Contents
Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
i...
161 downloads
1086 Views
3MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
Contents
Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
ix
Class Switch Recombination: A Comparison Between Mouse and Human Qiang Pan-Hammarstro¨m, Yaofeng Zhao, and Lennart Hammarstro¨m 1. 2. 3. 4.
Abstract. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Mechanism of CSR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Comparison Between Human and Mouse . . . . . . . . . . . . . . . . . . . . Concluding Remarks . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
1 1 2 15 42 43
Anti-IgE Antibodies for the Treatment of IgE-Mediated Allergic Diseases Tse Wen Chang, Pheidias C. Wu, C. Long Hsu, and Alfur F. Hung Abstract. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Rationale Leading to the Invention of the Anti-IgE Concept. . . . . Anti-IgE Is Approved for Treating Moderate-to-Severe Asthma . . Studies on Other Allergic Diseases . . . . . . . . . . . . . . . . . . . . . . . . . The Potential of Using Anti-IgE to Assist Allergen-Based Immunotherapy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6. Pivotal Roles of IgE and FceRI in Type I Hypersensitivity . . . . . . 7. Neutralization of Free IgE. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8. Downregulation of FceRI. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1. 2. 3. 4. 5.
v
63 64 67 73 78 83 85 88 90
c on t e n ts
vi
9. Potential Beneficial Effects of IgE:Anti-IgE Immune Complexes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10. Can Anti-IgE Modulate IgE-Committed B Lymphoblasts and Memory B Cell? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11. Other Immunoregulatory Effects of Anti-IgE . . . . . . . . . . . . . . . . . 12. Can Anti-IgE Attain a Long-Term Remission State?. . . . . . . . . . . . 13. Are There Adverse Effects Associated with Anti-IgE Therapy? . . . 14. Other Approaches for Targeting IgE or IgE-Expressing B Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15. Concluding Remarks. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
93 96 98 100 101 103 106 107
Immune Semaphorins: Increasing Members and Their Diverse Roles Hitoshi Kikutani, Kazuhiro Suzuki, and Atsushi Kumanogoh 1. 2. 3. 4. 5. 6. 7.
Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Sema4D . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Sema4A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Sema6D and Its Receptor Plexin-A1 . . . . . . . . . . . . . . . . . . . . . . . . Sema7A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Other Semaphorins. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Summary and Perspectives . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
121 121 122 127 130 135 137 138 139
Tec Kinases in T Cell and Mast Cell Signaling Martin Felices, Markus Falk, Yoko Kosaka, and Leslie J. Berg 1. 2. 3. 4. 5. 6. 7.
Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Subcellular Localization of Tec Kinases . . . . . . . . . . . . . . . . . . . . . . Tec Kinases in Signaling Pathways . . . . . . . . . . . . . . . . . . . . . . . . . . Regulation of Tec Kinase Activation . . . . . . . . . . . . . . . . . . . . . . . . Distinct Versus Redundant Functions of Tec Kinases . . . . . . . . . . . Tec Kinases in Mast Cell Signaling . . . . . . . . . . . . . . . . . . . . . . . . . Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
145 145 147 151 160 163 166 172 172
c o nt e n t s
vii
Integrin Regulation of Lymphocyte Trafficking: Lessons from Structural and Signaling Studies Tatsuo Kinashi Abstract. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Leukocyte Integrins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Affinity and Valency Regulation . . . . . . . . . . . . . . . . . . . . . . . . . . . . Integrin Conformational Changes . . . . . . . . . . . . . . . . . . . . . . . . . . Integrin-Mediated Adhesion Steps in Lymphocyte Trafficking . . . . Talin as Intracellular Regulator for Lymphocyte Adhesion and Migration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7. Intracellular Signals in Chemokine-Induced Adhesion and Migration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8. Inside-Out Signaling Events in TCR-Stimulated Lymphocytes . . . 9. Concluding Remarks . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1. 2. 3. 4. 5. 6.
185 185 186 189 189 195 201 203 211 215 216
Regulation of Immune Responses and Hematopoiesis by the Rap1 Signal Nagahiro Minato, Kohei Kometani, and Masakazu Hattori Abstract. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2. General Biology of the Rap1 Signal. . . . . . . . . . . . . . . . . . . . . . . . . 3. Rap1 Signal in Lymphocyte Development and Immune Responses . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4. Rap1 Signal in Hematopoiesis and Leukemia . . . . . . . . . . . . . . . . . 5. Rap1 Signal in Malignancy: New Aspects in Cancer. . . . . . . . . . . . 6. Conclusions and Perspectives. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
229 229 230 237 248 253 255 256
Lung Dendritic Cell Migration Hamida Hammad and Bart N. Lambrecht Abstract. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2. Airway DC Subsets: Localization and Phenotype . . . . . . . . . . . . . . 3. Recruitment of DCs to the Lung. . . . . . . . . . . . . . . . . . . . . . . . . . .
265 265 266 267
viii
c on t e n ts
4. Migration of Airway DCs to the LNs. . . . . . . . . . . . . . . . . . . . . . . . 5. Recruitment of pDCs to the Sites of Inflammation. . . . . . . . . . . . . 6. Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
269 272 272 273
Index. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 279 Contents of Recent Volumes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 291
Contributors
Numbers in parentheses indicate the pages on which the authors’ contributions begin.
Leslie J. Berg (145), Department of Pathology, University of Massachusetts Medical School, Massachusetts Tse Wen Chang (63), Genomics Research Center, Academia Sinica, Nankang, Taipei 115, Taiwan Markus Falk (145), Department of Pathology, University of Massachusetts Medical School, Massachusetts Martin Felices (145), Department of Pathology, University of Massachusetts Medical School, Massachusetts Hamida Hammad (265), Department of Pulmonary Medicine, Erasmus Medical Center, Dr Molewaterplein 50, 3015 GE Rotterdam, The Netherlands Lennart Hammarstro¨m (1), Department of Laboratory Medicine, Division of Clinical Immunology, Karolinska University Hospital Huddinge, SE-14186 Stockholm, Sweden Masakazu Hattori (229), Department of Immunology and Cell Biology, Graduate School of Biostudies, Kyoto University, Kyoto, Japan C. Long Hsu (63), Genomics Research Center, Academia Sinica, Nankang, Taipei 115, Taiwan; Department of Life Science, National Tsing Hua University, Hsinchu 300, Taiwan Alfur F. Hung (63), Genomics Research Center, Academia Sinica, Nankang, Taipei 115, Taiwan; Department of Life Science, National Tsing Hua University, Hsinchu 300, Taiwan Hitoshi Kikutani (121), Department of Molecular Immunology and CREST Program of JST, Research Institute for Microbial Diseases, Osaka University, Suita, Osaka 5650871, Japan Tatsuo Kinashi (185), Department of Molecular Genetics, Institute of Biomedical Science, Kansai Medical University, Kyoto 606, Japan Kohei Kometani (229), Department of Immunology and Cell Biology, Graduate School of Biostudies, Kyoto University, Kyoto, Japan ix
x
c o n tr i b u t o rs
Yoko Kosaka (145), Department of Pathology, University of Massachusetts Medical School, Massachusetts Atsushi Kumanogoh (121), Department of Immunopathology, Research Institute for Microbial Diseases, Osaka University, Suita, Osaka 5650871, Japan Bart N. Lambrecht (265), Department of Pulmonary Medicine, Erasmus Medical Center, Dr Molewaterplein 50, 3015 GE Rotterdam, The Netherlands Nagahiro Minato (229), Department of Immunology and Cell Biology, Graduate School of Biostudies, Kyoto University, Kyoto, Japan Qiang Pan-Hammarstro¨m (1), Department of Laboratory Medicine, Division of Clinical Immunology, Karolinska University Hospital Huddinge, SE-14186 Stockholm, Sweden Kazuhiro Suzuki (121), Department of Molecular Immunology and CREST Program of JST, Research Institute for Microbial Diseases, Osaka University, Suita, Osaka 5650871, Japan Pheidias C. Wu (63), Genomics Research Center, Academia Sinica, Nankang, Taipei 115, Taiwan; Department of Life Science, National Tsing Hua University, Hsinchu 300, Taiwan Yaofeng Zhao (1), Department of Laboratory Medicine, Division of Clinical Immunology, Karolinska University Hospital Huddinge, SE-14186 Stockholm, Sweden
Class Switch Recombination: A Comparison Between Mouse and Human Qiang Pan‐Hammarstro¨m, Yaofeng Zhao, and Lennart Hammarstro¨m Department of Laboratory Medicine, Division of Clinical Immunology, Karolinska University Hospital Huddinge, SE‐14186 Stockholm, Sweden
1. 2. 3. 4.
Abstract............................................................................................................. 1 Introduction ....................................................................................................... 1 Mechanism of CSR.............................................................................................. 2 Comparison Between Human and Mouse ................................................................ 15 Concluding Remarks............................................................................................ 42 References ......................................................................................................... 43
Abstract Humans and mice separated more than 60 million years ago. Since then, evolution has led to a multitude of changes in their genomic sequences. The divergence of genes has resulted in differences both in the innate and adaptive immune systems. In this chapter, we focus on species difference with regard to immunoglobulin class switch recombination (CSR). We have compared the immunoglobulin constant region gene loci from human and mouse, with an emphasis on the switch regions, germ line transcription promoters, and 30 enhancers. We have also compared pathways/factors that are involved in CSR. Although there are remarkable similarities in the cellular machinery involved in CSR, there are also a number of unique features in each species.
1. Introduction Owing to development of the gene ‘‘knockout’’ technology, Mus musculus has emerged as a leading mammalian system for biomedical research over the past decades. Mouse models have served as surrogates for exploring human physiology and pathology, leading to major discoveries in many areas of biomedical research, including immunology. The availability of the human, mouse, and rat genome sequences (Gibbs et al., 2004; Lander et al., 2001; Venter et al., 2001; Waterston et al., 2002) has provided possibilities for cataloging the murine orthologs of human genes and allowed a way to identify and to perform functional studies on human disease associated genes.
1 advances in immunology, vol. 93 # 2007 Elsevier Inc. All rights reserved.
0065-2776/07 $35.00 DOI: 10.1016/S0065-2776(06)93001-6
2
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
One concern, however, is if mouse models faithfully represent human disease processes or not. Humans and mice separated more than 60 million years ago (Madsen et al., 2001; Murphy et al., 2001). Since then, evolution has led to a multitude of changes in their genomic sequences, including mutations, insertions, deletions, and duplications. The average divergence rate is about one substitution for every two nucleotides (Waterston et al., 2002) and genes encoding various classes of proteins have evolved with different paces. One notable set of proteins that seem to be under positive or purifying selection, and thus evolves rapidly, are those implicated in host defense (Waterston et al., 2002). The divergence of genes in the mouse and human genomes has resulted in differences both in the innate and in the adaptive immune systems, leading to development of different pathways, involving a variety of chemical messengers. In this chapter, we will highlight some of these differences and address species differences related to immunoglobulin (Ig) class switch recombination (CSR). 2. Mechanism of CSR 2.1. Class Switch Recombination ‘‘ABC’’ The first antibodies produced in a humoral immune response are of the IgM class. Activated B cells subsequently undergo isotype switching to secrete antibodies of different isotypes: IgG, IgA, and IgE. Isotype switching does not affect the antibody specificity, but alters the effector functions of the antibody. The change in antibody class is effectuated by a deletional recombination event called class switch recombination (CSR), where the constant region gene of the m heavy chain (Cm) is replaced by a downstream CH gene (Cg, Ca, or Ce) and intervening sequences are excised as circular DNA (Iwasato et al., 1990; Matsuoka et al., 1990; von Schwedler et al., 1990). CSR involves DNA regions, called ‘‘switch (S) regions,’’ that are located in the intron upstream of each C region gene. S regions are composed of tandemly repeated sequences that contain common pentamer sequences (GAGCT and GGGGT), but differ in length and degree of sequence similarity with Sm. CSR is a unique form of recombination. It is referred to as a ‘‘region‐specific’’ rather than ‘‘site‐specific’’ process, as no consensus sequence has been identified at the junctions of recombined S regions. It is also distinct from homologous recombination (HR), as it does not depend on a long stretch of homology between the sequences involved. CSR is influenced in both a positive and a negative manner by a number of cytokines and B cell activators. The mechanism involved is partly mediated through the ability of cytokines and activators to regulate transcription of unrearranged CH genes prior to CSR, yielding what are referred to as germ line (GL) transcripts (Stavnezer‐Nordgren and Sirlin, 1986; Yancopoulos et al., 1986).
