn tyrosine kinase and the Ras-Raf-1-MEK-microtubule–associated protein kinase pathway. J. Exp. Med. 181, 1827–1834. Pazdrak, K., Olszewska-Pazdrak, B., Stafford, S., Garofalo, R. P., and Alam, R. (1998). Lyn, Jak2, and Raf-1 kinases are critical for the antiapoptotic effect of interleukin 5, whereas only Raf-1 kinase is essential for eosinophil activation and degranulation. J. Exp. Med. 188, 421–429. Petersen-Mahrt, S. K., Harris, R. S., and Neuberger, M. S. (2002). AID mutates E. coli suggesting a DNA deamination mechanism for antibody diversification. Nature 418, 99–103. Phipps, S., Flood-Page, P., Menzies-Gow, A., Ong, Y. E., and Kay, A. B. (2004). Intravenous anti-IL-5 monoclonal antibody reduces eosinophils and tenascin deposition in allergenchallenged human atopic skin. J. Invest. Dermatol. 122, 1406–1412. Plaut, M., Pierce, J. H., Watson, C. J., Hanley-Hyde, J., Nordan, R. P., and Paul, W. E. (1989). Mast cell lines produce lymphokines in response to cross-linkage of Fc epsilon RI or to calcium ionophores. Nature 339, 64–67.
232
Kiyoshi Takatsu et al.
Plo¨tz, S. G., Simon, H. U., Darsow, U., Simon, D., Vassina, E., Yousefi, S., Hein, R., Smith, T., Behrendt, H., and Ring, J. (2003). Use of an anti-interleukin-5 antibody in the hypereosinophilic syndrome with eosinophilic dermatitis. N. Engl. J. Med. 349, 2334–2339. Purkerson, J. M., and Isakson, P. C. (1992). Interleukin 5 (IL-5) provides a signal that is required in addition to IL-4 for isotype switching to immunoglobulin (Ig) G1 and IgE. J. Exp. Med. 175, 973–82. Rada, C., Williams, G. T., Nilsen, H., Barnes, D. E., Lindahl, T., and Neuberger, M. S. (2002). Immunoglobulin isotype switching is inhibited and somatic hypermutation perturbed in UNG-deficient mice. Curr. Biol. 12, 1748–1755. Rastelli, J., Ho¨mig-Ho¨lzel, C., Seagal, J., Mu¨ller, W., Hermann, A. C., Rajewsky, K., and ZimberStrobl, U. (2008). LMP1 signaling can replace CD40 signaling in B cells in vivo and has unique features of inducing class-switch recombination to IgG1. Blood 111, 1448–1455. Rathmell, W. K., and Chu, G. (1994). Involvement of the Ku autoantigen in the cellular response to DNA double-strand breaks. Proc. Natl. Acad. Sci. USA 91, 7623–7627. Rawlings, D., Saffran, D. C., Tsukada, S., Largaespada, D. A., Grimaldi, J. C., Cohen, L., Mohr, R. N., Bazan, J. F., Howard, M., Copeland, N. G., Jenkins, N. A., and Witte, O. N. (1993). Mutation of unique region of Bruton’s tyrosine kinase in immunodeficient XID mice. Science 261, 358–360. Reimold, A. M., Iwakoshi, N. N., Manis, J., Vallabhajosyula, P., Szomolanyi-Tsuda, E., Gravallese, E. M., Friend, D., Grusby, M. J., Alt, F., and Glimcher, L. H. (2001). Plasma cell differentiation requires the transcription factor XBP-1. Nature 412, 300–307. Revy, P., Muto, T., Levy, Y., et al. (2000). Activation-induced cytidine deaminase (AID) deficiency causes the autosomal recessive form of the Hyper-IgM syndrome (HIGM2). Cell 102, 565–575. Robinson, D. S., Hamid, Q., Ying, S., Tsicopoulos, A., Barkans, J., Bentley, A. M., Corrigan, C. J., Durham, S. R., and Kay, A. B. (1992). Predominant TH2-like bronchoalveolar T-lymphocyte population in atopic asthma. New Eng. J. Med. 326, 298–304. Rolink, A., and Melchers, F. (1991). Molecular and cellular origins of B lymphocyte diversity. Cell 66, 1081–1094. Rolink, A., Melchers, F., and Andersson, J. (1996). The SCID but not Rag-2 gene product is required for Sm-SE heavy chain class switching. Immunity 5, 319–330. Rothenberg, M. E., and Hogan, S. P. (2006). The eosinophil. Annu. Rev. Immunol. 24, 147–174. Rothenberg, M. E., Klion, A. D., Roufosse, F. E., Kahn, E. J., Weller, P. F., Simon, H- U., Schwartz, L. B., Rosenwasser, L. J., Ring, J., Griffin, E. F., Haig, A. E., Frewer, P. I. H., et al. (2008). Treatment of patients with the hypereosinophilic syndrome with mepolizumab. N. Engl. J. Med. 358, 1215–1228. Rothman, P., Lutzker, S., Cook, W., Coffman, R., and Alt, G. W. (1988). Mitogen plus interleukin-4 induction of CE transcripts in B lymphoid cells. J. Exp. Med. 168, 2385–2389. Rothman, P., Chen, Y. Y., Lutzker, S., Li, S. C., Stewart, V., Coffman, R., and Alt, F. W. (1990). Structure and expression of germ line immunoglobulin heavy-chain epsilon transcripts: interleukin-4 plus lipopolysaccharide-directed switching to CE. Mol. Cell. Biol. 10, 1672–1679. Sakamaki, K., Miyajima, I., Kitamura, T., and Miyajima, A. (1992). Critical cytoplasmic domains of the common beta subunit of the human GM-CSF, IL-3 and IL-5 receptors for growth signal transduction and tyrosine phosphorylation. EMBO J. 11, 3541–3549. Sakuishi, K., Oki, S., Araki, M., Porcelli, S. A., Miyake, S., and Yamamura, T. (2007). Invariant NKT cells biased for IL-5 production act as crucial regulators of inflammation. J. Immunol. 179, 3452–3462. Sanderson, C. J. (1992). Interleukin-5, eosinophils, and disease. Blood 79, 3101–3109. Sato, N., Sakamaki, K., Terada, N., Arai, K., and Miyajima, A. (1993). Signal transduction by the high-affinity GM-CSF receptor: two distinct cytoplasmic regions of the common beta subunit responsible for different signaling. EMBO J. 12, 4181–4189.