C L A S S S W I T C H R E C O M B I N AT I O N
3
GL transcripts all have a similar structure, resulting from the initiation of transcription from an I (intervening) exon upstream of the S region and are spliced to the first exon of the corresponding CH gene. GL transcripts are required for CSR, and targeting of CSR to a given C region gene is considered to be tightly correlated with transcription from the corresponding upstream GL promoter (Chaudhuri et al., 2004; Stavnezer, 1996). At the DNA level, CSR is initiated by activation‐induced deaminase (AID; Muramatsu et al., 2000; Revy et al., 2000), probably by deamination of dC residues within the S regions. The initial lesions are subsequently processed and DNA double strand breaks (DSBs) are introduced that may lead to recombination of the two S regions involved. These processes require activation of a number of DNA damage response/repair pathways, including ataxia‐telangiectasia mutated (ATM)/ataxia‐telangiectasia and Rad3‐related (ATR)‐dependent signaling, base excision repair (BER), mismatch repair (MMR), and nonhomologous end joining (NHEJ; Chaudhuri and Alt, 2004). 2.2. V(D)J Recombination and CSR Mammalian organisms require an additional form of DNA recombination, V(D)J recombination, in order to produce functional antibody encoding genes. V(D)J recombination mediates assembly of the gene segments that encode the Ig heavy‐ and light‐chain variable domains. It is distinct from CSR in several regards: it occurs early in B cell development in the bone marrow; it is initiated by the lymphocyte‐specific proteins RAG1 and RAG2 instead of AID; it proceeds through precise DNA cleavage at conserved signal sequences and is therefore a ‘‘site‐specific’’ rather than a ‘‘region‐specific’’ recombination process (Dudley et al., 2005; Jung and Alt, 2004; Schatz, 2004). There are, however, also similarities between the two types of recombination. Both V(D)J recombination and CSR involve DNA deletion by a mechanism whereby intervening sequences are excised as circular DNA. Moreover, CSR resembles V(D)J recombination in that DSBs are generated during the switch reaction (Catalan et al., 2003; Schrader et al., 2005; Wuerffel et al., 1997). Furthermore, components of the NHEJ machinery are implicated in resolution of the DSBs in both recombination processes (Chaudhuri and Alt, 2004; Lieber et al., 2004), whereas other DNA repair pathways/factors appear to be more ‘‘CSR specific’’ or ‘‘V(D)J specific’’ (see discussion in Section 2.5.3). 2.3. CSR and Somatic Hypermutation Somatic hypermutation (SHM), a process where point mutations are introduced at a high rate into the Ig variable (V) genes, helps shape the Ig repertoire and, similar to CSR, occurs in the germinal center. Both SHM and CSR require
4
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
transcription through the targeted regions and are initiated by the B cell‐specific factor AID (Muramatsu et al., 2000; Revy et al., 2000). Resolution of the initial lesions in the V and S region genes is, however, somewhat different (see discussion in Section 2.5.3), and DSBs seem not to be prominent intermediates. Instead, single‐strand breaks (SSBs) or single‐strand nicks appear to be essential in SHM (Faili et al., 2002b; Li et al., 2004b; Neuberger et al., 2005). 2.4. Function of AID AID was discovered by Honjo and coworkers and shown to be a B cell factor that is essential for both SHM and CSR (Muramatsu et al., 1999, 2000). AID‐ deficient mice are devoid of both SHM and CSR (Muramatsu et al., 2000), as are patients with an autosomal recessive form of the hyper‐IgM syndrome (HIGM2), caused by mutations in the human AID‐encoding gene (Revy et al., 2000). Ectopic expression of AID in nonlymphoid cells is sufficient to induce both SHM and CSR, suggesting that it is the only B cell‐specific factor needed for these processes (Martin et al., 2002; Okazaki et al., 2002; Yoshikawa et al., 2002). AID is also essential for gene conversion (Arakawa et al., 2002; Harris et al., 2002), which is the dominant mechanism for V region diversification in selected animal species, including chickens and possibly sheep. AID was initially thought to edit mRNA, as it shares a high degree of sequence homology with the RNA‐editing enzyme APOBEC‐1 (apolipoprotein B mRNA editing catalytic polypeptide 1). In this model, AID deaminates cytosines to uracils in the mRNA encoding a ubiquitously expressed, as yet undefined factor(s) that is essential for both SHM and CSR. Although there is some evidence that supports this model (Begum et al., 2004; Doi et al., 2003; Ito et al., 2004), there is an increasing wealth of data supporting a DNA deamination model, where AID initiates SHM and CSR by converting the cytosines in DNA to uracils (for review see Honjo et al., 2005; Lee et al., 2004). AID preferentially deaminates single‐stranded DNA (ssDNA) in vitro (Bransteitter et al., 2003; Chaudhuri et al., 2003; Dickerson et al., 2003; Ramiro et al., 2003) and the deamination of C is most prominent within WRC sequences (Pham et al., 2003; Yu et al., 2004), reflecting the in vivo SHM hotspots (RGYW/WRCY motifs; Milstein et al., 1998). The AID‐ mediated cytidine deamination also seems to be targeted by transcription (Chaudhuri et al., 2003; Ramiro et al., 2003), a process that may provide AID substrates by exposing short stretches of ssDNA during elongation or by generating secondary structures like ‘‘R loops,’’ where transcripts hybridize to the template strand, forming long stretches of single‐stranded regions on the nontemplate strand. Importantly, these ‘‘R loops’’ have previously been implicated in CSR (Yu et al., 2003). No ‘‘R loops’’ can, however, be formed in
C L A S S S W I T C H R E C O M B I N AT I O N
5
the V regions during SHM, and another mechanism, involving replication protein A (RPA), a ssDNA‐binding protein, has been proposed (Chaudhuri et al., 2004). RPA interacts specifically with AID in activated B cells and the RPA–AID complex is thought to bind to and stabilize short ssDNA sequences at the transient transcription bubbles, with a preference for RGYW motifs (Chaudhuri et al., 2004). RPA also binds to S regions in an AID‐dependent fashion and the RPA– AID complex may have a potential role in targeting S region sequences, which are also rich in RGYW motifs (Chaudhuri et al., 2004). These in vitro biochemical studies have provided an explanation for the link between the CSR and SHM requirements for transcription and AID‐dependent DNA deamination. 2.5. dU:dG Mismatches Processing and DNA DSB Resolution in CSR 2.5.1. dU: Mismatches in CSR The dU:dG mismatches resulting from AID activity can be repaired, replicated over (introducing transition mutations at G/C sites) or processed to initiate CSR or SHM. Both the base excision (uracil DNA glycosylase, UNG) and MMR (MSH2) pathways can recognize dU:dG pairs, and based on the different consequences of UNG deficiency (Rada et al., 2002), MSH2 deficiency (Ehrenstein and Neuberger, 1999; Schrader et al., 1999), and UNG–MSH2 double deficiency (Rada et al., 2004), the major pathway for CSR has been suggested to be dependent on UNG activity whereas the MSH2‐dependent pathway serves as a backup. In the UNG‐dependent pathway, the uracil base can be removed by UNG, generating an abasic site that is then recognized by an apurinic/apyrimidic (AP) endonuclease (APE or APEX), which in turn produces a nick. Closely positioned nicks on both strands could theoretically convert the SSBs to DSBs that are required for CSR. In the MSH2‐dependent pathway, the dU:dG mismatches would be recognized by the MMR proteins and single‐strand nicks may be introduced which eventually leads to the formation of DSBs (Stavnezer and Schrader, 2005). One question that remains is which endonuclease actually cleaves at the abasic site. APE1 (APEX1) is the major APE in mammalian cells (Demple et al., 1991; Robson and Hickson, 1991; Xanthoudakis and Curran, 1992), but its potential role in CSR has not been documented. A second APE, APEX2, has also been identified (Hadi and Wilson, 2000; Ide et al., 2003). Mice with a targeted inactivation of the APEX2 gene show thymic atrophy, reduced number of B cells, and attenuated immune responses, suggesting that APEX2 may have unique functional properties that cannot be compensated by APEX1 (Ide et al., 2004). However, thus far, there is no evidence to support the notion that APEX2 is involved in CSR. Another pathway, mediated by Mre11/Rad 50, has recently been proposed by Maizels and coworkers. The authors found that
6
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
Mre11, rather than APE1, is associated with rearranged Ig genes in hypermutating B cells and that Mre11/Rad50 cleaves at abasic sites within single‐stranded regions of DNA (Larson et al., 2005). Although the Mre11/ Rad50/NBS1 complex has previously been implicated in CSR (Kracker et al., 2005; La¨hdesma¨ki et al., 2004; Pan et al., 2002b; Reina‐San‐Martin et al., 2005) and potentially in SHM (Yabuki et al., 2005), it is unclear whether its role in CSR is through cleavage of abasic sites or resolution of the DSBs at a later stage. 2.5.2. DSB Resolutions in CSR 2.5.2.1. ATM and ATR Signaling in CSR The DSBs generated in the S regions during CSR will activate a number of signal‐transducing and DNA repair pathways. There are two signal‐transduction pathways, one which depends on ATM and a second that depends on the ATR protein. The ATM‐dependent pathway plays a major role in the response to DSBs, and the ATM protein has been implicated in CSR in both humans (Pan et al., 2002b) and mice (Lumsden et al., 2004; Reina‐San‐Martin et al., 2004). Several components of the ATM‐dependent pathway, including H2AX, NBS1, Mre11, and 53BP1, have also been shown to be involved in CSR (Kracker et al., 2005; La¨hdesma¨ki et al., 2004; Manis et al., 2004; Petersen et al., 2001; Reina‐San‐Martin et al., 2003, 2005; Ward et al., 2004). The ATR‐dependent pathway is activated by ssDNA during DNA replication or by agents such as UV irradiation that produce bulky lesions. By responding to the ssDNA resulting from processed DSBs, ATR may also reinforce the ATM response (Shiloh, 2001; Tibbetts et al., 1999). Furthermore, ATR shares several substrates with ATM (Abraham, 2001), including H2AX and 53BP1. A modest role of ATR in CSR has been demonstrated in ATR‐deficient patients, where a normal number of cells that have switched to IgG and IgA production were observed, but where the pattern of CSR junctions was aberrant (Pan‐Hammarstro¨m et al., 2006). 2.5.2.2. HR and NHEJ in CSR There are two major types of DSB repair mechanisms: HR and NHEJ. There is thus far no direct evidence showing that molecules involved in HR, such as Rad51, Rad52, and Rad54, are required for CSR, although expression of Rad51 is induced in activated B cells undergoing CSR (Bross et al., 2003; Li et al., 1996). The resolution of the CSR‐specific DSBs mainly requires components of the NHEJ pathway. On the basis of gene targeting studies, three components of the NHEJ machinery have been implicated in CSR in mice: DNA‐PKcs, Ku70, and Ku80 (Casellas et al., 1998; Manis et al., 1998a; Rolink et al., 1996). The impact of the other two components, DNA ligase IV and XRCC4, has not been
C L A S S S W I T C H R E C O M B I N AT I O N
7
analyzed in knockout models, as disruption of Lig4 or XRCC4 in mice results in embryonic lethality (Barnes et al., 1998; Frank et al., 1998; Gao et al., 1998b). Involvement of DNA ligase IV in CSR has, however, been demonstrated in patients who carry hypomorphic mutations in the Lig4 gene, where an altered pattern of in vivo generated CSR junctions in B cells was observed (Pan‐Hammarstro¨m et al., 2005). As DNA ligase IV, in contrast to Ku and DNA‐PKcs, has no reported roles outside NHEJ (Chaudhuri and Alt, 2004), the observation in DNA ligase IV deficient (Lig4D) patients links the core NHEJ machinery to CSR. Recently, five patients with growth retardation, microcephaly, and immunodeficiency characterized by a profound T and B lymphocytopenia were described. This autosomal recessive disorder is caused by mutations in a novel DNA repair factor, Cernunnos (XLF; Ahnesorg et al., 2006; Buck et al., 2006). The clinical phenotype of Cernunnos‐deficient patients shares several characteristics with Nijmegen breakage syndrome (NBS) and Lig4D patients. However, Cernunnos deficiency does not lead to impaired cell‐cycle checkpoints, as observed in NBS, but results in a defective V(D)J recombination and an impaired DNA end‐ligation process (Buck et al., 2006), similar to that observed in Lig4D patients. The precise role of Cernunnos in NHEJ remains elusive, although it seems to interact with the XRCC4‐ligase IV complex (Ahnesorg et al., 2006). It is interesting to note that in Cernunnos‐deficient patients, serum levels of IgG and IgA are low or absent, whereas the level of IgM is normal or even high, suggesting a possible role of Cernunnos in CSR (Buck et al., 2006). 2.5.3. DNA Damage Response/Repair Pathways Utilized in Ig Gene Diversification Table 1 summarizes the current knowledge on DNA damage response/repair factors utilized in V(D)J recombination, SHM and CSR. In general, factors that belong to the same pathway tend to show a similar pattern of involvement in Ig gene diversification. For example, the NHEJ core factors, Ku70 and Ku80, DNA‐PKcs, DNA ligase IV, and XRCC4, are all involved in V(D)J recombination and CSR, but, most likely, not in SHM. Most of the MMR proteins on the other hand are involved in both CSR and SHM, but may not be required in V(D)J recombination, whereas the ATM‐dependent factors are most often involved in CSR but not in SHM (Table 1 and references therein). There are, however, a few exceptions to the above ‘‘rule.’’ In the BER pathway, UNG thus far seems to be the only glycosylase required for removing the uracil bases in both the CSR and SHM processes. MSH3 seems to be the only MMR protein studied to date that is neither involved in CSR nor SHM
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
8
Table 1 Involvement of Different DNA Damage Response/Repair Pathways in Ig Gene Diversificationa Pathway and proteins
V(D)J recombination
Base‐excision repair UNG No SMUG1 NA
SHM
CSR
Yes No?
Yes No?
OGG1 MBD4 APEX1 and 2
NA NA NA
No No NA
NA No NA
Mismatch repair MSH2
No
Yes
Yes
PMS2
NA
Yes
Yes
MLH1
NA
Yes
Yes
MSH6
NA
Yes
Yes
MSH3
NA
No
No
MLH3 EXO1
NA NA
Yes Yes
No Yes
References Imai et al., 2003; Rada et al., 2002 Di Noia et al., 2006; Rada et al., 2004 Winter et al., 2003b Bardwell et al., 2003
Ehrenstein and Neuberger, 1999; Ehrenstein et al., 2001; Kim et al., 1999; Larijani et al., 2005; Martomo et al., 2004; Phung et al., 1998; Schrader et al., 1999, 2002; Wiesendanger et al., 2000 Ehrenstein and Neuberger, 1999; Ehrenstein et al., 2001; Kim et al., 1999; Larijani et al., 2005; Martomo et al., 2004; Phung et al., 1998; Schrader et al., 1999, 2002; Wiesendanger et al., 2000 Ehrenstein and Neuberger, 1999; Ehrenstein et al., 2001; Kim et al., 1999; Larijani et al., 2005; Martomo et al., 2004; Phung et al., 1998; Schrader et al., 1999, 2002; Wiesendanger et al., 2000 Ehrenstein and Neuberger, 1999; Ehrenstein et al., 2001; Kim et al., 1999; Larijani et al., 2005; Martomo et al., 2004; Phung et al., 1998; Schrader et al., 1999, 2002; Wiesendanger et al., 2000 Ehrenstein and Neuberger, 1999; Ehrenstein et al., 2001; Kim et al., 1999; Larijani et al., 2005; Martomo et al., 2004; Phung et al., 1998; Schrader et al., 1999, 2002; Wiesendanger et al., 2000 Li et al., 2006 Bardwell et al., 2004 (Continued)
9
C L A S S S W I T C H R E C O M B I N AT I O N
Table 1 (Continued) Pathway and proteins
V(D)J recombination
Nucleotide excision repair XPA NA
SHM
CSR
References
No
NA
NA
No
NA
NA
NA
Yes/No
Schrader et al., 2004; Tian et al., 2004; Winter et al., 2003a
NA
Yes
Yes?
NA
Yes/No
NA
NA
Yes
NA
NA
Yes
NA
Yes
No
NA
Yes
No
No
Delbos et al., 2005; Faili et al., 2004; Yavuz et al., 2002; Zeng et al., 2001, 2004 Faili et al., 2002a; Martomo et al., 2006; McDonald et al., 2003; Shimizu et al., 2003, 2005 Diaz et al., 2001; Masuda et al., 2005; Zan et al., 2001, 2005. Diaz et al., 2001; Masuda et al., 2005; Zan et al., 2001, 2005 Bertocci et al., 2002, 2003; Nick McElhinny et al., 2005; Ruiz et al., 2004 Gilfillan et al., 1993; Komori et al., 1993
Yes
NA
Yes
DNA‐PKcs
Yes
No
Yes
Lig4 and XRCC4
Yes
NA
Yes
Cernunnos (XLF)
Yes
NA
NA
No
Yes?/No
Yes?/No?
XPB and XPD (ERCC3/2) ERCC1‐XPF (ERCC4) DNA polymerase polZ (Y family) poli and POLK (Y family) poly (A family) polz (B family) polm (X family) TDT (X family) NHEJ core Ku70 and Ku80
HR Rad51, 52 and 54
Jacobs et al., 1998; Kim et al., 1997; Wagner et al., 1996 Jacobs et al., 1998; Kim et al., 1997; Wagner et al., 1996
Casellas et al., 1998; Gu et al., 1997; Manis et al., 1998a; Nussenzweig et al., 1996; Zhu et al., 1996 Bemark et al., 2000; Bosma et al., 2002; Cook et al., 2003; Gao et al., 1998a; Rolink et al., 1996; Taccioli et al., 1998 Barnes et al., 1998; Frank et al., 1998; Gao et al., 1998b; Pan‐Hammarstro¨m et al., 2005 Ahnesorg et al., 2006; Buck et al., 2006 Bross et al., 2003; Essers et al., 1997; Jacobs et al., 1998; Li et al., 1996; Zan et al., 2003 (Continued)
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
10 Table 1 (Continued) Pathway and proteins ATM dependent ATM
V(D)J recombination
SHM
CSR
Yes?/No
No
Yes
H2AX
Yes?/No
No
Yes
MDC1 53BP1
No No
NA No
Yes Yes
NBS1 and Mre11
Yes/No
Yes?