IL-5 in the Link Between the Innate and Acquired Immune Response
233
Sato, S., Katagiri, T., Takaki, S., Kikuchi, Y., Hitoshi, Y., Yonehara, S., Tsukada, S., Kitamura, D., Watanabe, T., Witte, O. N., and Takatsu, K. (1994). IL-5 receptor-mediated tyrosine phosphorylation of SH2/SH3-containing proteins and activation of Bruton’s tyrosine and Janus 2 kinases. J Exp Med. 180, 2101–2110. Sciammas, R., Shaffer, A. L., Schatz, J. H., Zhao, H., Staudt, L. M., and Singh, H. (2006). Graded expression of interferon regulatory factor-4 coordinates isotype switching with plasma cell differentiation. Immunity 25, 225–236. Shaffer, A. L., Yu, X., He, Y., Boldrick, J., Chan, E. P., and Staudt, L. M. (2000). BCL-6 represses genes that function in lymphocyte differentiation, inflammation, and cell cycle control. Immunity 13, 199–212. Shaffer, A. L., Lin, K. I., Kuo, T. C., Yu, X., Hurt, E. M., Rosenwald, A., Giltnane, J. M., Yang, L., Zhao, H., Calame, K., and Staudt, L. M. (2002). Blimp-1 orchestrates plasma celldiff erentiation by extinguishing the mature B cell gene expression program. Immunity 17, 51–62. Shapiro-Shelef, M., and Calame, K. (2005). Regulation of plasma-cell development. Nat. Rev., Immunol. 5, 230– 242. Shapiro-Shelef, M., Lin, K. I., McHeyzer-Williams, L. J., Liao, J., McHeyzer-Williams, M. G., and Calame, K. (2003). Blimp-1 is required for the formation of immunoglobulin secreting plasma cells and pre-plasma memory B cells. Immunity 19, 607–620. Schebesta, A., McManus, S., Salvagiott, G., Delogu, A., Busslinger, G. A., and Busslinger, M. (2007). Transcription factor Pax5 activates the chromatin of key genes involved in B cell signaling, adhesion, migration, and immune function. Immunity 27, 49–63. Scho¨nbeck, U., Sukhova, G. K., Gerdes, N., and Libby, P. (2002). T(H)2 predominant immune responses prevail in human abdominal aortic aneurysm. Am. J. Pathol. 161, 499–506. Severinson, E., Fernandez, C., and Stavnezer, J. (1990). Induction of germ-line immunoglobulin heavy chain transcripts by mitogens and interleukins prior to switch recombination. Eur. J. Immunol. 20, 1079–1084. Shaw, P. X., Ho¨rkko¨, S., Chang, M. K., Curtiss, L. K., Palinski, W., Silverman, G. J., and Witztum, J. L. (2000). Natural antibodies with the T15 idiotype may act in atherosclerosis, apoptotic clearance, and protective immunity. J. Clin. Invest. 105, 1731–1740. Shi, H., Qin, S., Huang, G., Chen, Y., Xiao, C., Xu, H., Liang, G., Xie, Z., Qin, X., Wu, J., Li, G., and Zhang, C. (1997). Infiltration of eosinophils into the asthmatic airways caused by interleukin 5. Am. J. Respir. Cell. Mol. Biol. 16, 220–224. Simon, H. U., Plo¨tz, S. G., Dummer, R., and Blaser, K. (1999). Abnormal clones of T cells producing interleukin-5 in idiopathic eosinophilia. N. Engl. J. Med. 341, 1112–1120. Snapper, C. M., Peschel, C., and Paul, W. E. (1988). IFN-g stimulates IgG2a secretion by murine B cells stimulated with bacterial lipopolysaccharide. J. Immunol. 140, 2121–2127. Snapper, C. M., McIntyre, T. M., Mandler, R., Pecanha, L. M. T., Finkelman, F. D., Lees, A., and Mond, J. J. (1992). Induction of IgG3 secretion by interferon g: A model for T cellindependent class switching in response to T-cell-independent type 2 antigens. J. Exp. Med. 175, 1367–1371. Snapper, C. M., Waegell, W., Beernink, H., and Dasch, J. R. (1993). Transforming growth factor-beta 1 is required for secretion of IgG of all subclasses by LPS-activated murine B cells in vitro. J. Immunol. 151, 4625–4636. Snapper, C. M., Marcu, K. B., and Zelazowski, P. (1997). The immunoglobulin class switch: Beyond ‘‘accessibility’’. Immunity 6, 217–223. Sokol, C. L., Barton, G. M., Farr, A. G., and Medzhitov, R. (2008). A mechanism for the initiation of allergen-induced T helper type 2 responses. Nat. Immunol. 9, 310–318. Sonoda, E., Matsumoto, R., Hitoshi, Y., Mita, S., Ishii, N., Sugimoto, M., Araki, S., Tominaga, A., Yamaguchi, N., and Takatsu, K. (1989). Transforming growth factor b induces IgA production and acts additively with interleukin 5 for IgA production. J. Exp. Med. 170, 1415–1420. Sun, Z., Yergeau, D. A., Tuypens, T., Tavernier, J., Paul, C. C., Baumann, M. A., Tenen, D. G., and Ackerman, S. J. (1995). Identification and characterization of a functional promoter
234
Kiyoshi Takatsu et al.
region in the human eosinophil IL-5 receptor alpha subunit gene. J. Biol. Chem. 270, 1462–1471. Stein, M. L., Collins, M. H., Villanueva, J. M., Kushner, J. P., Putnam, P. E., Buckmeier, B. K., Filipovich, A. H., Assa’ad, A. H., and Rothenberg, M. E. (2006). Anti-IL-5 (mepolizumab) therapy for eosinophilic esophagitis. J. Allergy Clin. Immunol. 118, 1133–1141. Stavnezer, J. (1996). Antibody class switching. Adv. Immunol. 61, 79–146. Stavnezer-Nordgren, J., and Sirlin, S. (1986). Specificity of immunoglobulin heavy chain switch correlates with activity of germline heavy chain genes prior to switching. EMBO J. 5, 95–102. Stavnezer, J., Guikema, J. E., and Schrader, C. E. (2008). Mechanism and regulation of class switch recombination. Annu. Rev. Immunol. 26, 261–292. Takaki, S., Tominaga, A., Hitoshi, Y., Mita, S., Sonoda, E., Yamaguchi, N., and Takatsu, K. (1990). Molecular cloning and expression of the murine interleukin-5 receptor. EMBO J. 9, 4367–4374. Takaki, S., Mita, S., Kitamura, T., Yonehara, S., Yamaguchi, N., Tominaga, A., Miyajima, A., and Takatsu, K. (1991). Identification of the second subunit of the murine interleukin-5 receptor: interleukin-3 receptor-like protein, AIC2B is a component of the high affinity interleukin-5 receptor. EMBO J. 10, 2833–2838. Takaki, S., Murata, Y., Kitamura, T., Miyajima, A., Tominaga, A., and Takatsu, K. (1993). Reconstitution of the functional receptors for murine and human interleukin 5. J. Exp. Med. 177, 1523–1529. Takaki, S., Kanazawa, H., Shiiba, M., and Takatsu, K. (1994). A critical cytoplasmic domain of the interleukin-5 (IL-5) receptor a chain and its function in IL-5-mediated growth signal transduction. Mol. Cell. Biol. 14, 7404–7413. Takatsu, K. (1992). Interleukin-5 receptor. Curr. Opin. Immunol. 4, 299–306. Takatsu, K. (1998). Interleukin 5 and B cell differentiation. Cytokines Growth Factor Rev. 9, 25–35. Takatsu, K., and Nakajima, H. (2008). IL-5 and eosinophilia. Curr. Opin. Immunol. 20, 288–294. Takatsu, K., Tominaga, A., and Hamaoka, T. (1980a). Antigen-induced T cell-replacing factor (TRF). I. Functional characterization of a TRF-producing helper T cell subset and genetic studies on TRF production. J. Immunol. 124, 2414–2422. Takatsu, K., Tanaka, K., Tominaga, A., Kumahara, Y., and Hamaoka, T. (1980b). Antigeninduced T cell-replacing factor (TRF). III. Establishment of T cell hybrid clone continuously producing TRF and functional analysis of released TRF. J. Immunol. 125, 2646–2653. Takatsu, K., Kikuchi, Y., Takahashi, T., Honjo, T., Matsumoto, M., Harada, N., Yamaguchi, N., and Tominaga, A. (1987). Interleukin 5, a T-cell-derived B-cell differentiation factor also induces cytotoxic T lymphocytes. Proc. Natl. Acad. Sci. USA 84, 4234–4238. Takatsu, K., Tominaga, A., Harada, N., Mita, S., Matsumoto, M., Takahashi, T., Kikuchi, Y., and Yamaguchi, N. (1988). T cell-replacing factor (TRF)/interleukin 5 (IL-5): Molecular and functional properties. Immunol. Rev. 102, 107–135. Takatsu, K., Takaki, S., and Hitoshi, Y. (1994). Interleukin-5 and its receptor system in the immune system and inflammation. Adv. Immunol. 57, 145–190. Takatsu, K., Dickason, R., and Huston, D. (1997). Interleukin-5. Growth Factors and Cytokines in Health and Disease"., (D. LeRoith, and and C. Bondy, Eds.), Volume IIA, pp. 143–200. JAI Press, London. Takeda, K., Kaisho, T., and Akira, S. (2003). Toll-like receptors. Annu. Rev. Immunol. 21, 335–376. Takeda, K., and Akira, S. (2005). Toll-like receptors in innate immunity. Int. Immunol. 17, 1–14. Tanaka, H., Kawada, N., Yamada, T., Kawada, K., Takatsu, K., and Nagai, H. (2000). Allergen-induced airway inflammation and bronchial responsiveness in interleukin-5 receptor a chain-deficient mice. Clin. Exp. Allergy 30, 874–881.