Yes
Artemis
Yes
NA
No
No? NA
Yes Yes?
Yes Yes?
ATR dependent ATR RPA
References Betz et al., 1993; Giovannetti et al., 2002; Lumsden et al., 2004; Pan et al., 2002b; Pan‐Hammarstro¨m et al., 2003; Perkins et al., 2002; Reina‐San‐Martin et al., 2004 Chen et al., 2000; Reina‐San‐Martin et al., 2003 Lou et al., 2006 Manis et al., 2004; Ward et al., 2004 Clatworthy et al., 2005; Harfst et al., 2000; Kracker et al., 2005; Larson et al., 2005; La¨hdesma¨ki et al., 2004; Pan et al., 2002b; Petersen et al., 2001; Reina‐San‐Martin et al., 2005; Yabuki et al., 2005; Yeo et al., 2000 Moshous et al., 2001; Rooney et al., 2003; Rooney et al., 2005 Pan‐Hammarstro¨m et al., 2006) Basu et al., 2005; Chaudhuri et al., 2004
a ‘‘No’’, no evidence showing the specified factor is involved in the respective process; ‘‘Yes’’, there is evidence showing the involvement of the specified factor in the respective process; ‘‘Yes?’’ or ‘‘No?’’, no direct evidence supporting the conclusion; NA, not analyzed. For caution, if the authors did not specifically indicate that the numbers of B and T cells are normal in the studied subjects and there is no other in vivo or in vitro study available, the involvement of that particular factor will be marked as ‘‘NA’’ for V(D)J recombination.
(Martomo et al., 2004; Wiesendanger et al., 2000), suggesting that the MSH3‐ specific function, that is repair of 2‐ to 4‐bp insertion/deletion loops (Wei et al., 2002), is not required in either process. MLH3, another MMR factor, seems to inhibit SHM while it has no influence on CSR (Li et al., 2006). Artemis, which is dependent on ATM signaling (Riballo et al., 2004; Zhang et al., 2004b), appears to be dispensable in CSR (Rooney et al., 2005), but is absolutely required in coding‐joint formation during V(D)J recombination (Ma et al., 2002; Moshous
C L A S S S W I T C H R E C O M B I N AT I O N
11
et al., 2001). The Artemis‐dependent ‘‘hairpin opening’’ function may thus be specific for the V(D)J recombination process. ATM, ATR, and a few ATM/ATR‐dependent factors, including H2AX, 53BP1, and NBS1, are all involved in CSR, but their roles in V(D)J recombination in mammalian cells remain uncertain (Chen et al., 2000; Clatworthy et al., 2005; Hsieh et al., 1993; Yeo et al., 2000). Thus, ATM was thought not to be required in V(D)J recombination as cells from ataxia‐telangiectasia (A‐T) patients supported normal rearrangement of exogenous substrates (Hsieh et al., 1993), and endogenously rearranged TCRb and IgH genes from A‐T patients revealed normal V(D)J coding joints (Giovannetti et al., 2002; Pan‐Hammarstro¨m et al., 2003). However, similar to patients with Omenns syndrome (RAG2 deficient), A‐T patients display a restricted TCRb repertoire, which may suggest a subtle recombination defect (Giovannetti et al., 2002). Furthermore, both A‐T patients (Taylor et al., 1996) and ATM‐deficient mice (Barlow et al., 1996; Liyanage et al., 2000) are prone to lymphoid malignancies that harbor translocations involving V(D)J region genes, although RAG1 and RAG2 seem not to be essential in tumorigenesis in ATM‐deficient mice (Petiniot et al., 2000, 2002). Thus, ATM, and potentially also related factors, may be indirectly involved in the process by sensing the DNA breaks and by suppression of aberrant V(D)J recombination that may lead to development of lymphoid malignancies (Dudley et al., 2005; Liao and van Dyke, 1999; Perkins et al., 2002). Two members of the DNA polymerase (pol) X family, TDT and polm, also seem to have important, albeit restricted, roles in V(D)J recombination. TDT is crucial for N nucleotide additions at V–D and D–J junctions, whereas polm is required in the rearrangement of light chain genes (Bertocci et al., 2003). Members of the DNA pol Y, A and B families, including polZ, poly, and polyz, have all been implicated in SHM (Table 1 and references therein), in particular during the proposed second phase of SHM, where mutations are generated mainly at A/T pairs (Neuberger et al., 2005; Seki et al., 2005). The role of these DNA polymerases during CSR is however unclear, although an altered mutation pattern in the Sm regions has been observed in xeroderma pigmentosum variant (XP‐V) patients, who are deficient in DNA polZ (Faili et al., 2004; Zeng et al., 2004). 2.6. Regulation of CSR Cytokines and B cell activators control switching through their ability to regulate GL transcription of the CH genes and to induce or suppress the expression of AID. A number of alternative pathways for inducing CSR have also been described.
12
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
2.6.1. The ‘‘Accessibility Model’’ and Beyond Induction or suppression of GL transcription by particular cytokines has been directly correlated with subsequent switching to the same isotype after addition of a B cell activator (Stavnezer, 1996, 2000). It has been proposed that initiation of GL transcription confers a level of accessibility to the CH locus that allows binding of additional factors that participate in CSR, that is the accessibility model of CSR. Indeed, modifications of histone H3 and/or H4, which create localized DNA accessibility to trans‐acting factors, are correlated with the level of GL transcription and differential targeting of downstream S regions during CSR (Li et al., 2004a; Nambu et al., 2003; Wang et al., 2006). Furthermore, the physical association of AID to the S region requires GL transcription (Nambu et al., 2003). However, histone acetylation alone cannot promote CSR or GL transcription, and H3 acetylation, in the absence of GL transcription, does not make S regions accessible to AID binding (Nambu et al., 2003). These studies provide evidence that GL transcription plays an important role in the regulation of chromatin accessibility during CSR, but also suggest that GL transcription has functional consequences beyond simply making the S region chromatin accessible. As discussed in the previous section, AID preferentially deaminates ssDNA rather than dsDNA in vitro. A more direct role of GL transcription has also been proposed, that is creation of ssDNA within the S regions, through formation of transient transcription bubbles or R‐loop structures, thus providing targets for AID (for review see Chaudhuri and Alt, 2004; Kaminski and Stavnezer, 2004). 2.6.2. Regulation of AID Expression Another aspect of ‘‘beyond accessibility’’ is that cytokines and B cell activators are able to direct CSR to a particular CH region, not only through regulation of GL transcription but also through their ability to induce the expression of AID. For example IL‐4, together with TGF‐b and CD40L, is able to induce AID expression in the mouse B cell line CH12F3‐2 and LPS alone, or in combination of IL‐4 or TGF‐b, is able to induce AID in mouse spleen cells (Muramatsu et al., 1999). A B cell‐specific enhancer has been identified in the first intron of the gene encoding mouse AID, and the transcriptional activity of this enhancer is regulated by E‐proteins (Sayegh et al., 2003). Another putative promoter region has been identified in a region immediately upstream of the transcription initiation site and this promoter is not lymphoid specific (Gonda et al., 2003; Yadav et al., 2006). Several transcription factor‐binding sites, including those for Pax5 (B cell‐specific activator protein), Sp1, and Sp3, have been
C L A S S S W I T C H R E C O M B I N AT I O N
13
identified in this region. However, the data on Pax5 binding are controversial (Gonda et al., 2003; Yadav et al., 2006). STAT6 and NF‐kB p50 are thought to be required for induction of AID expression by IL‐4 and CD40 engagement and potential binding sites for STAT6 and NF‐kB p50 have been identified in a region further upstream of the putative promoter of the human AICDA gene (Dedeoglu et al., 2004). The activity of AID is also regulated at a posttranslational level. The AID– RPA association in activated B cells requires AID phosphorylation (Chaudhuri et al., 2004), and protein kinase A (PKA) was identified as the physiological AID kinase (Basu et al., 2005; Pasqualucci et al., 2006). It is possible that AID may be sequestered in an inactive state in the cytoplasm, by an as yet unknown mechanism, and with appropriate signaling to the B cells, AID is phosphorylated by PKA, activated, and subsequently transported to the nucleus (Basu et al., 2005). As multiple signals activate PKA, including cytokines, for instance TGF‐b‐induced Smad proteins might activate PKA directly (Zhang et al., 2004a), this may add yet another dimension to the regulation of CSR by cytokines and B cell activators. However, the exact signaling that is critical for PKA‐mediated regulation of AID, needs to be further investigated. The mechanism underlying the negative regulation of AID remains to be explored, although it appears to be B cell specific (Muto et al., 2006). It is also tempting to hypothesize that inactivation of AID, or retention of AID in the cytoplasm, is due to its interaction with specific inhibitory proteins, a situation that is reminiscent of the induction of nuclear factor‐kB (NF‐kB) activity (Jimi and Ghosh, 2005; Zhong et al., 1997).
2.6.3. IgH 30 Enhancers In addition to the promoter elements regulating GL transcription, regions containing a series of enhancer elements are located 30 of the human Ca1 and Ca2 genes (Chen and Birshtein, 1997; Mills et al., 1997; Pinaud et al., 1997). These regions, similar to the 30 IgH enhancers in the mouse (Dariavach et al., 1991) and rat (Pettersson et al., 1990) Ig heavy chain constant region (IGHC) loci, may constitute a locus control region (LCR; Madisen and Groudine, 1994; Ong et al., 1998; Seidl et al., 1999) that regulates GL transcription and CSR (Cogne et al., 1994; Madisen and Groudine, 1994; Ong et al., 1998; Seidl et al., 1999). Consistent with this hypothesis, we have previously shown that the activity of the human a1, a2, g3 (Hu et al., 2000; Pan et al., 2000), and g4 (Pan‐Hammarstro¨m et al., unpublished data) GL promoters can be markedly upregulated in reporter gene assays by DNA segments containing elements of the human 30 enhancers.
14
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
2.6.4. CD40–CD40L Interaction CD40 and CD40 ligand (L) interaction is crucial during T‐dependent B cell activation, and its central role in B cell maturation and CSR is demonstrated in patients with type I and type III hyper‐IgM syndromes (HIGM) who carry mutated CD40L or CD40 genes (for review see Levy et al., 1997; Lougaris et al., 2005). These patients are characterized by very low levels of serum IgG, IgA, and IgE, with normal or elevated levels of IgM, and associated with a defective germinal center formation. In addition to the defects in CSR, SHM is also significantly reduced. However, somatically mutated Ig genes have been found in a subset of B cells (IgMþIgDþCD27þ) in these patients, suggesting that SHM may occur in the absence of classical cognate T–B cell collaboration (Weller et al., 2001). CD40 signaling activates multiple kinases and pathways and eventually leads to activation of transcription factors, including NF‐kB, NF of activated T cells (NF‐ATs), and activator protein 1 (AP‐1). CD40 signaling is able to direct CSR, by induction of GL transcripts, through the binding of activated NF‐kB to the corresponding GL promoters (for review see Stavnezer, 2000) or to the 30 enhancers (Grant et al., 1996; Sepulveda et al., 2004; Zelazowski et al., 2000). Furthermore, optimal AID induction also requires CD40 signaling (Muramatsu et al., 1999; Zhou et al., 2003). 2.6.5. Alternative Pathways for CSR In a few CD40L‐deficient patients, where CD40L expression is totally absent, low levels of serum IgA and IgE have still been observed, suggesting that mechanisms other than CD40–CD40L interaction may also induce CSR (Levy et al., 1997). Indeed, a few alternative CSR pathways have recently been described and are discussed below. 2.6.5.1. BAFF and APRIL The TNF family ligands B cell activation factor of the TNF family (BAFF) and a proliferation‐inducing ligand (APRIL) regulate lymphocyte survival and activation. BAFF binds to three receptors that are selectively expressed on B cells; BAFF‐R, transmembrane activator and CAML interactor (TACI) and B cell maturation antigen (BCMA) whereas APRIL interacts with TACI, BCMA, and proteoglycans (for review see Schneider, 2005). In the presence of appropriate cytokines, BAFF and APRIL have also been reported to induce CSR in human B cells (Litinskiy et al., 2002). This finding was extended by the observation that both ligands can induce CSR in CD40/ mouse B cells, suggesting that this form of CSR is not dependent on CD40– CD40L interaction (Castigli et al., 2005b). In this model, TACI and/or BAFF‐R,
15
C L A S S S W I T C H R E C O M B I N AT I O N
but not BCMA, seem to be the receptors that mediate CSR by APRIL and BAFF (Castigli et al., 2005b). 2.6.5.2. Toll and Toll‐Like Receptor LPS is known to induce CSR to all isotypes in mouse B cells (Stavnezer, 2000), probably through binding to Toll‐like receptor 4 (TLR4). A more recently described pathway, involving TLR9 and its ligand, CpG‐containing DNA, has also been shown to induce both mouse and human B cells to undergo CSR to selected Ig isotypes (He et al., 2004; Lin et al., 2004; Liu et al., 2003). The TLR9 pathway has received growing attention due to the potential relevance of CpG DNAs in the pathogenesis of autoimmune diseases and as candidates for antiallergens (Klinman, 2004; Peng, 2005).
3. Comparison Between Human and Mouse 3.1. The Constant Region Gene Locus in Human and Mouse The human IGHC gene locus, localized on chromosome 14, contains nine functional genes and two pseudogenes (Cm‐Cd‐Cg3‐Cg1‐Cce‐Ca1‐Ccg‐Cg2‐ Cg4‐Ce‐Ca2), organized into two g‐g‐e‐a blocks (Fig. 1). It has evolved through a series of duplications, followed by mutations and specialization of the new genes. The locus is still evolving and up to 20% of the Caucasoid population and 44% of the Mongoloid population show duplications of single or multiple IGHC genes (Rabbani et al., 1996; Fig. 1). The mouse IGHC locus, localized on chromosome 12, is composed of eight functional genes, including four Cg genes but only one Ca gene (Cm‐Cd‐Cg3‐
Mouse
µ
V(D)J
δ
γ 3 γ 1 γ 2b γ 2a ε
α
Eµ
3⬘αE µ
V(D)J
δ
γ 3 γ1 ψε α1
ψγ
γ2 γ4
ε
α2
Human Eµ
3⬘α1E µ
V(D)J
Human Eµ
δ
3⬘α 2E ψγ
γ 3 γ 1 ψε α1 3⬘α1E
γ2 γ4
ε
ψγ
α1
γ2 γ4
3⬘α 2E
ε
α2 3⬘α 2E
α1-ε duplication, 110 kb
Figure 1 The constant region gene locus in human and mouse. Coding regions are shown as filled boxes and pseudogenes are indicated as open boxes. Striped boxes represent the duplicated constant regions genes in human Ig locus.