IL-5 in the Link Between the Innate and Acquired Immune Response
235
Tanaka, H., Komai, M., Nagao, K., Ishizaki, M., Kajiwara, D., Takatsu, K., Delespesse, G., and Nagai, H. (2004). Role of interleukin-5 and eosinophils in allergen-induced airway remodeling in mice. Am. J. Respir. Cell Mol. Biol. 31, 62–68. Tanaka, T., Grusby, M. J., and Kaisho, T. (2007). PDLIM2-mediated termination of transcription factor NF-kappaB activation by intranuclear sequestration and degradation of the p65 subunit. Nat. Immunol. 8, 584–591. Tavernier, J., Devos, R., Cornelis, S., Tuypens, T., Van der Heyden, J., Fiers, W., and Plaetinck, G. (1991). A human high affinity interleukin-5 receptor (IL5R) is composed of an IL5-specific a chain and a b chain shared with the receptor for GM-CSF. Cell 66, 1175–1184. Temple, R., Allen, E., Fordham, J., et al. (2001). Microarray analysis of eosinophils reveals a number of candidate survival and apoptosis genes. Am. J. Respir. Cell Mol. Biol. 25, 425–433. Thomas, J. D., Sideras, P., Smith, C. I. E., Vorechovsky, I., Chapman, V., and Paul, W. E. (1993). Colocalization of X-linked agammaglobulinemia and X-linked immunodeficiency genes. Science 261, 355–358. Tominaga, A., Matsumoto, M., Harada, N., Takahashi, T., Kikuchi, Y., and Takatsu, K. (1988). Molecular properties and regulation of mRNA expression for murine T cell-replacing factor/IL-5. J. Immunol. 140, 1175–1181. Tominaga, A., Mita, S., Kikuchi, Y., Hitoshi, Y., Takatsu, K., Nishikawa, S- I., and Ogawa, M. (1989). Establishment of IL-5-dependent early B cell lines by long-term bone marrow cultures. Growth Factors 1, 135–146. Tominaga, A., Takaki, S., Koyama, N., Katoh, S., Matsumoto, R., Migita, M., Hitoshi, Y., Hosoya, Y., Yamauchi, S., Kanai, Y., Miyazaki, J- I., Usuku, G., et al. (1991). Transgenic mice expressing a B cell growth and differentiation factor gene (interleukin-5) develop eosinophilia and autoantibody production. J. Exp. Med. 173, 429–437. Tsukamoto, Y., Uehara, S., Mizoguchi, C., Sato, A., Horikawa, K., and Takatsu, K. (2005). Requirement of 8-mercaptoguanosine as a costimulus for IL-4-dependent m to g1 class switch recombination in CD38-activated B cells. Biolchem. Biophysic. Res. Commun. 336, 625–633. Tsukamoto, Y., Nagai, Y., Kariyone, A., Shibata, T., Kaisho, T., Akira, A., Miyake, K., and Takatsu, K. (2009). Toll-like receptor 7 cooperates with IL-4 in activated B cells through antigen receptor or CD38 and induces class switch recombination and IgG1 production. Mol. Immunol. In press. Tsuji, R. F., Szczepanik, M., Kawi, I., Paliwal, V., Campos, R. A., Itakura, A., AkahiraAzuma, M., Baumgarth, N., Herzenberg, L. A., and Askenase, P. W. (2002). B cell-dependent T cell responses: IgM antibodies are required to elicit contact sensitivity. J. Exp. Med. 196, 1277–1290. Tsukada, S., Saffran, D. C., Rawling, D. J., Parolini, O., Allen, R. C., Klisak, I., Sparkes, R. S., Kubagawa, H., Mohandas, T., Quan, S., Belmont, J. W., Cooper, M. D., et al. (1993). Deficient expression of a B cell cytoplasmic tyrosine kinase in human X-linked agammaglobulinemia. Cell 72, 279–290. Tunyaplin, C., Shaffer, A. L., Angelin-Duclos, C. D., Yu, X., Staudt, L. M., and Calame, K. L. (2004). Direct repression of prdm1 by Bcl-6 inhibits plasmacytic differentiation. J. Immunol. 173, 1158–1165. Turner, C. A., Jr., Mack, D. H., and Davis, M. M. (1994). Blimp-1, a novel zinc finger-containing protein that can drive the maturation of B lymphocytes into immunoglobulin-secreting cells. Cell 77, 297–306. Vetrie, D., Vorechovsky, I., Sideras, P., Holland, J., Davies, A., Flinter, F., Hammerstrom, L., Kinnon, C., Levinsky, R., Bobrow, M., Smith, C. I. E., and Bentley, D. R. (1993). The gene involved in X-linked agammaglobulinaemia is a member of the src family of proteintyrosine kinases. Nature 361, 226–233. von Schwedler, U., Jack, H. M., and Wabl, M. (1990). Circular DNA is a product of the immunoglobulin class switch rearrangement. Nature 345, 452–456.
236
Kiyoshi Takatsu et al.
Wakioka, T., Sasaki, A., Kato, R., Shouda, T., Matsumoto, A., Miyoshi, K., Tsuneoka, M., Komiya, S., Baron, R., and Yoshimura, A. (2001). Spred is a Sprouty-related suppressor of Ras signalling. Nature 412, 647–651. Warren, H. S., Kinnear, B. F., Phillips, J. H., and Lanier, L. L. (1995). Production of IL-5 by human NK cells and regulation of IL-5 secretion by IL-4, IL-10, and IL-12. J. Immunol. 154, 5144–5152. Watanabe, S., Mui, A. L- F., Muto, A., Chan, J. X., Hayashida, K., Yokota, T., Miyajima, A., and Arai, K. (1993). Reconstituted human granulocyte-macrophage colony-stimulating factor receptor transduces growth-promoting signals in mouse NIH 3T3 cells: Comparison with signalling in BA/F3 pro-B cells. Mol. Cell. Biol. 13, 1440–1448. Weber, J. D., Isakson, P. C., and Purkerson, J. M. (1996). IL-5 receptor expression and Ig secretion from murine B lymphocytes requires coordinated signaling by membrane Ig, IL-4, and IL-5. J. Immunol. 157, 4428–4435. Wilkins, H. J., Crane, M. M., Copeland, K., and Williams, W. V. (2005). Hypereosinophilic syndrome: an update. Am. J. Hematol. 80, 148–157. Wills-Karp, M. (1999). Immunologic basis of antigen-induced airway hyperresponsiveness. Annu. Rev. Immunol. 17, 255–281. Wuerffel, R. A., Du, J., Thompson, J., and Kenter, A. L. (1997). Sg3 DNA specific double strand breaks are induced in mitogen-activated B cells and are implicated in switch recombination. J. Immunol. 159, 4139–4144. Yamaguchi, Y., Suda, T., Suda, J., Eguchi, M., Miura, Y., Harada, N., Tominaga, A., and Takatsu, K. (1988a). Purified interleukin 5 supports the terminal differentiation and proliferation of murine eosinophilic precursors. J. Exp. Med. 167, 43–56. Yamaguchi, Y., Hayashi, Y., Sugama, Y., Miura, Y., Kasahara, T., Torisu, T., Mita, S., Tominaga, A., Takatsu, K., and Suda, T. (1988b). Purified interleukin 5 supports the terminal differentiation and proliferation of murine eosinophilic precursors. J. Exp. Med. 167, 1737–1742. Yamaguchi, N., Hitoshi, Y., Mita, S., Hosoya, Y., Kikuchi, Y., Tominaga, A., and Takatsu, K. (1990). Characterization of the murine interleukin 5 receptor by using a monoclonal antibody. Int. Immunol. 