16
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
Cg1‐Cg2b‐Cg2a‐Ce‐Ca; Fig. 1). On the basis of sequence homologies, it has been suggested that the ancestral rodent IGHC only contained three Cg genes and that the mouse Cg2b and Cg2a have been generated by a recent duplication (Bru¨ggemann, 1988). It is interesting to note that in one mouse strain (BALB/c), where the IGHC locus has been studied in detail, pseudo‐g‐genes have also been identified between the g1 and g2b and between the g2b and g2a genes (Cm‐Cd‐Cg3‐Cg1‐Ccg1‐Cg2b‐Ccg2‐Cg2a‐Ce‐Ca; Akahori and Kurosawa, 1997). The polarity of the two pseudogenes is, however, opposite to that of the functional g genes. Whether similar pseudo‐g‐gene exists in other mouse strains is not known but such information might provide additional clues for the evolution of the mouse IGHC locus. The evolution of the human and mouse IGHC loci after the divergence of the two species has resulted in differences in the gene organization, the number of genes, and the function of selected IGHC genes. Thus, although both species have four IgG‐subclass‐encoding genes, a given subclass, for instance human IgG3, is equivalent neither in terms of structure nor in terms of function to the mouse IgG3. Furthermore, CSR to IgG subclasses or IgA is also differentially regulated in human and mouse (Sections 3.5 and 3.6). 3.2. Switch Regions in Human and Mouse 3.2.1. Characteristics of S Regions The S regions for all Ig isotypes, in man and mouse, have previously been mapped and sequenced. The repetitive sequences of the S regions are most often defined by the Sm‐like pentameric repeats, although different standards have been applied and we have therefore reevaluated the repetitive sequences using dot plot analysis (Table 2). One reference sequence from each S region was studied. For the mouse S regions, the sequences were all derived from the BALB/c strain, except for Sm, where a complete sequence is only available from the C57BL/6 genome. Structurally, S regions are all composed of tandemly repeated sequences that contain common pentamer sequences (GAGCT and GGGCT), but differ in the length of the repetitive region and the actual sequence of the repeats (summarized in Table 2). Human Sm, Sa, and Se are closely related and characterized by a dense clustering of pentameric repeats. No higher order of these repeats has been identified in the human Sm, Sa, and Se regions, except for five 25‐bp repeats at the 30 border of Sm (Islam et al., 1994; Mills et al., 1990; Pan et al., 2001). The four human Sg regions are less related to Sm, and vary considerably in length (Sg1 > Sg3 > Sg2 > Sg4), due to the presence of different numbers of 79‐bp repeat units (Mills et al., 1995). The human Sg
Table 2 Structural Characteristics of Switch Regions
Length of repeat units (bp)
Approximate length of the repetitive region (kb)a
17
S region
Accession number
Mouse Sm Se
AC073553 M57385
10–40 40–50
2.4 (1.4) 2.5
3 (Sequenced) 2 (Sequenced)
Sa Sg3 Sg1 Sg2b
D11468 D78343 D78344 D78344
2080 49 49 (þDRI, II) 26 þ 49
4.0 (1.8) 2.0 (1.8) 7.7 (4.5) 3.5 (3.3)
2 (Sequenced) 3 (KpnI) 5 (KpnI) 4 (BamHI)
Sg2a
D78344
26 þ 52
2.4 (1.5)
4 (BamHI)
Human Sm Se Sa1
X54713 AL928742 L19121
Pentamer þ 25 Pentamer Pentamer
3.6 (3.6) 2.2 2.5 (2.5)
2 (SacI) NA 14 (SacI)
Sa2
AF030305
Pentamer
2.0 (1.9)
18 (SacI)
Sg1 Sg2 Sg3 Sg4
U39737 U39934 U39935 X56796
79 79 79 79
2.1 (2.1) 0.9 1.4 (1.4) 0.7 (0.5)
NA NA 2 (Sequenced) 6 (BamHI or sequenced)
Number of alleles
References Nikaido et al., 1981 Gritzmacher and Liu, 1987; Nikaido et al., 1982; Scappino et al., 1991 Arakawa et al., 1993 Szurek et al., 1985 Mowatt and Dunnick, 1986 Akahori and Kurosawa, 1997; Nikaido et al., 1982 Akahori and Kurosawa, 1997; Nikaido et al., 1982 Mills et al., 1990; Sun and Kitchingman, 1991 Mills et al., 1990; Sun and Kitchingman, 1991 Islam et al., 1994; Keyeux and Bernal, 1996; Pan et al., 2001 Islam et al., 1994; Keyeux and Bernal, 1996; Pan et al., 2001 Mills et al., 1995; Pan et al., 1997b, 1998 Mills et al., 1995; Pan et al., 1997b, 1998 Mills et al., 1995; Pan et al., 1997b, 1998 Mills et al., 1995; Pan et al., 1997b, 1998 (Continued)
Table 2 (Continued) Length of the repetitive sequences (search length 30 bp, 70% homology) Mouse Sg1 > Sa > Sg2b > Se > Sm ¼ Sg2a > Sg3 Human Sm > Sa1 > Se > Sg1 > Sa2 > Sg3 > Sg2 > Sg4
18
Density of dots corresponding to repeats of similar sequences, Sx/Sx (search length 30 bp, 70% homology) Mouse Sa > Sm > Se > Sg1 > Sg3 > Sg2b > Sg2a Human Sm > Sa1 > Sa2 > Se > Sg1 > Sg3 > Sg4 > Sg2 Density of dots corresponding to sequence match to Sm, Sx/Sm (search length 30 bp, 70% homology) Mouse Sa > Se > Sg3 > Sg1 ¼ Sg2b > Sg2a Human Sa1 > Sa2 > Se > Sg4 > Sg2 > Sg1 > Sg3 a The approximate length of the repetitive sequence of all the S regions listed was estimated by dotplot analysis. The repetitive sequences in a given S region were defined by running the S region sequences against themselves; the search window is 30 bp and a maximum of 9 (70%) mismatches is allowed. When only three mismatches are allowed (90%), a more dense area of repetitive sequences can be identified and the estimated length was given in parenthesis. Mouse S regions were based on the sequences from BALB/c mice, except for Sm, which was derived from the C57BL/6 mice.
19
C L A S S S W I T C H R E C O M B I N AT I O N
regions are also different in the extent of conservation between repeat units, as visualized by the aligned repeats (Mills et al., 1995) and by dot matrix analysis, in an Sg1 > Sg3 > Sg4 > Sg2 order (Table 2). There is substantial homology between the human and mouse S regions, especially for the Sm, Sa, and Se regions (Fig. 2A). Mouse Sm, Sa, and Se are also rich in pentameric repeats and these repeats can be organized in a higher order structure, with lengths of the repeat unit being 10–40, 20–80, and 40–50 bp, respectively (Arakawa et al., 1993; Nikaido et al., 1981, 1982; Scappino
A
Human Sa 2
Human Sm
1000
2000
3000
1000
2000
4000 1000 2000 1000 Mouse Sm
3000
3000
4000
5000
Mouse Sa
2000
1000 Human Sg 3
Human Se 3
2000
4000
2000
3000 2000 Mouse Se
1000
2000 3000 Mouse Sg 3
4000
B Sg 3 consensus repeat +79 +1 AGGGCAGAGCAGCCGCAGGTGAGCAGGGG-CGGTGGAGGAGGCAGGACGAGCAGGGGGCAGCTCCTG---GAGCTCAGGGGACC Human TGGGGTGGGTGGGAGTGTGGGGGACTAACCTGGGACAGCTCTGGGGAGC Mouse +1 +49 SNIP/NF-k B site SNAP site
Figure 2 Switch regions in human and mouse. (A) Dot matrix analysis of the human and mouse switch regions. The dots represent homologies with a search length of 30 bp and maximum of 9 mismatches. (B) The alignment of the human 79‐bp and mouse 49‐bp Sg3 repeat units. The SNIP/ NF‐kB‐ and SNAP‐binding sites are indicated by boxes (Pan et al., 1997b; Wuerffel et al., 1992).
20
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
et al., 1991). The four mouse Sg regions share very little homology with mouse Sm (Sg3 > Sg1 ¼ Sg2b > Sg2a), but show homology with human Sg regions and are organized in 49‐ to 52‐bp repeats (Mowatt and Dunnick, 1986; Nikaido et al., 1982; Szurek et al., 1985). A 26‐bp repeating unit, in addition to a 49‐bp repeating unit, is present in the Sg2a and Sg2b regions (Akahori and Kurosawa, 1997). The mouse Sg repeat units and human 79‐bp repeat units show considerable sequence homology, especially with regard to conservation of the A (SNAP binding) and B (SNIP/NF‐kB binding) sites (Akahori and Kurosawa, 1997; Pan et al., 1997b; Wuerffel et al., 1992; Fig. 2B). The mouse Sg regions are also different with regard to the length of repeat sequences (Sg1 > Sg2b > Sg2a > Sg3) and the degree of conservation between the repeat units (Sg1 > Sg3 > Sg2b > Sg2a). Taken together, the available data suggests that the Sm and Sg were probably duplicated from an ancestral sequence earlier than the human/mouse divergence and structural features unique for Sm (Sa, Se) and Sg have been evolutionarily conserved (Mills et al., 1990). Human Sg1 and mouse Sg1 seem to share several common features, with a similar location in the Ig locus, most precise repeat units and being the longest Sg regions (at least in the BALB/c strain). On the basis of the dot matrix comparison, the Sg1 repeats appear to be prototypic for units in the other Sg regions in both human and mouse. Other Sg regions, however, do not show a correlation. For instance, Sg3 is the shortest Sg region in mice but not in humans. In addition, Sg3 is the only Sg region that shows some degree of homology with Sm in the mouse, whereas in humans, Sg3 shows the least homology with Sm (Sg4 > Sg2 > Sg1 > Sg3). The most 30 Sg region in human and mouse, Sg4 and Sg2a, share the least homology with other Sg regions. However, the human Sg4 is still more related to the ‘‘prototype’’ Sg1, whereas the mouse Sg2a is more related to Sg2b, suggesting that both have appeared late in ontogeny and subsequently evolved differently. 3.2.2. Polymorphism of S Regions S regions show extensive polymorphism, both in human and in mouse. In most cases, however, only restriction fragment length polymorphism (RFLP) data are available. The best‐studied human S region is Sg4, where five different BamHI IGHG4 alleles have been characterized by sequencing (Pan et al., 1998). These Sg4 alleles differ in length due to deletions and insertions of a varying number of 79‐bp Sg4 repeat units, ranging from 5 to 14 repeats (Pan et al., 1998). In addition, single base substitutions have also been noted in several alleles when compared with the prototype Sg4 region (derived from the 9.2‐kb BamHI allele; Pan et al., 1998). In the mouse, a partially sequenced Sg3 from the BAB14 strain has been compared with the fully sequenced Sg3 from BALB/c, and insertions and
21
C L A S S S W I T C H R E C O M B I N AT I O N
BamHI allele
Human Sg 4 region
IgG4 serum level (g/L)
9.4 kb (12 repeats)
0.42 ± 0.23
9.2 kb (10 repeats)
0.26 ± 0.14
Figure 3 Influence of the length of the Sg4 region on serum levels of IgG4. The boxes filled with different patterns represent the individual 79‐bp Sg4 repeat units (Pan et al., 1998).
deletions of 49‐bp units were evident (Szurek et al., 1985). A later study also suggested that polymorphism in the Sg1 region is due to differences in the number of 49‐bp elements (Mowatt and Dunnick, 1986). In Table 2, the number of possible alleles for each S region, mainly based on RFLP results, is indicated, and the numbers may change when additional sequence data becomes available. There have been suggestions that the length of the S region correlates to serum levels of a given Ig class. In humans, IgG1 shows the highest serum concentration, followed by IgG3 (provided that half‐life is taken into account), IgG2, and IgG4, which is in general agreement with the length of the Sg regions presented in Table 2. We have also shown that the 9.4‐kb BamHI IGHG4 allele is more productive than the 9.0‐kb allele in normal healthy donors, possibly due to the extended Sg4 region (Pan et al., 1998; Fig. 3). In BALB/c mice, IgG1 is the most abundant Ig class and Sg1 is indeed the longest among the S regions in this strain. By replacing the mouse Sg1 region with synthetic or endogenous S regions of various lengths, Zarrin et al. (2005) have shown that the length of the S region directly influences CSR efficiency in vivo, presumably by providing more substrate for the recombination machinery. Despite the constant length and organization of human Sg3 regions associated with both the b and g allotypes, marked differences are noted in the rate of switching (Hassan et al., 1992) and serum IgG3 levels (Morell et al., 1972b). These differences appear to be due to point mutations in a crucial NF‐kB‐ binding motif in one of the Sg3 repeats rather than polymorphisms in the GL g3 promoter (Pan et al., 1997a,b). 3.2.3. Secondary Structures in S Regions As discussed above, CSR is a region rather than a site‐specific event. It is therefore of interest to search for a relation between the recombination breakpoints and the structural character of the S region. The human and mouse S regions contain a large number of palindromic sequences that may form secondary ssDNA structures. It has been suggested that CSR preferentially
22
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
occurs at transitions from a stem to a loop structure in ssDNA (microsites) in Xenopus and in mice (Mussmann et al., 1997). However, a later study based on large number of human Sm, Sg, and Sa breakpoints did not show a significant correlation between the breakpoints and such secondary structures (Pan‐Hammarstro¨m et al., 2004). It is currently unclear whether the difference noted represents species variations or are due to differences in the methods used for analysis. Nevertheless, new ways of exploring the role of secondary and tertiary structures of the S regions are required to fully resolve the question. 3.3. 30 Enhancers in Human and Mouse The human and mouse enhancer elements in the 30 a region share significant sequence homology (Mills et al., 1997) and have been proposed to have similar functional properties. There are, however, significant differences. First, there are two 30 enhancer regions in humans and they might be regulated differently and could also interact with each other. Second, humans do not have an equivalent for the mouse HS3B enhancer elements and the 30 enhancers are organized differently (Fig. 4A). The human a1 and a2 HS1,2 enhancers both reside near the centers of 10‐kb palindromes, with each palindrome closely flanked by a single copy of HS3 immediately adjacent to the 50 end and an HS4 unit located 4‐kb downstream (HS3‐HS1,2‐HS4; Mills et al., 1997). By comparison, the mouse HS1,2 is centrally positioned in a much larger (25 kb) palindrome that contains a copy of HS3 on each end, with HS4 located 4‐kb downstream of the palindrome (HS3A‐HS1,2‐HS3B‐HS4; Chauveau and Cogne, 1996; Saleque et al., 1997). Third, certain transcription factor binding sites in the mouse enhancer, including Pax5‐binding sites, do not appear to be conserved in the human HS1,2 or HS4 (Mills et al., 1997; Fig. 4B and C) and transient transfection assays have shown that the activity of the human HS4 is indeed regulated differently from that of the equivalent mouse enhancer (Sepulveda et al., 2004). A study has compared the genomic sequences of the entire 30 regulatory regions, encompassing the known enhancer elements and its downstream sequences in mice and humans (Sepulveda et al., 2005). Although very limited sequence identity was observed between these regions, except for the enhancers themselves, other features, that is extensive palindromes flanking the HS1,2 enhancer and families of locally repetitive sequences, are conserved (Sepulveda et al., 2005). One interesting difference is that in humans, but not in mice, the locally repetitive sequences contain short tandem repeats that resemble ‘‘switch’’ sequences. Whether these repetitive sequences have a role in CSR is unknown but worthy of further investigation.