2, 181–187. Yan, C. T., Boboila, C., Souza, E. K., Franco, S., Hickernell, T. R., Murphy, M., Gumaste, S., Geyer, M., Zarrin, A. A., Manis, J. P., Rajewsky, K., and Alt, F. W. (2007). IgH class switching and translocations use a robust non-classical end-joining pathway. Nature 449, 478–482. Yancopoulos, G. D., DePinho, R. A., Zimmerman, K. A., Lutzker, S. G., Rosenberg, N., and Alt, F. W. (1986). Secondary genomic rearrangement events in pre-B cells: VHDJH replacement by a LINE-1 sequence and directed class switching. EMBO J. 5, 3259–3266. Yang, D., Chen, Q., Su, S. B., Zhang, P., Kurosaka, K., Caspi, R. R., Michalek, S. M., Rosenberg, H. F., Zhang, N., and Oppenheim, J. J. (2008). Eosinophil-derived neurotoxin acts as an alarmin to activate the TLR2-MyD88 signal pathway in dendritic cells and enhances Th2 immune responses. J. Exp. Med. 205, 79–90. Yoshida, T., Ikuta, K., Sugaya, H., Maki, K., Takagi, M., Kanazawa, H., Sunaga, S., Kinashi, T., Yoshimura, K., Miyazaki, J., Takaki, S., and Takatsu, K. (1996). Defective B-1 cell development and impaired immunity against Angiostrongylus cantonensis in IL-5Ra-deficient mice. Immunity 4, 483–494. Zahn, S., Godillot, P., Yoshimura, A., and Chaiken, I. (2000). IL-5-Induced JAB–JAK2 interaction. Cytokine 12, 299–306. Zhang, K., Mius, F. C., and Saxon, A. (1994). Switch circles from IL-4-directed class switching from human B Lymphocytes: Evidence for direct, sequential, and multiple step sequential switch from m to Ig heavy chain gene. J. Immunol. 152, 3427–3435. Zelazowski, P., Max, E. E., Kehry, M. R., and Snapper, C. M. (1997). Regulation of Ku expression in normal murine B cells by stimuli that promote switch recombination. J. Immunol. 159, 2559–2562.
SUBJECT INDEX A Activation induced cytidine deaminase, 163, 194 dependent mutation, 179 DNA–RNA hybrid, 169 mediated mutation, 179 SHM/CSR, 167 Activation receptors, 44. See also NK cell receptors hyporesponsiveness, 44 NKG2D receptor–ligand system, 42–43 physical interaction between Ly49D and H2Dd, 41–42 AID. See Activation induced cytidine deaminase Airway respiratory infections, 125 Alemtuzumab, 106 Allergic disease, 7, 19, 134, 195 Allergic inflammation, 126 animal models of, Fel d1, 132 cell functions in, 124 Allergic inflammation, in TSLP adaptive allergic immune responses, 6–8 CD4þ T cells, activation, 10–11 DC-induced Th2 responses, 9–10 DC maturation, 19 human atopic dermatitis and asthma, 8–9 innate allergic immune responses, 5–6 Th2 differentiation, 11 TSLP expression regulation, 11–12, 18 Antibody-dependent cell-mediated cytotoxicity (ADCC), 222 Antibody-producing plasma cells (ASC), 194 Antieosinophil therapeutics in development, 106–107 glucocorticoids, cyclosporine A, and a-interferon, 105 imatinib therapy and alemtuzumab, 106 Antigen presentation, 90–91 Antigen-presenting cells (APCs), 131 Antihistamines, 106 Anti-IgE antibody, 124, 132
Anti-IL-5 mAbs, 218 Arachidonic acid products as antieosinophil therapeutics, 106 in eosinophil trafficking, 95 ARI. See Airway respiratory infections Arming mechanism, 40–41 Asthma, 195 C57BL/6 background, 101 eosinophil-deficient mice, 100 MBP and LTs, 99 Atopic dermatitis, eosinophil role in IL-5, 102 MBP positive staining, 101 Autoimmune disease, 65 B BACs. See Bacterial artificial chromosomes Bacterial artificial chromosomes, 168 Bacterial infection, eosinophils role, 98–99 BAL. See Bronchoalveolar lavage Basal transcription, 148 Base excision repair, 167 Basophil/eosinophil characteristics, 125 Basophil granulocyte, 123 Basophilia, human IL-3, 125 Basophil participation in human disease allergic inflammation, 139–143 delayed-type hypersensitivity, 145–146 innate immune responses, 143–145 Basophil(s) allergic disease, 148 pathophysiology of, 126 b1-integrin expressed on, 126 CD203c and CD63 roles of, 133 CD69 expression on, 142 conceptual representation of, 151 IgE expression on, 131 IL-4/IL-13-producing capacity, 129 IL-4-producing cell, 149 IL-3 production autocrine effects of, 139
237
238
Subject Index
Basophil(s) (cont.) inflammatory mediators, 126 innate immunity, 144 in mouse models of TH2 inflammation, 146–151 B cell-deficient mice, 216 B cell maturation, 212 bc intracytoplasmic proteolysis (bIP), 199 BER. See Base excision repair b1integrins, 94 Blimp-1 gene, 214 Bronchoalveolar lavage fluids, 126 Btk-binding protein, 203 Btk-mutant mouse, 211 Btk, schematic illustration of, 205 C Calcium ionophores, 136 CD18 family of molecules, 94 cDNA microarray technology, 212 CD4þ T cell homeostasis, TSLP role in CD4þCD25þ Tregs, 16 CD28 signaling, 14 homeostatic proliferation, 15 mouse splenic DCs, 12–13 unified model of central tolerance, 16–17 Cell-surface markers activation-linked basophils express, 133 FceRIa molecules, 131 high affinity IgE receptor (FceRI), 130 mast cells, 132 basophil migration, 127–128 cytokine receptors basophil activity, 129 class of, 130 human basophils, 128 for pDCs, 128 innate immunity role for, 133 Toll-Like Receptors (TLR), 134 vascular cell adhesion molecule (VCAM-1), 127–128 Chemoattractant-homologous receptor, 127 Chemokines, eosinophil trafficking by, 93–94 Chromatin immunoprecipitation (ChIP), 180 Chronic eosinophilic leukemia (CEL), characterization, 104 Class switch recombination (CSR), 163–164, 194
CH gene isotype expression of, 209 chromosomal translocation, 183 evolution of, 182 IgH constant region, 165 IL-5-induced, molecular basis of, 213 S regions gene targeting based experimental system, 168 role of, 168 V regions, 174 Xenopus, 173 Common myeloid progenitors (CMPs), 200 Costimulatory molecules, expression, 89–90 Cutaneous basophilic hypersensitivity (CBH), 145 Cyclosporine A, 105 Cytokines in eosinophil trafficking, 91–92 in hematopoietic cell development, 84 production by eosinophil, 88 stimulation in NK cell tolerance, 57–59 Cytosolic calcium, importance, 137 D Ddbl-GATA mice, 100 Delayed-type hypersensitivity (DTH), 145 DGYW, tetramer sequence, 175–177 Disarming mechanism, 41 DNA traps, from neutrophils, 88 Double-strand breaks (DSBs), 167 role in AID target hotspots, 181 S regions, 180 E Ectoenzyme, CD203c marker, 133 Endosomal-associated tetraspanin protein, CD63, 133 Enhanced green fluorescent protein (eGFP), 148 EnsEMBL annotated mouse genome database, 178 Enzymatic digestion, of tissue, 136 Eosinophil cationic protein (ECP), 85 Eosinophil-derived neurotoxin (EDN), 86–87 Eosinophilic progenitors, 198 Eosinophil peroxidase (EPO), 86 Eosinophil progenitors (EoPs), 200
239
Subject Index
Eosinophils, 196 in asthma pathogenesis C57BL/6 background, 101 eosinophil-deficient mice, 100 MBP and LTs, 99 in atopic dermatitis pathogenesis IL-5, 102 MBP positive staining, 101 basic components of ECP, 85 EDN, 86–87 EPO, 86 MBP, 85–86 bone marrow Th2 cytokines, 195 cytokine production by, 88 differentiation of GM-CSF role in, 84 transcription factors involved in, 82–84 extracellular DNA traps, 88 in GI disorders eotaxin-3 expression, 103–104 murine models, 102 RANTES expression, 104 in hyper eosinophilic diseases, 104–105 and immune regulation antigen presentation and T cell proliferation, 90–91 mast cell regulation, 91 and reproduction implantation and pregnancy, 89 infiltration in uterus, 88 role in inflammatory processes bacterial infection, 98–99 helminth infection, 96–97 viral and fungal infection, 98 secretion/degranulation of, 87 thymic (see Thymic eosinophils) trafficking of adhesion molecules in, 94–95 arachidonic acid metabolites in, 95 chemokines in, 93–94 chitin in, 96 cytokines in, 91–93 EXC4 in, 95–96 negative regulation of, 96 Eotaxin-1/2/3 in asthmatic lung, 92, 94 expression by epithelial cells, 104 genetic manipulation of, 93 in mammary gland, 89
in human genome, 93 mice deficient in, 101 Epithelial cells, functions, 2 Escherichia coli, 204 F Fcg–Fce fusion protein, 132 Fetal tolerance, 65–66 FIP1L1-PDGFRA-transduced hematopoietic stem cells/progenitors (HSC/Ps) transplantation of, 104 Fungal infection, eosinophils role, 98 G GATA-1, in eosinophilic lineage, 84 Gene encoding Igh, 193 Germline-encoded receptors, 29 GI disorders eotaxin-3 expression, 103–104 murine models, 102 RANTES expression, 104 Glucocorticoids, 105 GM-CSF, eosinophil development, 84, 89 Granulocyte/monocyte progenitors (GMPs), 199 H Helminth infection models IL-5 role in, 97 propensity of eosinophils to, 96 Hematology, 124 Hematopoietic stem cells differentiation, 82 transplantation, 63–64 Human basophil cytokine responses prolonged calcium responses, importance, 136 Human basophil cytokine secretion IL-4, 134–137 IL-13, 137–138 IL-17 family member, 138 IL-3 receptor (IL-3R), 139 pro-Th2 activity, 138 Human basophils anaphylactic type reactions in, 140 CD40L, 132 cytokine receptors, 128 IgE/FceRI complexes, 138 IL-4, 138, 147 IL-13, 137
240
Subject Index
Human basophils (cont.) IL-8 and GM-CSF, 139 IL-3 protein, 138 IL-3 receptors, 139 IL-4 secretion, 138 inflammatory properties, 126 mRNA expression, 139 murine mast cells, 136 Human basophils responses, adaptive-and innate-immune stimuli, 135 Human immunodeficiency virus (HIV), gp120 glycoprotein, 143 Human recombinant histamine releasing factor (HrHRF), 129 Human TSLP (hTSLP), 3–4 Hypereosinophilic syndromes (HES), 196 cause of clonal, 104–105 first line therapy for, 106 mepolizumab for, 107 Hyper-responsive cells, 128 I ICAMs. See Intracellular adhesion molecules IgA-producing plasma cells IL-5-dependent B-1 cells, 207 mucosal tissues, 206 IgE binding, 131 IgE-dependent adaptive immune responses, 130 IgE-dependent cytokine responses, 137 IgG/basophil-dependent mechanism, 150 IgH locus, germline transcription, 180 IL-5 biologic effects of, 207 CD40-activated B cells maturation of, 210 genes, kinetics expression, 214 glycoprotein, 195 JAK1 and JAK2, 201 RT–PCR analysis, 197 Xid mouse, 202 IL-7, target cells, 3 IL-5 asthma, pathogenesis of, 192 augmentation of innate immune response B-1 cell growth, promotion of, 204–207 B-1 cell, schematic illustration of, 208 eosinophil function, 207 TLR activation, 207
in eosinophil lineage, 84 homodimeric glycoprotein, 192 links to innate disease model antibody-dependent cell-mediated cytotoxicity (ADCC), 222 atherosclerotic model, 217 contact sensitivity model, 216–217 IgH CSR, molecular mechanisms of, 221 IL-5 in allergy, 218–220 pleiotropic effects, 220 Stat5a and Stat5b, 221 mRNA expression, 197 signal transduction molecular basis of, 202 molecular mechanisms for, 204 IL-5 in allergy anti-IL-5 antibody, effect of eosinophilic disorders, 220 anti-IL-5 mAb in bronchial asthma, 218–219 in eosinophilic esophagitis, 219–220 anti-IL-5 mAb fin HES, 219 IL-5, modulating acquired immune responses B-2 cells into AFC, differentiation of, 208–209 class switch recombination AID, UNG, Bach2, and 53BP1, gene expression of, 211 CSR in B cells, 209 DNAdependent protein kinase catalytic subunit (DNA–PKcs), 210 genes, kinetics expression, 214 IL-4, 213 IL-4 on CD38-stimulated B cells, 214–215 m to g1 CSR, induction of, 212 representative signaling pathway, comparison of, 216 IL-5Ra expression, 200 of B cell progenitor expression of, 200 fetal liver, 199 on B-2 cells, 198 IL-5 receptor (IL-5R), a and bc chains, 192 IL-5-receptor-mediated signaling Btk activation, 202–203 JAK2 and STAT5 pathway, 201–202 Ras/ERK activation, 204
241
Subject Index
IL-5, stimulation AID, UNG, Bach2, and 53BP1 gene expression of, 211 Blimp-1 and Aid expression in aCD38-stimulated B cells, 214 Imatinib therapy, 106 Immune regulation and eosinophils antigen presentation and T cell proliferation, 90–91 mast cell regulation, 91 Immunoglobulin heavy (IgH), variable region, 164 Immunoglobulin-producing plasma cells, 133 Immunology, 124 Immunoreceptor tyrosine-based inhibitory motif (ITIM) of inhibitory Ly49 receptors, 41 in NK cell receptors, 29–30 phosphorylation, 50 role in licensing, 45–46 transgenic SHP-1, 45 Y-to-F mutation in, 40, 44 Inhibitory receptors, 29 Innate immunity, 125 Integrin a4b7, 94 Intercellular adhesion molecule (ICAM)–1 role in T-cell proliferation, 94 Interferon-alpha (IFN-a), 193 Interferon consensus sequence binding protein (Icsbp), 83–84 Interleukin-5. See IL-5 Intracellular adhesion molecules, 127 K Killer-cell immunoglobulin (Ig)-like receptors (KIRs), 29 and mouse Ly49s, comparison of, 30–31 KIR-HLA disease, 63 L Late phase response, 126 Leukocyte immunoglobulin-like receptors, 134 Licensed NK cells, licensing of cell-free antibody cross-linking, 34 H2b haplotype and Ly49–MHC interaction, 36 inhibitory receptor expression, 37 NK1.1 (Nkrp1c) expression, 35 Lidocaine, 106 Lipopolysacharride (LPS), 144