23
C L A S S S W I T C H R E C O M B I N AT I O N
A
HS3A
HS1,2
HS3B HS4
Mouse 3⬘a E 25 kb
HS3 HS1,2
HS4
Human 3⬘a1E 10 kb
HS3 HS1,2
HS4
Human 3⬘a 2E 10 kb
Pax5
B
PU.1
Pax5 NF-k B mE1
mE5 Octamer AP-1/Ets
Mouse HS1,2 Human a1HS1,2 Human a 2HS1,2 HS1,2 core homology
C
Octamer NF-k B Pax5 Octamer
Mouse HS4 Human HS4 Figure 4 Comparison of human and mouse 30 enhancer regions. (A) Schematic map of the human and mouse 30 enhancer elements. (B) Transcription factor‐binding sites identified within the human and mouse HS1,2 enhancer elements. Black boxes represent the conserved motifs whereas gray boxes indicate partially conserved binding sites. The figure was based on the sequence alignments from a previous study (Mills et al., 1997). Only one of the a1HS1,2 alleles (a1HS1,2T) is shown here. The highly conserved HS1,2 core homology region is indicated by arrows. (C) Transcription factor‐binding sites identified within the human and mouse HS4 enhancer elements (Mills et al., 1997; Sepulveda et al., 2004).
24
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
The 30 enhancer regions in humans are polymorphic. At least four a1HS1,2 and two a2HS1,2 alleles have been identified. The allelic polymorphism is due to varying number of 38‐bp repeats (one to four) immediately 30 of the core of HS1,2 enhancer, variable spacer elements separating the 38‐bp repeats and variable external elements bordering the repetition cluster (Denizot et al., 2001; Giambra et al., 2005). The repeat units themselves do not exhibit enhancer activity and are not conserved between mice and humans (Mills et al., 1997). However, as a number of transcription factor‐binding sites, including NF‐kB and E47, have been identified in these repetitive sequence (Giambra et al., 2005) and increasing the number of these repeats results in an increased level of HS1,2 enhancer activity in luciferase assays (Denizot et al., 2001), the polymorphisms in the HS1,2 enhancer might be of functional relevance. Indeed, dysregulation of IgA production in celiac disease and IgA nephropathy has been suggested to be associated with different a1HS1,2 alleles (Aupetit et al., 2000; Frezza et al., 2004). The human HS3 and HS4 enhancers are not polymorphic (Guglielmi et al., 2004) whereas the mouse 30 enhancers have not been studied in detail in this respect. However, as the entire 30 regulatory region and downstream sequences are highly polymorphic, when comparing the 129Sv and C57BL/6 strains (Sepulveda et al., 2005), it will not be surprising if allelic differences exist in the enhancer elements. In mice, targeted deletion of the 30 enhancers have shown that HS3A and HS1,2 are individually dispensable for CSR (Manis et al., 1998b) whereas the joint deletion of HS3B and HS4 severely affects this process (except CSR to IgG1; Pinaud et al., 2001). In humans, no deletions of these enhancers have been reported. However, there is evidence that the mouse HS1,2 enhancer regulates the GL e and g2b promoters (Laurencikiene et al., 2001) whereas the human HS1,2 enhancer regulates the GL a and g promoters (Hu et al., 2000; Pan et al., 2000). Both human a1 and a2 HS1,2 fragments show strong enhancer activity on the GL a1 and a2 promoters when transiently transfected into human mature B cell lines. HS4 has a modest effect whereas HS3 shows no enhancer activity in these cell lines (Hu et al., 2000). Notably, the combination of HS3‐HS1,2‐HS4 fragments displays a markedly stronger enhancer activity than the individual fragments, suggesting that they interact synergistically and all three enhancer elements may be needed for the activation of the Ca locus before CSR occurs (Hu et al., 2000). Similarly, this combination of enhancer elements also strongly stimulates the GL g3 promoter in an orientation‐independent manner (Pan et al., 2000). Furthermore, the conserved structures flanking the HS1,2 and the highly conserved HS1,2 core sequence in mice and humans suggest that the entire 30 enhancer region, rather than the HS3B and HS4 alone, is activated during normal CSR. This hypothesis is supported by an observation that deletion of the entire
C L A S S S W I T C H R E C O M B I N AT I O N
25
30 enhancer from a BAC transgene eliminates IgG1 CSR in addition to all the other isotypes (Dunnick et al., 2005). 3.4. AID in Human and Mouse AID is highly conserved in evolution, from fish to humans (Zhao et al., 2005). At the protein level, human AID and mouse AID shows a sequence identity of 91% and thus far no functional differences between these molecules have been noted. In human primary B cells, IL‐4 alone is sufficient to drive AID expression but CD40 signaling is required for optimal AID production (Zhou et al., 2003). In mouse primary B cells, similar results have been obtained (Dedeoglu et al., 2004), although an earlier study has suggested that IL‐4 alone has no detectable effect on AID expression and that IL‐4 þ CD40L were not synergistic for AID induction (Muramatsu et al., 1999). LPS is a powerful AID inducer in mice but not in humans (Muramatsu et al., 1999; Zhou et al., 2003), which is consistent with the previous knowledge that LPS is a strong CSR inducer in mice but not in humans. IL‐4 þ CD40L instead, provides a strong signal for CSR in human B cells. The intronic enhancer for the AICDA loci in humans and mice share a 70% sequence identity and the two high‐affinity E‐box sites are conserved, as are octamer, Pax5‐, NF‐kB‐, and Ikaros‐binding sites (Sayegh et al., 2003; Yadav et al., 2006). The upstream promoter region also shares a high degree of homology and contains conserved Pax5‐ or Sp1‐binding sites (Gonda et al., 2003; Yadav et al., 2006). The proposed STAT6 and NF‐kB p50 sites upstream of the promoter region in the human AICDA locus (Dedeoglu et al., 2004) are, however, not conserved in mice. By searching the 8‐kb genomic sequences upstream of the second exon of the human AICDA loci, we found another potential STAT6‐binding site about 350‐bp upstream of the first E‐box site. However, again, it is not conserved in the mouse locus. Thus, although STAT6 and p50 are essential for IL‐4 induction of AID gene expression in mouse B cells (Dedeoglu et al., 2004), the underlying mechanism might still be somewhat different from that in human cells. Two PKA phosphorylation sites have been identified in the human AID protein, threonine 27 (T27) and serine 38 (S38). Both are located within the PKA canonical consensus motifs (RRXS/T; Pasqualucci et al., 2006). In mice, however, T27 is not embedded within a classical PKA motif due to an amino acid substitution (RHET versus RRET in humans). Although T27 was found to be a PKA substrate in vitro and a T27A mutant failed to undergo PKA phosphorylation and was not able to rescue CSR in AID/ mouse cells, S38 has been suggested as the residue on mouse AID that is phosphorylated by
26
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
PKA (Basu et al., 2005). However, S38 is not conserved in AID from bony fish and yet it can support CSR when transfected into mouse B cells (Barreto et al., 2005). Thus, it is currently unclear how fish AID can ‘‘bypass’’ PKA phosphorylation. Alternatively, other PKA site(s), such as T27, which is located in the same nonconsensus motif as in the mouse (RHET), is utilized in fish AID. 3.5. Regulation of CSR to IgA in Human and Mouse TGF‐b1 can direct switching from IgM to IgA in both humans and mice by inducing GL transcripts (Islam et al., 1991; Shockett and Stavnezer, 1991) through activation of its corresponding promoter elements in the Ia region (Lin and Stavnezer, 1992; Nilsson and Sideras, 1993). The GL a promoter regions, in particular the TGF‐b1‐responsive element, including binding sites for RUNX and SMAD3/4, are highly conserved between humans and mice and these promoters appear to be regulated similarly (Hanai et al., 1999; Pardali et al., 2000; Shi and Stavnezer, 1998; Xie et al., 1999). Unlike mice, however, humans express two IgA subclasses, IgA1 and IgA2, each encoded by a separate gene and directed against different antigens. Thus, IgA1 mainly gives rise to antibodies against protein antigens whereas IgA2 is primarily directed against polysaccharide antigens. The two human IgA subclasses are also differentially expressed at different anatomical sites. IgA1 comprises about 80–90% of the total IgA in serum and it is predominantly expressed in spleen, peripheral lymph nodes, tonsils, nasal mucosa, lacrimal glands, gastric and proximal small intestinal mucosa, whereas IgA2 production is proportionally larger in the salivary glands and it is the predominant subclass in the large bowel mucosa (Kett et al., 1986). By selective amplification of recombined Sa1 or Sa2 regions, we have estimated the proportion of cells that have switched to IgA1 or IgA2 at different anatomical sites and largely confirmed the above observations at the DNA level (Pan‐Hammarstro¨m et al., unpublished data). The mechanisms underlying the preferential IgA1 or IgA2 responses are still elusive. The two human GL a promoters are 98% homologous (Nilsson et al., 1991), with identical TGF‐b1‐responsive elements (Nilsson et al., 1995), suggesting that the GL a promoters themselves may not contain enough sequence information to ensure subclass‐restricted expression. Additional cis‐elements, such as the 30 enhancers, independent of the TGF‐b1 pathway, may thus be required. Even though a sequence comparison shows that the a1 and a2 core enhancer elements are almost identical, there are important structural differences between the two loci where the a2HS1,2 element is inverted relative to the a1HS1,2 (Fig. 4A). It is also located at a greater distance from the HS3 than in the a1 locus (Mills et al., 1997). Indeed, we have shown that the
C L A S S S W I T C H R E C O M B I N AT I O N
27
a1HS1,2 element has a stronger effect on the GL g3 promoter than the corresponding a2 elements (Pan et al., 2000). Thus, the current hypothesis suggests that the 30 a1 and a2 enhancers primarily influence the first (Cg3‐ Cg1‐Cce‐Ca1) and second (Cg2‐Cg4‐Ce‐Ca2) block of duplicated IGHC region genes, respectively. However, the specific factors that would turn on the a1 or a2 enhancer, and subsequently the expression of the genes in the first or second block, respectively, remain to be identified. 3.5.1. IgA Production in mMT Mice and Cm‐Deficient Patients For switching and subsequent production of IgA, additional differences may exist that may not relate to the difference in the number of IgA genes. A previous study from Zinkernagel’s group has shown that IgA is selectively expressed in mMT mice, which lack IgM or IgD expression and have a pro‐B cell developmental block (Macpherson et al., 2001). The mMT IgA pathway requires extrasplenic peripheral lymphoid tissues and has previously been suggested as an evolutionarily primitive system in which immature B cells can switch to IgA production at peripheral sites (Macpherson et al., 2001). Patients with mutations or deletions in the Cm gene (IgMD), which prevent IgM surface expression on B cells, have also been described previously (Lopez Granados et al., 2002; Yel et al., 1996). These patients are highly susceptible to infections in the respiratory tract and often succumb at an early age, suggesting that, in contrast to the mouse model described above, serum and secretory IgA might be low or absent. Indeed, using ELISA, we found that although IgA was present in the sera of the patients, it was expressed at about two orders of magnitude lower than those found in the mMT mice (Pan et al., 2002a). No IgA was found in saliva from these patients, nor could any fecal IgA can be detected (Pan et al., 2002a). While IgAþ cells were detected in histological sections taken from the ileum and spleen of mMT mice (Macpherson et al., 2001), no IgAþ cells could be visualized in intestinal biopsy or nasal biopsy from IgMD patients (Pan et al., 2002a). The direct IgA switching pathway described in mice therefore contributes little, if any, to the mucosal defense system in humans. 3.6. Regulation of CSR to IgG Subclasses in Human and Mouse 3.6.1. Functional Properties of IgG Subclasses in Human and Mouse Both human and mouse IgG can be subdivided into four subclasses. However, as diversification of the IgG‐subclass‐encoding genes have occurred after the divergence of the two species, a given subclass in humans, for instance IgG1 or IgG3, is not the ‘‘functional homologue’’ of mouse IgG1 or IgG3.