LIR. See Leukocyte immunoglobulin-like receptors LPR. See Late phase response Ly49Ahi NK cells, 33 Ly49Alow NK cells, 33 Ly49C surface expression on MHC-deficient cells, 33 Lymphocyte development, by TSLP, 3 Ly49 receptors apparent surface expression of MHC-dependent reduction in, 33–34 cis enlargement of downregulation of surface expression, 49 MHC class I ligand, 47–48 NK cell licensing, role in, 50–51 expression of cognate self-MHC ligands on NK cell, 51–52 and inhibitory human KIRs, comparison of, 30, 32 open and closed conformation, 49 transgenic SHP-1 acting on, 45 M Major basic protein (MBP) MBP-1 and MBP-2, 85 toxic effect of, 86 Major histocompatibility complex (MHC) class I ‘’missing self’’ hypothesis and, 29 Malondialdehyde-modified (MDA-modified), 217 Mammalian immune cell, 146 Mammalian S regions AGCT hotspots, 173 AID targeting, 173 dotplot analysis of, 172 G-rich, 169 sequence characteristics of, 170–171 variation of, 170, 173 Mammalian V genes, 175 Mast cell regulation, 91 Mast cells, stimulation of, 132, 208 Mediate CSR, non-S regions susceptibility, 179–180 Mepolizumab, prednisone-sparing effect, 107 MHC class I-deficient targets interactions of NK cells with mix of, 41–42 MHC class I-deficient NK cells response to, 33–34, 50 ‘’self-blind’’ cells and, 32
242
Subject Index
MHC-specific inhibitory receptors, ligands, 30 Mice infected, with Trichinella spiralis, 200 Mismatch repair (MMR), 167 ‘’Missing self’’ hypothesis, 29, 31–32 Monoclonal anti-CD52 antibody, 106 Monocyte chemotactic protein (MCP) family, 127 Mouse basophils, IL-4, 147 Mouse IgH locus, genetic alterations of, 165 Mouse S regions, G nucleotide bias, 178 Mouse TSLP (mTSLP), 3 Mouse V regions, S regions comparison, 178 Mycobacterium tuberculosis, 195 Myeloid DCs (mDC), activation by hTSLP, 4 N Natural killer cells. See NK cells Nerve growth factor (NGF), 129 Nippostrongylus brasiliensis, 134, 148 NK cell licensing activation receptors in, (see Activation receptors) cell type responsible for, 47 of human NK cells, 38 of licensed NK cells (see Licensed NK cells, licensing of ) during maturation in BM, 46 MHC class I gene dosage and affinity in, 38–39 self-MHC-specific receptor arming mechanism, 40–41 disarming mechanism, 41, 43 indirect effects and gene transfer, 40 signaling events mediated by, 44–46 of unlicensed NK cells hyporesponsiveness, 38 IFNg production and IL-2 stimulation, 37 NK cell receptors in human and mice, 29 KIR and Ly49 families, 29–31 MHC-specific inhibitory, 30 NK cells CD56dim and CD56bright populations, self-tolerance of, 52–53 germline-encoded receptors and, 29 licensing of (see NK cell licensing) ‘’missing self’’ hypothesis and, 29 self-tolerance activation receptor cooperation, 60–61 cytokine stimulation, 57–59
DCs and NKT cells role in, 61–62 due to Ly49H-m157 interaction, 43 hyporesponsiveness, 32 Ly49 receptors and KIRs, 32 in MHC class i chimeric and mosaic mice, 54–57 non-MHC-specific inhibitory receptors, 59–60 receptor calibration model, 33–34 self-MHC-specific receptors, 32–33 target cells, 31 Tregs influence on, 62 tolerance mechanisms, in clinic autoimmune disease, 65 fetal tolerance, 65–66 hematopoietic stem cell transplantation, 63–64 KIR-HLA disease associations and NK cell licensing, 63 tumor immunotherapy, 64–65 Nonhomologous end joining (NHEJ), 181 Nuclear factor of activated T cell (NFAT), importance, 137 O OVA-induced allergic airway inflammation, 101 OX40L signaling, 19 P Peptidoglycan (PGN), 144 Periostin, 95 PHIL mice, 100 Phosphorylcholine (PC), 204 PIR-B receptors cis interaction of, 49 Plasmacytoid dendritic cells (pDCs), 128 Prednisone-sparing therapy, 107 Prostaglandin D2 (PGD2), 128 PU.1 expression, 83 R Receptor calibration model, 33, 50 RFX DNA-binding protein family, 198 S Salmonella spp., 204 SCF. See Stem cell factor Self-MHC-specific receptor arming mechanism, 40–41
243
Subject Index
disarming mechanism, 41, 43 indirect effects and gene transfer, 40 signaling events mediated by, 44–46 Siglec-7, 49 Signal transduction IL-5 expression, regulation of, 196–197 IL-5 receptor expression B-2 cells, 198 eosinophilic progenitors, 198 eosinophils, 199–200 JAK kinase activity, 199 lysosome, 199 plasma cell differentiation program, 197 progenitors for B-1 cell, 199–200 SNAREs, classifications, 87 Somatic hypermutation (SHM), 163–164, 194 AID and S regions, 182 CSR, evolution model, 182 Ig and non-Ig genes, 175 point mutation generation model for, 166 Spleen tyrosine kinase (syk), 131 S region sequence composition, analysis of AGCT, DGYW and WRCH, 175–176 Stem cell factor, 125 Suppressor of cytokine synthesis (SOCS) genes, 130 T T cell proliferation, eosinophils role in, 90–91 T cell receptor (TCR), 194 Th2-type inflammation, allergic, 148 Thymic eosinophils, 89–90 Thymic stromal lymphopoietin (TSLP), 2 in allergic inflammation adaptive allergic immune responses, 6–8 CD4þ T cells, activation, 10–11 DC-induced Th2 responses, 9–10 DC maturation, 19 human atopic dermatitis and asthma, 8–9 innate allergic immune responses, 5–6 Th2 differentiation, 11 TSLP expression regulation, 11–12, 18 in CD4þ T cell homeostasis CD4þCD25þ Tregs, 16 CD28 signaling, 14 homeostatic proliferation, 15
mouse splenic DCs, 12–13 unified model of central tolerance, 16–17 expression of, 3 human mDC activation by, 4, 17 in lymphocyte development, 3 structure and function, 4 Tissue mast cell, 139 TLR. See Toll-Like Receptors TLR2 ligand, 141 Tolerance mechanisms, NK cells autoimmune disease, 65 fetal tolerance, 65–66 hematopoietic stem cell transplantation, 63–64 KIR-HLA disease associations and NK cell licensing, 63 tumor immunotherapy, 64–65 Toll-like receptor (TLR) family, 134, 193 Toxocara canis, 195 Transcription factors, in eosinophilic lineage C/EPB members, 82–83 Icsbp and GATA-1, 84 PU.1 expression, 83 Trichinella spiralis, 200 TSLPR. See TSLP receptor TSLPR chain, 3 TSLP receptor, 3–4 Tumor immunotherapy, 64–65 Tyrosine residues, nitration of, 87 U Uracil Nucleoside Glycosylase (UNG), 181 V Very late antigen (VLA)–4 molecules, 94, 127 Viral infection, role of eosinophils, 98 Viral internal ribosomal entry sequence (IRES), 148 X Xenopus tropicalis, 175 X-linked agammaglobulinemia (XLA), 202 XPF intron, 180 Y Yeast ISceI endonuclease, 181
CONTENTS OF RECENT VOLUMES Volume 85 Cumulative Subject Index Volumes 66–82
Volume 86 Adenosine Deaminase Deficiency: Metabolic Basis of Immune Deficiency and Pulmonary Inflammation Michael R. Blackburn and Rodney E. Kellems Mechanism and Control of V(D)J Recombination Versus Class Switch Recombination: Similarities and Differences Darryll D. Dudley, Jayanta Chaudhuri, Craig H. Bassing, and Frederick W. Alt Isoforms of Terminal Deoxynucleotidyltransferase: Developmental Aspects and Function To-Ha Thai and John F. Kearney Innate Autoimmunity Michael C. Carroll and V. Michael Holers Formation of Bradykinin: A Major Contributor to the Innate Inflammatory Response Kusumam Joseph and Allen P. Kaplan Interleukin-2, Interleukin-15, and Their Roles in Human Natural Killer Cells Brian Becknell and Michael A. Caligiuri Regulation of Antigen Presentation and Cross-Presentation in the Dendritic Cell Network: Facts, Hypothesis, and Immunological Implications Nicholas S. Wilson and Jose A. Villadangos Index