28
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
In humans, the four IgG subclasses differ in their relative serum abundance, half‐life, ability to activate complement, affinity for Fcg receptors, and are preferentially directed against different types of antigens. IgG1 is the predominant serum IgG subclass (66%), followed by IgG2 (24%), IgG3 (7%), and IgG4 (3%). IgG1 and IgG3 appear early in ontogeny (Morell et al., 1972a; Oxelius, 1979), are efficient activators of the classical complement pathway (Bru¨ggemann et al., 1987), bind to high‐affinity FcgRI receptors, and are directed mainly against protein antigens. IgG2 appears much later in ontogeny and is primarily directed against polysaccharide antigens (Hammarstro¨m et al., 1986). IgG3 is sensitive to proteolytic degradation (Turner et al., 1970) and has the shortest half‐life of all subclasses. IgG4 antibodies are functionally monovalent and do not, under normal circumstances, activate complement. Raised levels of IgG4 antibodies are often noted against selected protein antigens after chronic exposure (Aalberse et al., 1983) and are involved in a variety of allergic diseases (Djurup, 1985; Perelmutter, 1984). In mice, the four IgG subclasses are also endowed with different biological and functional properties, although these have not been studied in as much detail as in humans. The serum abundance of the four IgG subclasses varies in mice with different genetic backgrounds. In BALB/c, IgG1 is the predominant serum IgG subclass whereas in C57BL/6, IgG2b has the highest serum concentration (Shimizu et al., 1982). IgG1 is dominant in response to parasitic infections. It does not activate complement very efficiently but can stimulate phagocytosis through interaction with Fc receptors. IgG2a can efficiently activate the complement cascade, binds to high‐affinity Fc receptors, and is important for control of viral infections (Coutelier et al., 1987). IgG2b and IgG3 are mainly induced by T‐independent antigens such as polysaccharide antigens and in this respect are the ‘‘functional homologue’’ of human IgG2. 3.6.2. Differential Regulation of CSR to IgG Subclasses by Cytokines Thus far, no human IgG‐subclass‐specific ‘‘switch factor’’ has been described. In the presence of anti‐CD40 antibodies, IL‐4 can induce CSR to IgG1, IgG3, and IgG4 (Armitage et al., 1993; Fujieda et al., 1995), whereas IL‐10 induces CSR to IgG1 and IgG3 (Briere et al., 1994; Fujieda et al., 1996). IL‐10 is not a switch factor for IgG4, but addition of IL‐10 augments IL‐4‐induced g4 expression and IgG4 production (Jeannin et al., 1998). Cg3 expression seems to be upregulated by IL‐4 in the presence of B cell activators such as Staphylococcus aureus Cowan I (SAC) or PMA (Kuze et al., 1991), however, neither SAC nor PMA are switch‐inducing stimuli. IFN‐g has been shown to cooperate with IL‐6 to induce IgG2 production in human B cells (Kawano et al., 1994), however, it is unlikely that it acts as a switching factor for IgG2 as its
C L A S S S W I T C H R E C O M B I N AT I O N
29
enhancing effect on IgG2 production is not observed when using IgG2‐ negative cells (Kawano et al., 1994). Regulation of CSR to mouse IgG subclasses is different from that in humans. In mouse B cells, IL‐4 directs CSR to IgG1, but not to other IgG subclasses, whereas IFN‐g selectively induces CSR to IgG2a and, under certain circumstances, IgG3 (Stavnezer, 2000). Studies have also shown that IL‐27 can induce CSR to IgG2a in B cells activated with anti‐CD40 antibody or LPS, in an IFN‐g‐independent manner (Yoshimoto et al., 2004). LPS alone induces CSR to IgG2b and IgG3 and addition of TGF‐b or IL‐10 further increase CSR to IgG2b or IgG3, respectively (Stavnezer, 2000). 3.6.3. GL Promoters in Human and Mouse Sequences located upstream of each Sg region, including the Ig exons and the corresponding Ig promoter region, are highly conserved among the four human Cg subclasses (Mills et al., 1995). When comparing these sequences with mouse GL g2b transcripts, a 175 bp evolutionarily conserved sequence (ECS‐Ig) was previously identified (Mills et al., 1995; Sideras et al., 1989; Fig. 5). The overall homology between human and mouse ECS‐Ig is 65%, which is remarkable for intron sequences, suggesting that it contains important regulatory elements. Indeed, three NF‐kB‐binding sites have been identified in the mouse ECS‐Ig and appear to be required for induction of transcriptional activity of the GL g1 promoter by CD40 engagement (Lin and Stavnezer, 1996). A STAT6‐binding site located upstream of the NF‐kB‐binding sites has also been identified in the mouse GL g1 promoter and is important for induction by IL‐4 (Lundgren et al., 1994). The three NF‐kB‐binding sites, particularly the first one, are highly conserved between human and mouse ECS‐Ig regions (Fig. 5). Encouraged by this observation, human GL Ig3 (Pan et al., 2000; Schaffer et al., 1999), Ig1 (Bhushan and Covey, 2001), and Ig4 (Agresti and Vercelli, 2002) promoters were subsequently characterized. At least two additional NF‐kB‐binding sites and one STAT6‐binding site, all located downstream of the first three NF‐kB‐ binding sites, are required for activation of the human Ig3 promoters (Pan et al., 2000; Schaffer et al., 1999; Fig. 5). These sites are located in the 30 half of the ECS‐Ig; however, they are not conserved between species. A 36‐bp region in the human GL g1 promoter, downstream of the ECS‐Ig, and containing CREB/ATF‐ and NF‐kB‐binding sites, has been shown to contribute to the difference in expression of g1 and g3 GL transcripts (Bhushan and Covey, 2001; Dryer and Covey, 2005). In the human GL g4 promoter, in addition to the region containing the conserved NF‐kB‐binding sites, an additional IL‐4/ CD40 responsive element, that binds STAT6 and interacts selectively with
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
30 A
STAT6/CEBP
NF-k B 1
2
1
2
3
Mouse GL g 1 promoter NF-k B Human GL g 3 promoter
3
STAT6 4
5
ECS-Ig
B Mouse Ig 1
ECS-Ig NF-k B 1 −139 STAT6 CACCCTCACCCACACATTCACATGAAGTAATCTAAGTCAGGTTTGGACTCCCCCTCACCCTCT
Human Ig 3
CACCCCCATCCCCACACACCCATGAGGCAGCCTCGGCTGTGTCTGGACTCCCCCTTACCCTGT −229 NF-k B 3 NF-k B 3
Mouse Ig 1
GACACAGAAACCCCCAGAATGAAGGGGAACCCTGTCAGGAAATAGCCTTATGCCACCACTGTC
Human Ig 3
GACACAGAAACCACCAGAAGAAAAGGGAAC..T.TCAGGAAGTAAGC.GGTGCCGCCGGTTTC
Mouse Ig 1
+1 AATCCTGTTCTTAGTCAATCATATGATGGAAAGAGGGTGACATTACCTCTCTGGGACAAAGGC
Human Ig 3
AATCCTGTTCTTAGTC.TTTGCAGCGTGGAGTTCACACCCCTGGGGACCTGAGGGCCGAGCTG NF-k B 4 NF-kB 5
Mouse Ig 1
TGTGACTCTGGGAAAGACAAGAGAAGGGCACAG...GAACAGAGACGGCTG
Human Ig 3
TGATTTCCTAGGAAGACAAATAGCAGCTGACGGCGTGGGCAAGTCTGCCCA +1 STAT6 ECS-Ig
Figure 5 Comparison of human and mouse GL g promoters. (A) Schematic map of the human GL g3 and mouse GL g1 promoters. Black boxes represent the conserved transcription factor‐ binding sites whereas gray boxes indicate partially conserved motifs. Striped boxes represent transcription factor‐binding sites that are unique in human GL g3 promoters. (B) Nucleotide sequences of the evolutionarily conserved region. The transcription factor‐binding sites are boxed. The initiation site of the human g3 or mouse g1GL transcript is indicated as ‘‘þ1,’’ above or below the sequences.
c‐Rel, has been identified (Agresti and Vercelli, 2002). Regulation of CSR to IgG2 in human B cells is still poorly understood and the GL g2 promoter is the only GL g promoter that has not been characterized to date. Given the marked homology of the ECS‐Ig2 with the other human ECS‐Ig regions, a differential regulation of CSR to IgG2, is most likely determined by regulatory elements located outside the ECS‐Ig regions. One concern for the GL promoter studies is that different results are often obtained when different cell lines are studied (Lin and Stavnezer, 1996; Pan et al., 2000; Schaffer et al., 1999; Warren et al., 1999). These differences may
C L A S S S W I T C H R E C O M B I N AT I O N
31
be the result of variations in the expression of cellular and nuclear factors responsive to CD40 and/or IL‐4 pathway‐associated signals. Furthermore, experiments from transgenic mice suggest that cis‐acting elements upstream of the three NF‐kB‐ and STAT6‐binding sites might be critical for the GL g1 transcription (Berton et al., 2004). Thus, the relevance of studies in B cell lines for the function of these promoters in normal B cells remains to be elucidated. 3.7. CD40–CD40L Pathway in Human and Mouse The phenotypes of human patients with HIGM type I (CD40L deficient) and type III (CD40 deficient) have largely been confirmed in mouse ‘‘knockout’’ experiments where either the CD40‐ or the CD40L‐encoding genes have been inactivated by HR (Castigli et al., 1994; Kawabe et al., 1994; Renshaw et al., 1994; Xu et al., 1994). Unlike ‘‘classical’’ HIGM patients, normal levels of serum IgM have been observed in both CD40 and CD40L knockout mice. This phenotype was, however, noted in a later study on 56 CD40L‐deficient patients where the majority (52.7%) had normal IgM serum levels at the time of diagnosis (Levy et al., 1997). It thus appears that IgM serum levels may increase with age, particularly if initiation of IVIG substitution therapy is delayed (Levy et al., 1997). It would thus be interesting to study the IgM level in aged CD40L‐ and CD40‐deficient mice. Another notable difference between CD40L‐ or CD40‐deficient mice and HIGM patients is that these mice show reduced, albeit detectable, levels of serum IgG with a relatively normal level of IgG3 (Kawabe et al., 1994; Renshaw et al., 1994), whereas the majority of patients (92% for CD40L‐deficient and two out of three CD40‐deficient patients) have undetectable levels of IgG (Ferrari et al., 2001; Levy et al., 1997). This may reflect a difference between T cell‐independent immune responses of mice and humans. The CSR pathways other than CD40–CD40L may be more prominent in mice than in humans. In mouse B cells, CD40 signaling itself induces GL g1 and e transcription and together with IL‐4, it induces CSR to IgG1 and IgE (Stavnezer, 2000). In the presence of TGF‐b1, IL‐4, IL‐5, and anti‐d antibody immobilized on dextran, CD40L can also replace LPS to induce CSR to IgA (Snapper et al., 1995). In human B cells, antibodies to CD40 or CD40L have provided the first relatively efficient means for induction of CSR. In the presence of IL‐4, anti‐ CD40 antibodies induce GL e transcripts and switching to IgE (Gascan et al., 1991). This combination of stimulators also induces secretion of all IgG subclasses and the respective GL transcripts except IgG2 (Fujieda et al., 1995). In the presence of TGF‐b, IL‐10, and SAC, anti‐CD40 antibody‐activated B cells also secrete an increased amount of IgA (Defrance et al., 1992). Interestingly, anti‐CD40 antibodies and IL‐10 also induce production of normal, or close to
32
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
normal, amounts of IgA and IgG in cells from IgA deficient (IgAD) and a subgroup of common variable immunodeficiency (CVID) patients (Eisenstein et al., 1994; Friman et al., 1996; Nonoyama et al., 1993; Pan‐Hammarstro¨m et al, unpublished data), suggesting that abnormalities in these patients are probably reversible and regulatory in origin. 3.8. BAFF–APRIL–TACI Pathway in Human and Mouse BAFF and APRIL activate IgG, IgA, and IgE switching in both human and mouse B cells (Castigli et al., 2005b; Litinskiy et al., 2002). In human B cells, however, secretion of class‐switched antibodies requires additional signals that include cross‐linking of the B cell receptor and cytokines such as IL‐15 or IL‐2 (Litinskiy et al., 2002). TACI, which is encoded by TNFRSF13B, binds both BAFF and APRIL. Two TACI‐deficient mouse models have been described to date. In the first model, a significant decrease in serum IgM and IgA concentrations were observed, despite an increased number of circulating and splenic B cells. The responses to T‐independent type II antigens were also abolished (von Bulow et al., 2001). In the second model, TACI deficiency resulted in profound B cell hyperplasia, lymphoma development, and severe autoimmune disease with lupus‐like symptoms (Seshasayee et al., 2003; Yan et al., 2001). No antibody deficiency was observed and the TACI‐deficient B cells instead produced increased amounts of Igs in vitro (Yan et al., 2001). On the basis of the data from the second mouse model, TACI was suggested to play an important role in the negative regulation of B cell activation. It is currently unclear why such discrepancies were noted in the two models, although it might be due to differences in the targeting strategies (deleting exons 1 and 2 versus sequences that correspond to the transmembrane and intracellular regions of TACI in the second model) or different genetic backgrounds of the mice. Homozygous or compound heterozygous mutations in TNFRSF13B were identified in a few patients with CVID (Castigli et al., 2005a; Salzer et al., 2005). These mutations resulted in loss of TACI function, as evidenced by impaired proliferative responses to IgM‐APRIL costimulation and defective CSR induced by APRIL or BAFF. In contrast to the second mouse model, TACI‐deficient patients are characterized by humoral immunodeficiency, with substantially reduced serum concentrations of IgM, IgG, and IgA. The total number of peripheral B cells is, however, normal and signs of autoimmunity and lymphoproliferation are not dominant features (Salzer et al., 2005). By analyzing B cells from mice deficient in TACI (the first model), BCMA, and BAFF‐R, Castigli et al. (2005b) have shown that TACI‐deficient B cells do not synthesize IgG1, IgA, and IgE in response to APRIL but are able
C L A S S S W I T C H R E C O M B I N AT I O N
33
to produce IgG1 and IgE in response to BAFF. These results suggest that APRIL‐induced CSR to all isotypes and BAFF‐induced CSR to IgA are mediated by TACI whereas BAFF‐induced CSR to IgG1 and IgE may be mediated by both TACI and the BAFF‐R. Normal CSR activity was observed in BCMA‐ deficient B cells suggesting that signal through this receptor is not required for CSR (Castigli et al., 2005b). However, neither APRIL nor BAFF can induce CSR and subsequent IgG production in vitro in TACI‐deficient human B cells (Salzer et al., 2005). This could potentially explain the observed phenotypic difference, where most of the individuals with TACI deficiency show reduced serum levels of both IgA and IgG, whereas TACI‐deficient mice express normal levels of IgG. Taken together, the existing data suggest that TACI can mediate CSR induced by APRIL/BAFF in both human and mouse B cells, although it might be of greater importance for IgG production in humans. The human TACI‐deficient phenotype is also different from the mouse models as neither severe B cell hyperplasia nor features of systemic lupus erythematosus have been observed. The dichotomy between gene deletion (mice) and point mutations (humans) cannot fully explain the species difference, as individuals with a complete lack of the TACI protein show a similar phenotype as patients with hypomorphic homozygous or heterozygous point mutations in the TACI‐ encoding gene. Alternatively, species differences might exist in the BAFF– APRIL–TACI system with regard to B cell homeostasis and humoral immune responses. This should be taken into account when designing drugs aimed at interfering with the BAFF–APRIL–BAFFR–TACI–BCMA system, as previously suggested (Gross et al., 2001). 3.9. Toll and Toll‐Like Receptor in Human and Mouse In contrast to findings in mice, LPS is not a switch factor for human B cells, probably due to a lack of expression of TLR4 on the B cell surface. However, TLR4 expression can be induced in human B cells by stimulation with IL‐4 (Mita et al., 2002), suggesting that human B cells might still be susceptible to LPS–TLR4 signaling under certain conditions. In addition, human monocytes express TLR4, which may indirectly influence CSR through secretion of cytokines. In light of these findings, we may need to reevaluate the role of the LPS–TLR4 pathway in CSR in humans. But if there is indeed an effect, it is probably less potent than in mice. Both human and mouse B cells express TLR9. In the mouse, CpG DNAs direct CSR and subsequent Ig production to ‘‘Th1‐like’’ Ig isotypes (IgG2a, IgG2b, and IgG3) while suppressing expression of Th2 isotypes (IgG1 and IgE) in a TLR9‐dependent manner (Lin et al., 2004; Liu et al., 2003). A study
34
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
further showed that TLR9 signaling is required for CSR to pathogenic IgG2a and IgG2b autoantibodies in a murine SLE model (Ehlers et al., 2006). In humans, CpG DNAs can induce CSR to IgG1, IgG2, and IgG3, but subsequent IgG production requires additional stimulation by factors such as anti‐ BCR, BAFF, or CD40L (He et al., 2004), suggesting that CpG DNAs are less potent in human than in murine B cells. The same study also pointed out that CpG DNAs inhibited IL‐4‐induced Ce GL transcription. However, the authors did not show whether this would influence subsequent IgE switching and/or the production of IgE (He et al., 2004). There is thus far no human disease associated with mutations in the gene encoding TLR9. However, a recent study by Cunningham‐Rundles et al. showed that TLR9 activation is defective in CVID patients. They observed that CpG DNA did not upregulate expression of CD86 on cells in these patients, even when costimulated via the BCR, nor did it induce production of IL‐6 or IL‐10 as in normal B cells (Cunningham‐Rundles et al., 2006). In addition, CpG‐activated dendritic cells from CVID patients produced subnormal levels of IFN‐a. The study, however, did not provide evidence that CSR to IgG through the CpG–TLR9 pathway is actually impaired in these patients. 3.10. DNA Repair Factors and CSR Individuals with defective DNA repair mechanisms display pleiotropic phenotypes including a predisposition to cancer, neurodegeneration, and developmental abnormalities. Immunodeficiency is increasingly recognized as a feature of some of these syndromes and the underlying mechanism appears to be that the general DNA repair machinery is also required for rearrangements of the T and B cell receptor genes, that is V(D)J recombination and CSR. Table 3 highlights the clinical manifestations and the phenotypes of CSR in primary immunodeficiency patients with known defects in DNA repair/ recombination. As targeted disruption of the genes encoding ATR, NBS1, Mre11, and DNA ligase IV all result in embryonic lethality, the corresponding human disease models have provided unique opportunities to study the role of these DNA repair factors in CSR. In the case of H2AX, 53BP1, and MDC1 on the other hand, only mouse models are available thus far. Below, we will focus on the comparison of a few human diseases and mouse knockout models that are relevant for CSR. 3.10.1. UNG Deficiency in Human and Mouse UNG deficiency (HIGM5) has been described in a few patients with a phenotype resembling AID deficiency (HIGM2), including susceptibility to bacterial infections, lymphoid hyperplasia, increased serum IgM concentrations, and
Table 3 DNA Repair Defects Affecting CSR, a Comparison Between Human Diseases and Mouse Knockout Models Patients carrying mutations
35
Gene (syndrome)
Clinical manifestations
UNG (hyper‐IgM syndrome 5) MLH1
Immunodeficiency, lymphoid hyperplasia Cancer predisposition
MSH2
ATM (ataxia‐ telangiectasia, A‐T) ATR (Seckel syndrome, ATRD)
CSR
Knockout mouse model Phenotype
CSR
References
In vitro CSR reduced Reduced, altered S junctional pattern (" microhomology)
Imai et al., 2003; Rada et al., 2002 Hackman et al., 1997; Ricciardone et al., 1999; Schrader et al., 1999, 2002; Vilkki et al., 2001; Wei et al., 2002 Ehrenstein and Neuberger, 1999; Schrader et al., 1999, 2002; Wei et al., 2002; Whiteside et al., 2002 Lumsden et al., 2004; Pan et al., 2002b; Reina‐San‐Martin et al., 2004 Pan‐Hammarstro¨m et al., 2006
Impaired
Normal
NA
Cancer predisposition, infertile
Cancer predisposition Immunodeficiency?