Volume 87 Role of the LAT Adaptor in T-Cell Development and Th2 Differentiation
Bernard Malissen, Enrique Aguado, and Marie Malissen The Integration of Conventional and Unconventional T Cells that Characterizes Cell-Mediated Responses Daniel J. Pennington, David Vermijlen, Emma L. Wise, Sarah L. Clarke, Robert E. Tigelaar, and Adrian C. Hayday Negative Regulation of Cytokine and TLR Signalings by SOCS and Others Tetsuji Naka, Minoru Fujimoto, Hiroko Tsutsui, and Akihiko Yoshimura Pathogenic T-Cell Clones in Autoimmune Diabetes: More Lessons from the NOD Mouse Kathryn Haskins The Biology of Human Lymphoid Malignancies Revealed by Gene Expression Profiling Louis M. Staudt and Sandeep Dave New Insights into Alternative Mechanisms of Immune Receptor Diversification Gary W. Litman, John P. Cannon, and Jonathan P. Rast The Repair of DNA Damages/ Modifications During the Maturation of the Immune System: Lessons from Human Primary Immunodeficiency Disorders and Animal Models Patrick Revy, Dietke Buck, Franc¸oise le Deist, and Jean-Pierre de Villartay Antibody Class Switch Recombination: Roles for Switch Sequences and Mismatch Repair Proteins Irene M. Min and Erik Selsing Index
245
246
Contents of Recent Volumes
Volume 88 CD22: A Multifunctional Receptor That Regulates B Lymphocyte Survival and Signal Transduction Thomas F. Tedder, Jonathan C. Poe, and Karen M. Haas Tetramer Analysis of Human Autoreactive CD4-Positive T Cells Gerald T. Nepom Regulation of Phospholipase C-g2 Networks in B Lymphocytes Masaki Hikida and Tomohiro Kurosaki Role of Human Mast Cells and Basophils in Bronchial Asthma Gianni Marone, Massimo Triggiani, Arturo Genovese, and Amato De Paulis A Novel Recognition System for MHC Class I Molecules Constituted by PIR Toshiyuki Takai Dendritic Cell Biology Francesca Granucci, Maria Foti, and Paola Ricciardi-Castagnoli The Murine Diabetogenic Class II Histocompatibility Molecule I-Ag7: Structural and Functional Properties and Specificity of Peptide Selection Anish Suri and Emil R. Unanue RNAi and RNA-Based Regulation of Immune System Function Dipanjan Chowdhury and Carl D. Novina Index
Lysophospholipids as Mediators of Immunity Debby A. Lin and Joshua A. Boyce Systemic Mastocytosis Jamie Robyn and Dean D. Metcalfe Regulation of Fibrosis by the Immune System Mark L. Lupher, Jr. and W. Michael Gallatin Immunity and Acquired Alterations in Cognition and Emotion: Lessons from SLE Betty Diamond, Czeslawa Kowal, Patricio T. Huerta, Cynthia Aranow, Meggan Mackay, Lorraine A. DeGiorgio, Ji Lee, Antigone Triantafyllopoulou, Joel Cohen-Solal Bruce, and T. Volpe Immunodeficiencies with Autoimmune Consequences Luigi D. Notarangelo, Eleonora Gambineri, and Raffaele Badolato Index
Volume 90 Cancer Immunosurveillance and Immunoediting: The Roles of Immunity in Suppressing Tumor Development and Shaping Tumor Immunogenicity Mark J. Smyth, Gavin P. Dunn, and Robert D. Schreiber
Volume 89
Mechanisms of Immune Evasion by Tumors Charles G. Drake, Elizabeth Jaffee, and Drew M. Pardoll
Posttranscriptional Mechanisms Regulating the Inflammatory Response Georg Stoecklin Paul Anderson
Development of Antibodies and Chimeric Molecules for Cancer Immunotherapy Thomas A. Waldmann and John C. Morris
Negative Signaling in Fc Receptor Complexes Marc Dae¨ron and Renaud Lesourne
Induction of Tumor Immunity Following Allogeneic Stem Cell Transplantation Catherine J. Wu and Jerome Ritz
The Surprising Diversity of Lipid Antigens for CD1-Restricted T Cells D. Branch Moody
Vaccination for Treatment and Prevention of Cancer in Animal Models
Contents of Recent Volumes
Federica Cavallo, Rienk Offringa, Sjoerd H. van der Burg, Guido Forni, and Cornelis J. M. Melief Unraveling the Complex Relationship Between Cancer Immunity and Autoimmunity: Lessons from Melanoma and Vitiligo Hiroshi Uchi, Rodica Stan, Mary Jo Turk, Manuel E. Engelhorn, Gabrielle A. Rizzuto, Stacie M. Goldberg, Jedd D. Wolchok, and Alan N. Houghton Immunity to Melanoma Antigens: From Self-Tolerance to Immunotherapy Craig L. Slingluff, Jr., Kimberly A. Chianese-Bullock, Timothy N. J. Bullock, William W. Grosh, David W. Mullins, Lisa Nichols, Walter Olson, Gina Petroni, Mark Smolkin, and Victor H. Engelhard Checkpoint Blockade in Cancer Immunotherapy Alan J. Korman, Karl S. Peggs, and James P. Allison Combinatorial Cancer Immunotherapy F. Stephen Hodi and Glenn Dranoff Index
Volume 91 A Reappraisal of Humoral Immunity Based on Mechanisms of AntibodyMediated Protection Against Intracellular Pathogens Arturo Casadevall and Liise-anne Pirofski Accessibility Control of V(D)J Recombination Robin Milley Cobb, Kenneth J. Oestreich, Oleg A. Osipovich, and Eugene M. Oltz Targeting Integrin Structure and Function in Disease
247
Donald E. Staunton, Mark L. Lupher, Robert Liddington, and W. Michael Gallatin Endogenous TLR Ligands and Autoimmunity Hermann Wagner Genetic Analysis of Innate Immunity Kasper Hoebe, Zhengfan Jiang, Koichi Tabeta, Xin Du, Philippe Georgel, Karine Crozat, and Bruce Beutler TIM Family of Genes in Immunity and Tolerance Vijay K. Kuchroo, Jennifer Hartt Meyers, Dale T. Umetsu, and Rosemarie H. DeKruyff Inhibition of Inflammatory Responses by Leukocyte Ig-Like Receptors Howard R. Katz Index
Volume 92 Systemic Lupus Erythematosus: Multiple Immunological Phenotypes in a Complex Genetic Disease Anna-Marie Fairhurst, Amy E. Wandstrat, and Edward K. Wakeland Avian Models with Spontaneous Autoimmune Diseases Georg Wick, Leif Andersson, Karel Hala, M. Eric Gershwin,Carlo Selmi, Gisela F. Erf, Susan J. Lamont, and Roswitha Sgonc Functional Dynamics of Naturally Occurring Regulatory T Cells in Health and Autoimmunity Megan K. Levings, Sarah Allan, Eva d’Hennezel, and Ciriaco A. Piccirillo BTLA and HVEM Cross Talk Regulates Inhibition and Costimulation
248
Contents of Recent Volumes
Maya Gavrieli, John Sedy, Christopher A. Nelson, and Kenneth M. Murphy The Human T Cell Response to Melanoma Antigens Pedro Romero, Jean-Charles Cerottini, and Daniel E. Speiser Antigen Presentation and the Ubiquitin-Proteasome System in Host–Pathogen Interactions Joana Loureiro and Hidde L. Ploegh Index