NA
Cancer predisposition
Reduced, shift of CSR breakpoints
Ataxia, telangiectasias, immunodeficiency, radiosensitivity, cancer predisposition Microcephaly, growth retardation, immunodeficiency?
Reduced, altered S junctional pattern (" microhomology)
Growth retardation, immunodeficiency, thymic lymphoma, infertile Embryonic lethality
Reduced, normal or altered S junctional pattern (" microhomology) NA
Altered S junctional pattern (" microhomology)
(Continued)
Table 3 (Continued) Patients carrying mutations Gene (syndrome) NBS1 (p95) (Nijmegen breakage syndrome, NBS)
Clinical manifestations
CSR
Phenotype
Microcephaly, radiosensitivity, immunodeficiency, cancer predisposition
Reduced, altered S junctional pattern (" microhomology)
NBS1/, embryonic lethality NBS1m/m, growth retardation, radiosensitivity, immunodeficiency, thymic lymphoma NBS1DB/DB, radiosensitivity NBSD/ Embryonic lethality
Reduced NA
Embryonic lethality
NA
Barnes et al., 1998; Pan‐Hammarstro¨m et al., 2005
Radiosensitivity, immunodeficiency
Normal
Moshous et al., 2001; Rooney et al., 2003, 2005
36 Mre11 (ataxia‐ telangiectasia like disorder, ATLD) DNA ligase IV (LIG4 syndrome)
Artemis (RS‐SCID)
Knockout mouse model
Ataxia, radiosensitivity
Microcephaly growth retardation, photosensitivity, immunodeficiency Radiosensitivity, severe combined immunodeficiency
Reduced, altered S junctional pattern (altered mutation pattern) Impaired, altered S junctional pattern (" microhomology) NA
CSR NA NA
NA
References Dumon‐Jones et al., 2003; Kang et al., 2002; Kracker et al., 2005; La¨hdesma¨ki et al., 2004; Pan et al., 2002b; Reina‐San‐Martin et al., 2005; Williams et al., 2002; Zhu et al., 2001
La¨hdesma¨ki et al., 2004; Xiao and Weaver, 1997
C L A S S S W I T C H R E C O M B I N AT I O N
37
markedly decreased serum levels of IgG and IgA (Imai et al., 2003). The deficiency causes a profound impairment in CSR at a DNA precleavage step and also an altered pattern of SHM (Imai et al., 2003). The UNG mouse knockout model largely resembles the UNG‐deficient patient phenotype, although with only a partial defect in CSR (Rada et al., 2002). It is therefore possible that additional DNA glycosylases, such as SMUG1, exert a redundant activity in mice. However, although SMUG1, when overexpressed, can partially substitute for UNG in SHM and restore the CSR defect in Msh2 and UNG double knockout mice, it only plays a minor role in antibody diversification (Di Noia et al., 2006). Alternatively, the MSH2 pathway is more important as a backup pathway in mice during CSR. In humans, individuals with heterozygous germ line mutations in one of the MMR genes, including MLH1, MSH2, MSH6, PMS1, and PMS2, are at risk of developing hereditary nonpolyposis colorectal cancer. A few individuals with homozygous or compound heterozygous germ line mutations in the MLH1, MSH2, and MSH6 genes have also been described and these patients suffer from early‐onset brain tumors, hematological malignancies, or colorectal carcinomas and adenomas (Bougeard et al., 2003; Hackman et al., 1997; Hegde et al., 2005; Vilkki et al., 2001; Whiteside et al., 2002). Immunodeficiency has not been noted in these individuals, with one exception, where a child carrying a homozygous mutation in the MSH2 gene had IgA deficiency (Whiteside et al., 2002). It would thus be of considerable interest to study the CSR process in cells from MLH1‐, MSH2‐, and MSH6‐deficient individuals.
3.10.2. APEX in Human and Mouse To date, two AP endonucleases, APEX1 and APEX2 have been identified in mammalian cells. As discussed above, there is as yet no evidence that either of them is involved in CSR, even though such an endonuclease activity is expected to be required in the AID–UNG pathway. Knocking out APEX1 results in embryonic lethality (Xanthoudakis et al., 1996) whereas APEX2‐null mice exhibit growth retardation, attenuated immune responses, and radiosensitivity (Ide et al., 2004). No equivalent human disease has been described as yet, although several sequence variants have been identified in the gene encoding human APEX1 and four of the variants exhibit reduced DNA repair capacity in an in vitro assay (Hadi et al., 2000). APEX1 is highly conserved between mouse and human, with a 94% AA sequence identity whereas APEX2 only shows about 80% sequence identity. The highly diversified sequence near the C‐terminus of the latter may provide
38
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
multiple protein–protein interacting surfaces, including one for PCNA; some of which may be species specific (Ide et al., 2003). The human APEX2 gene is located on the X chromosome and a human disease resulting from APEX2 deficiency, as anticipated from the mouse knockout model, might present itself as an X‐linked form of immunodeficiency, with growth retardation and radiosensitivity.
3.10.3. ATM Deficiency in Human and Mouse ATM deficiency in humans results in a rare, complex, multisystem disorder ataxia‐telangiectasia (A‐T), which is characterized by cerebellar degeneration with ataxia, ocular, and cutaneous telangiectasias, radiosensitivity, chromosomal instability, and cancer predisposition (Chun and Gatti, 2004). A‐T is also recognized as a primary immunodeficiency syndrome involving both humoral and cellular immunity (Peterson et al., 1963; Regueiro et al., 2000). IgA deficiency has been observed in 60–80% of the patients, and a subgroup suffers from concomitant IgG subclass deficiency, suggesting a defect in CSR and subsequent production of downstream Ig isotypes. As T cells from A‐T patients are abnormal, it is unclear whether the proposed CSR defect is due to intrinsic defects in the B cells, lack of T cell help, or both. By analyzing the in vivo switched B cells, we have previously demonstrated that the Sm‐Sa switch recombination junctions in A‐T patients are aberrant and characterized by a strong dependence on short sequence homologies (microhomology; average 7.2 bp versus 1.8 bp in controls, p ¼ 2.6 107) and a lack of normally occurring mutations around the breakpoint (Pan et al., 2002b). These observations have provided the first clue that ATM might be directly involved in the final steps of CSR, including DNA end modification, repair and joining, and the antibody deficiencies in A‐T patients could thus be due to intrinsic defects in the B cells. We have subsequently shown that the pattern of mutations in the VH regions is largely normal in A‐T patients, suggesting that the SHM process is unaffected (Pan‐Hammarstro¨m et al., 2003). Thus, ATM, and ATM‐dependent signaling, appears to play a specific role in CSR. ATM‐deficient mice have been generated in several laboratories in the mid‐ 1990s (Barlow et al., 1996; Elson et al., 1996; Xu et al., 1996). These mice exhibit growth retardation, infertility, radiosensitivity, defects in T cell maturation, and development of thymic lymphomas, features that resemble the human disease. However, neither ataxia nor telangiectasias are readily observed in these mouse models. Furthermore, levels of serum IgA are normal (Xu et al., 1996), suggesting that B cells may be functionally intact in ATM‐ deficient mice.
C L A S S S W I T C H R E C O M B I N AT I O N
39
Studies in vitro have, however, shown that B cells from ATM‐deficient mice cannot switch to downstream isotopes, including IgA, as efficiently as do wild‐ type B cells (Lumsden et al., 2004; Reina‐San‐Martin et al., 2004). The defect in CSR is not due to alterations in GL transcription or DNA damage checkpoint protein (53BP1) recruitment (Lumsden et al., 2004; Reina‐San‐Martin et al., 2004). Furthermore, the intra‐switch recombination proceeds normally, whereas the long‐range inter‐switch recombination is defective, suggesting a role for ATM in S region synapsis during CSR (Reina‐San‐Martin et al., 2004). CSR junctions have also been analyzed in ATM‐deficient mouse B cells. However, only one of the two studies showed a small, albeit significant, increase in the length of sequence homology (2.6 bp versus 1.2 bp in wild‐type cells; Lumsden et al., 2004). It should be noted that only Sm–Sg1 junctions have been analyzed in these mice, whereas in humans, Sm–Sa and Sm–Sg junctions were all characterized. The microhomology‐based end joining is much more prominent in Sm–Sa as compared to Sm–Sg junctions in A‐T patients (Pan et al., 2002b; Pan‐Hammarstro¨m et al., 2006). This is also evident in other patients studied to date, including ATR‐, Ligase IV‐, Mre11‐, and NBS1‐deficient patients (La¨hdesma¨ki et al., 2004; Pan‐Hammarstro¨m et al., 2004, 2006). This is probably due to the higher degree of homology between Sm and Sa as compared to Sm and Sg regions, where the likelihood of obtaining a 7‐, 10‐, or 15‐bp microhomology between the Sm–Sa regions is 8‐, 270‐, and >1000‐fold higher than in the Sm–Sg regions, respectively. Furthermore, in A‐T‐ and ATR‐deficient patients, the Sm–Sg junctions tend to use more microhomologies, whereas in Lig4D patients, the Sm–Sg junctions mainly show an increased frequency of 1‐bp insertions (Pan‐Hammarstro¨m et al., 2005). Moreover, the mutation pattern at, or close to, the Sm–Sg junctions is different from the Sm–Sa junctions in normal controls (Pan and Hammarstro¨m, 1999). Taken together, the Sm–Sa and Sm–Sg junctions are resolved differently in controls and patients with various defects in their DNA repair systems. In mice, the Sa regions also show a much higher degree of homology with Sm, than does Sg, and the microhomology‐based pathway would be a more attractive alternative for Sm/Sa recombination when the normal repair pathway(s) is impaired. However, as in the case of ATM‐deficient mice, in most mouse knockout models described to date, Sm–Sa junctions have not been analyzed in as much as detail as Sm–Sg1 and Sm–Sg3 junctions (Manis et al., 2004; Reina‐San‐Martin et al., 2003; Schrader et al., 2002; Ward et al., 2004). Thus, when summarizing the human and mouse models, one should be careful not to compare the human Sm–Sa junctions with the mouse Sm–Sg junctions directly and conclusions like ‘‘normal CSR junctions’’ based on Sm–Sg data alone may need to be reevaluated.