Volume 93 Class Switch Recombination: A Comparison Between Mouse and Human Qiang Pan-Hammarstro¨m, Yaofeng Zhao, and Lennart Hammarstro¨m Anti-IgE Antibodies for the Treatment of IgE-Mediated Allergic Diseases Tse Wen Chang, Pheidias C. Wu, C. Long Hsu, and Alfur F. Hung Immune Semaphorins: Increasing Members and Their Diverse Roles Hitoshi Kikutani, Kazuhiro Suzuki, and Atsushi Kumanogoh Tec Kinases in T Cell and Mast Cell Signaling Martin Felices, Markus Falk, Yoko Kosaka, and Leslie J. Berg Integrin Regulation of Lymphocyte Trafficking: Lessons from Structural and Signaling Studies Tatsuo Kinashi Regulation of Immune Responses and Hematopoiesis by the Rap1 Signal Nagahiro Minato, Kohei Kometani, and Masakazu Hattori Lung Dendritic Cell Migration Hamida Hammad and Bart N. Lambrecht Index
Volume 94 Discovery of Activation-Induced Cytidine Deaminase, the Engraver of Antibody Memory Masamichi Muramatsu, Hitoshi Nagaoka, Reiko Shinkura, Nasim A. Begum, and Tasuku Honjo DNA Deamination in Immunity: AID in the Context of Its APOBEC Relatives Silvestro G. Conticello, Marc-Andre Langlois, Zizhen Yang, and Michael S. Neuberger The Role of Activation-Induced Deaminase in Antibody Diversification and Chromosome Translocations Almudena Ramiro, Bernardo Reina San-Martin, Kevin McBride, Mila Jankovic, Vasco Barreto, Andre´ Nussenzweig, and Michel C. Nussenzweig Targeting of AID-Mediated Sequence Diversification by cis-Acting Determinants Shu Yuan Yang and David G. Schatz AID-Initiated Purposeful Mutations in Immunoglobulin Genes Myron F. Goodman, Matthew D. Scharff, and Floyd E. Romesberg Evolution of the Immunoglobulin Heavy Chain Class Switch Recombination Mechanism Jayanta Chaudhuri, Uttiya Basu, Ali Zarrin, Catherine Yan, Sonia Franco, Thomas Perlot, Bao Vuong, Jing Wang, Ryan T. Phan, Abhishek Datta, John Manis, and Frederick W. Alt Beyond SHM and CSR: AID and Related Cytidine Deaminases in the Host Response to Viral Infection Brad R. Rosenberg and F. Nina Papavasiliou Role of AID in Tumorigenesis Il-mi Okazaki, Ai Kotani, and Tasuku Honjo
Contents of Recent Volumes
Pathophysiology of B-Cell Intrinsic Immunoglobulin Class Switch Recombination Deficiencies Anne Durandy, Nadine Taubenheim, Sophie Peron, and Alain Fischer Index
Volume 95 Fate Decisions Regulating Bone Marrow and Peripheral B Lymphocyte Development John G. Monroe and Kenneth Dorshkind Tolerance and Autoimmunity: Lessons at the Bedside of Primary Immunodeficiencies Magda Carneiro-Sampaio and Antonio Coutinho B-Cell Self-Tolerance in Humans Hedda Wardemann and Michel C. Nussenzweig Manipulation of Regulatory T-Cell Number and Function with CD28Specific Monoclonal Antibodies Thomas Hu¨nig Osteoimmunology: A View from the Bone Jean-Pierre David Mast Cell Proteases ˚ brink, Gunnar Pejler, Magnus A Maria Ringvall, and Sara Wernersson Index
Volume 96 New Insights into Adaptive Immunity in Chronic Neuroinflammation Volker Siffrin, Alexander U. Brandt, Josephine Herz, and Frauke Zipp Regulation of Interferon-g During Innate and Adaptive Immune Responses Jamie R. Schoenborn and Christopher B. Wilson
249
The Expansion and Maintenance of Antigen-Selected CD8þ T Cell Clones Douglas T. Fearon Inherited Complement Regulatory Protein Deficiency Predisposes to Human Disease in Acute Injury and Chronic Inflammatory States Anna Richards, David Kavanagh, and John P. Atkinson Fc-Receptors as Regulators of Immunity Falk Nimmerjahn and Jeffrey V. Ravetch Index
Volume 97 T Cell Activation and the Cytoskeleton: You Can’t Have One Without the Other Timothy S. Gomez and Daniel D. Billadeau HLA Class II Transgenic Mice Mimic Human Inflammatory Diseases Ashutosh K. Mangalam, Govindarajan Rajagopalan, Veena Taneja, and Chella S. David Roles of Zinc and Zinc Signaling in Immunity: Zinc as an Intracellular Signaling Molecule Toshio Hirano, Masaaki Murakami, Toshiyuki Fukada, Keigo Nishida, Satoru Yamasaki, and Tomoyuki Suzuki The SLAM and SAP Gene Families Control Innate and Adaptive Immune Responses Silvia Calpe, Ninghai Wang, Xavier Romero, Scott B. Berger, Arpad Lanyi, Pablo Engel, and Cox Terhorst Conformational Plasticity and Navigation of Signaling Proteins in Antigen-Activated B Lymphocytes Niklas Engels, Michael Engelke, and Ju¨rgen Wienands Index
250
Contents of Recent Volumes
Volume 98 Immune Regulation by B Cells and Antibodies: A View Towards the Clinic Kai Hoehlig, Vicky Lampropoulou, Toralf Roch, Patricia Neves, Elisabeth Calderon-Gomez, Stephen M. Anderton, Ulrich Steinhoff, and Simon Fillatreau Cumulative Environmental Changes, Skewed Antigen Exposure, and the Increase of Allergy Tse Wen Chang and Ariel Y. Pan New Insights on Mast Cell Activation via the High Affinity Receptor for IgE Juan Rivera, Nora A. Fierro, Ana Olivera, and Ryo Suzuki B Cells and Autoantibodies in the Pathogenesis of Multiple Sclerosis and Related Inflammatory Demyelinating Diseases Katherine A. McLaughlin and Kai W. Wucherpfennig Human B Cell Subsets Stephen M. Jackson, Patrick C. Wilson, Judith A. James, and J. Donald Capra
Pathogenesis of Myocarditis and Dilated Cardiomyopathy Daniela Cihakova and Noel R. Rose Emergence of the Th17 Pathway and Its Role in Host Defense Darrell B. O’Quinn, Matthew T. Palmer, Yun Kyung Lee, and Casey T. Weaver Peptides Presented In Vivo by HLA-DR in Thyroid Autoimmunity Laia Muixı´, In˜aki Alvarez, and Dolores Jaraquemada Index
Volume 100 Autoimmune Diabetes Mellitus—Much Progress, but Many Challenges Hugh O. McDevitt and Emil R. Unanue CD3 Antibodies as Unique Tools to Restore Self-Tolerance in Established Autoimmunity: Their Mode of Action and Clinical Application in Type 1 Diabetes Sylvaine You, Sophie Candon, Chantal Kuhn, Jean-Franc¸ois Bach, and Lucienne Chatenoud
Index
GAD65 Autoimmunity—Clinical Studies ˚ ke Lernmark Raivo Uibo and A
Volume 99
CD8þ T Cells in Type 1 Diabetes Sue Tsai, Afshin Shameli, and Pere Santamaria
Cis-Regulatory Elements and Epigenetic Changes Control Genomic Rearrangements of the IgH Locus Thomas Perlot and Frederick W. Alt DNA-PK: The Means to Justify the Ends? Katheryn Meek, Van Dang, and Susan P. Lees-Miller Thymic Microenvironments for T-Cell Repertoire Formation Takeshi Nitta, Shigeo Murata, Tomoo Ueno, Keiji Tanaka, and Yousuke Takahama
Dysregulation of T Cell Peripheral Tolerance in Type 1 Diabetes R. Tisch and B. Wang Gene–Gene Interactions in the NOD Mouse Model of Type 1 Diabetes William M. Ridgway, Laurence B. Peterson, John A. Todd, Dan B. Rainbow, Barry Healy, and Linda S. Wicker Index