40
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
Another point also deserves more attention: in A‐T patients, the CSR junctions have been amplified from unstimulated PBL, whereas in ATM‐ deficient mice, CSR junctions are amplified from either IL‐4 þ CD40L stimulated (Lumsden et al., 2004) or IL‐4 þ LPS stimulated (Reina‐San‐Martin et al., 2004) B cells. Our own unpublished data suggest that in normal individuals, the average length of microhomology at Sm–Sa junctions is significantly longer in IL‐10 þ CD40L stimulated cells than that in unstimulated cells (3.9 bp versus 2.0 bp). This suggests that, in addition to the availability of DNA repair factors and the degree of homology between the S regions, differential stimulation by cytokines or other activators might also alter the balance between the DNA repair pathways used in CSR. 3.10.4. NBS1 Deficiency in Human and Mouse NBS1 deficiency in humans results in a rare hereditary disease, NBS, which is characterized by immunodeficiency, microcephaly, chromosomal instability, and an extremely high incidence of lymphoid malignancies (Digweed and Sperling, 2004). Most NBS patients are of Slavic origin and are homozygous for the founder NBS1 mutation, 657del5 (Varon et al., 1998). This mutation was first regarded as a null mutation; however, it was later shown to be hypomorphic, and a truncated 70‐kDa NBS1 protein can be produced through an alternative initiation of translation upstream of the 5‐bp deletion (Maser et al., 2001). The immunodeficiency in NBS is severe and affects both humoral and cellular immunity (van der Burgt et al., 1996). Absent or low serum levels of IgG and/or IgA is observed in 80–90% of the patients with IgG4 being most often affected (74%), followed by IgG2 (67%), IgG1 (63%), and IgA (50%) (Gregorek et al., 2002; van der Burgt et al., 1996). As in A‐T patients, a CSR defect has been proposed but it is unclear whether the defect is due to an intrinsic defect in the B cells. By analyzing the in vivo‐switched B cells, we have previously shown a reduced level of switching to IgA in NBS patients (all homozygous for the 657del5; Pan et al., 2002b). There was also a significantly increased length of sequence homology at the Sm–Sa junctions (average 3.6 bp versus 1.8 bp in controls, p ¼ 0.028); however, not as dramatic as in those from A‐T patients (Pan et al., 2002b). In addition, a high rate of mutation was observed in the Sm–Sa junctions from NBS patients, which is clearly different from those in A‐T patients. Less dependence (but still significant as compared to controls) on microhomology and a normal or high rate of mutation at or close to the breakpoints were also features of Sm–Sg recombination in NBS patients (Pan et al., 2002b). Thus, the NBS1 protein seems to be directly involved in the
C L A S S S W I T C H R E C O M B I N AT I O N
41
CSR reaction but it may have other functions in addition to interacting with ATM. Targeted disruption of the NBS1 gene (deletion of NBS promoter, exon 1 and intron 1, or deletion of exon 6) leads to early embryonic lethality in mice (Dumon‐Jones et al., 2003; Zhu et al., 2001). However, viable knockout mice have been generated by replacing either the NBS1 exons 2 and 3 (NBS1m/m; Kang et al., 2002) or exons 4 and 5 (NBS1DB/DB; Williams et al., 2002) with a neomycin resistance gene. Although both mutants show some of the features that are found in NBS patient cells, including cell‐cycle checkpoint defects, there are also notable phenotypic differences when compared to patients, in particular with regard to humoral immunodeficiency. NBS1m/m mice are growth retarded, hypersensitive to ionizing radiation, defective in T‐dependent antibody responses and rapidly develop thymic lymphomas. However, a normal level of serum IgG has been observed (IgA levels were not shown). NBS1DB/DB mice show no immunodeficiency and are not prone to development of malignancy. No CSR assay has been performed in either of these models to date. Using a cell‐type‐specific conditional inactivation strategy, two studies have shown that CSR to various IgG subclasses is reduced in NBS1‐deficient B cells (NBS1D/, CD19creþNBS1/LoxP; Kracker et al., 2005; Reina‐San‐Martin et al., 2005). The CSR defect is independent of GL transcription and appears to be a consequence of inefficient recombination at the DNA level (Reina‐San‐Martin et al., 2005). In both studies, normal CSR junctions, in terms of microhomology usage and mutation occurrence, were found. However, only Sm–Sg1 junctions were analyzed and the junctions were derived from cells stimulated by LPS and IL‐4. In addition, in one of the studies, only 75% of the cells were NBS deficient after tat‐Cre treatment and the ‘‘normal’’ CSR junctions might thus actually be derived from NBS‐proficient cells (Kracker et al., 2005). A humanized mouse model for NBS has been developed where the human 5‐bp deletion hypomorphic allele has been introduced into NBS‐deficient mice (hNBS1657D5mNBS1/; Difilippantonio et al., 2005). These mice show cell‐cycle checkpoint defects, T cell developmental defects, and gonadal abnormalities, which resemble some of the phenotypes in NBS patients. The serum levels of IgG1 and IgG3 were slightly reduced but B cells from these mice could produce normal levels of IgG1 and IgG3 after appropriate stimulation in vitro. Thus, although both the human studies (La¨hdesma¨ki et al., 2004; Pan et al., 2002b) and the conditional knockout mouse models (Kracker et al., 2005; Reina‐San‐Martin et al., 2005) suggest that NBS1 might be directly involved in CSR, curiously, the humanized mouse model does not show a defect in CSR, at least to IgG. No serum IgA level or IgA switching assay has, however, been reported in these mice. In view of the above reasoning on the
42
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
similarities of the Sm and Sa regions, it would thus be of considerable interest to study the Sm–Sa junctions in these mice. 4. Concluding Remarks In spite of the fact that humans and mice separated in evolution more than 60 million years ago, there are still remarkable similarities in the machinery involved in CSR. Having said that, there are also distinct characteristics, particularly regarding the regulation of CSR to IgA and various IgG subclasses. Humans and mice also show varying degrees of dependence on alternative/ backup systems for CSR to downstream isotypes. The phenotype of knockout mice most often only reflects part of the clinical picture in patients, which could be due to differences in the nature of the gene defect (null or hypomorphic), experimental procedures, and environmental factors. It should also be borne in mind that experiments on humans are carried out on individuals in an outbred population, whereas in mice, in essence, only a single individual is being tested (inbred strain). The different clinical manifestations in patients may reflect a crucial importance of modifying/interacting genes. It is thus interesting to note that distinct phenotypes have been observed in mice when different parts of the targeted gene have been inactivated and/or different mouse strains have been utilized, as exemplified by the TACI‐ and NBS‐deficient mouse models. The dissimilarities between different knockout models in mice may be a reflection of the interaction between the mutated gene and background genes and may thus help us to understand the full clinical spectrum in patients. We also hope that this chapter will raise awareness on species differences and that we should be cautious when extrapolating the function of a given molecule from one species to another and we need to understand and to acknowledge that each species has evolved unique mechanisms to combat infections. Notes added in proof (A) By analyzing the mutation pattern in the S regions in msh2/ung/ mice, Xue et al., 2006 have shown that in contrast to the in vitro systems (Bransteitter et al., 2003; Chaudhuri et al., 2003; Dickerson et al., 2003; Ramiro et al., 2003, AID‐catalyzed deamination in vivo occurs in a strand‐ symmetric manner, at both donor and acceptor S regions. (B) The phosphatidylinositol 3‐kinase (P13K) signaling has been shown to suppress CSR by interfering with AID transcription as well as its function (Omori et al., 2006). (C) In a study by Honjo and colleagues, UNG is found to play a novel noncanonical role in a CSR step that follows DNA cleavage (Begum et al., 2006).
C L A S S S W I T C H R E C O M B I N AT I O N
43
Acknowledgments This work was supported by the Swedish Research Council Cancerfonden and the Swedish Doctors Association. We thank Professor J. Stavnezer and Dr. K. Zhang for helpful comments on the manuscript and Professor W. Dunnick for providing mouse Sg region sequences.
References Aalberse, R. C., van der Gaag, R., and van Leeuwen, J. (1983). Serologic aspects of IgG4 antibodies. I. Prolonged immunization results in an IgG4‐restricted response. J. Immunol. 130, 722–726. Abraham, R. T. (2001). Cell cycle checkpoint signaling through the ATM and ATR kinases. Genes Dev. 15, 2177–2196. Agresti, A., and Vercelli, D. (2002). c‐Rel is a selective activator of a novel IL‐4/CD40 responsive element in the human Ig g4 germline promoter. Mol. Immunol. 38, 849–859. Ahnesorg, P., Smith, P., and Jackson, S. P. (2006). XLF interacts with the XRCC4‐DNA ligase IV complex to promote DNA nonhomologous end‐joining. Cell 124, 301–313. Akahori, Y., and Kurosawa, Y. (1997). Nucleotide sequences of all the gamma gene loci of murine immunoglobulin heavy chains. Genomics 41, 100–104. Arakawa, H., Iwasato, T., Hayashida, H., Shimizu, A., Honjo, T., and Yamagishi, H. (1993). The complete murine immunoglobulin class switch region of the alpha heavy chain gene‐hierarchic repetitive structure and recombination breakpoints. J. Biol. Chem. 268, 4651–4655. Arakawa, H., Hauschild, J., and Buerstedde, J. M. (2002). Requirement of the activation‐induced deaminase (AID) gene for immunoglobulin gene conversion. Science 295, 1301–1306. Armitage, R. J., Macduff, B. M., Spriggs, M. K., and Fanslow, W. C. (1993). Human B cell proliferation and Ig secretion induced by recombinant CD40 ligand are modulated by soluble cytokines. J. Immunol. 150, 3671–3680. Aupetit, C., Drouet, M., Pinaud, E., Denizot, Y., Aldigier, J. C., Bridoux, F., and Cogne, M. (2000). Alleles of the alpha1 immunoglobulin gene 30 enhancer control evolution of IgA nephropathy toward renal failure. Kidney Int. 58, 966–971. Bardwell, P. D., Martin, A., Wong, E., Li, Z., Edelmann, W., and Scharff, M. D. (2003). Cutting edge: The G‐U mismatch glycosylase methyl‐CpG binding domain 4 is dispensable for somatic hypermutation and class switch recombination. J. Immunol. 170, 1620–1624. Bardwell, P. D., Woo, C. J., Wei, K., Li, Z., Martin, A., Sack, S. Z., Parris, T., Edelmann, W., and Scharff, M. D. (2004). Altered somatic hypermutation and reduced class‐switch recombination in exonuclease 1‐mutant mice. Nat. Immunol. 5, 224–229. Barlow, C., Hirotsune, S., Paylor, R., Liyanage, M., Eckhaus, M., Collins, F., Shiloh, Y., Crawley, J. N., Ried, T., Tagle, D., and Wynshaw‐Boris, A. (1996). Atm‐deficient mice: A paradigm of ataxia telangiectasia. Cell 86, 159–171. Barnes, D. E., Stamp, G., Rosewell, I., Denzel, A., and Lindahl, T. (1998). Targeted disruption of the gene encoding DNA ligase IV leads to lethality in embryonic mice. Curr. Biol. 8, 1395–1398. Barreto, V. M., Pan‐Hammarstro¨m, Q., Zhao, Y., Hammarstro¨m, L., Misulovin, Z., and Nussenzweig, M. C. (2005). AID from bony fish catalyzes class switch recombination. J. Exp. Med. 202, 733–738. Basu, U., Chaudhuri, J., Alpert, C., Dutt, S., Ranganath, S., Li, G., Schrum, J. P., Manis, J. P., and Alt, F. W. (2005). The AID antibody diversification enzyme is regulated by protein kinase A phosphorylation. Nature 438, 508–511. Begum, N. A., Kinoshita, K., Muramatsu, M., Nagaoka, H., Shinkura, R., and Honjo, T. (2004). De novo protein synthesis is required for activation‐induced cytidine deaminase‐dependent
44
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
DNA cleavage in immunoglobulin class switch recombination. Proc. Natl. Acad. Sci. USA 101, 13003–13007. Begum, N. A., Izumi, N., Nishikori, M., Nagaoka, H., Shinkura, R., and Honjo, T. (2006). Requirement of non‐canonical activity of uracil DNA glycosylase for class switch recombination. J. Biol. Chem. (in press). Bemark, M., Sale, J. E., Kim, H. J., Berek, C., Cosgrove, R. A., and Neuberger, M. S. (2000). Somatic hypermutation in the absence of DNA‐dependent protein kinase catalytic subunit (DNA‐PK(cs)) or recombination‐activating gene (RAG)1 activity. J. Exp. Med. 192, 1509–1514. Bertocci, B., De Smet, A., Flatter, E., Dahan, A., Bories, J. C., Landreau, C., Weill, J. C., and Reynaud, C. A. (2002). Cutting edge: DNA polymerases mu and lambda are dispensable for Ig gene hypermutation. J. Immunol. 168, 3702–3706. Bertocci, B., De Smet, A., Berek, C., Weill, J. C., and Reynaud, C. A. (2003). Immunoglobulin k light chain gene rearrangement is impaired in mice deficient for DNA polymerase mu. Immunity 19, 203–211. Berton, M. T., Linehan, L. A., Wick, K. R., and Dunnick, W. A. (2004). NF‐kB elements associated with the Stat6 site in the germline gamma1 immunoglobulin promoter are not necessary for the transcriptional response to CD40 ligand. Int. Immunol. 16, 1741–1749. Betz, A. G., Neuberger, M. S., and Milstein, C. (1993). Discriminating intrinsic and antigen‐ selected mutational hotspots in immunoglobulin V genes. Immunol. Today 14, 405–411. Bhushan, A., and Covey, L. R. (2001). CREB/ATF proteins enhance the basal and CD154‐ and IL‐4‐induced transcriptional activity of the human Ig1 proximal promoter. Eur. J. Immunol. 31, 653–664. Bosma, G. C., Kim, J., Urich, T., Fath, D. M., Cotticelli, M. G., Ruetsch, N. R., Radic, M. Z., and Bosma, M. J. (2002). DNA‐dependent protein kinase activity is not required for immunoglobulin class switching. J. Exp. Med. 196, 1483–1495. Bougeard, G., Charbonnier, F., Moerman, A., Martin, C., Ruchoux, M. M., Drouot, N., and Frebourg, T. (2003). Early onset brain tumor and lymphoma in MSH2‐deficient children. Am. J. Hum. Genet. 72, 213–216. Bransteitter, R., Pham, P., Scharff, M. D., and Goodman, M. F. (2003). Activation‐induced cytidine deaminase deaminates deoxycytidine on single‐stranded DNA but requires the action of RNase. Proc. Natl. Acad. Sci. USA 100, 4102–4107. Briere, F., Servet‐Delprat, C., Bridon, J. M., Saint‐Remy, J. M., and Banchereau, J. (1994). Human interleukin 10 induces naive surface immunoglobulin D þ (sIgDþ) B cells to secrete IgG1 and IgG3. J. Exp. Med. 179, 757–762. Bross, L., Wesoly, J., Buerstedde, J. M., Kanaar, R., and Jacobs, H. (2003). Somatic hypermutation does not require Rad54 and Rad54B‐mediated homologous recombination. Eur. J. Immunol. 33, 352–357. Bru¨ggemann, M. (1988). Evolution of the rat immunoglobulin gamma heavy‐chain gene family. Gene 74, 473–482. Bru¨ggemann, M., Williams, G. T., Bindon, C. I., Clark, M. R., Walker, M. R., Jefferis, R., Waldmann, H., and Neuberger, M. S. (1987). Comparison of the effector functions of human immunoglobulins using a matched set of chimeric antibodies. J. Exp. Med. 166, 1351–1361. Buck, D., Malivert, L., de Chasseval, R., Barraud, A., Fondaneche, M. C., Sanal, O., Plebani, A., Stephan, J. L., Hufnagel, M., le Deist, F., Fischer, A., Durandy, A., et al. (2006). Cernunnos, a novel nonhomologous end‐joining factor, is mutated in human immunodeficiency with microcephaly. Cell 124, 287–299. Casellas, R., Nussenzweig, A., Wuerffel, R., Pelanda, R., Reichlin, A., Suh, H., Qin, X. F., Besmer, E., Kenter, A., Rajewsky, K., and Nussenzweig, M. C. (1998). Ku80 is required for immunoglobulin isotype switching. EMBO J. 17, 2404–2411.
C L A S S S W I T C H R E C O M B I N AT I O N
45
Castigli, E., Alt, F. W., Davidson, L., Bottaro, A., Mizoguchi, E., Bhan, A. K., and Geha, R. S. (1994). CD40‐deficient mice generated by recombination‐activating gene‐2‐deficient blastocyst complementation. Proc. Natl. Acad. Sci. USA 91, 12135–12139. Castigli, E., Wilson, S. A., Garibyan, L., Rachid, R., Bonilla, F., Schneider, L., and Geha, R. S. (2005a). TACI is mutant in common variable immunodeficiency and IgA deficiency. Nat. Genet. 37, 829–834. Castigli, E., Wilson, S. A., Scott, S., Dedeoglu, F., Xu, S., Lam, K. P., Bram, R. J., Jabara, H., and Geha, R. S. (2005b). TACI and BAFF‐R mediate isotype switching in B cells. J. Exp. Med. 201, 35–39. Catalan, N., Selz, F., Imai, K., Revy, P., Fischer, A., and Durandy, A. (2003). The block in immunoglobulin class switch recombination caused by activation‐induced cytidine deaminase deficiency occurs prior to the generation of DNA double strand breaks in switch mu region. J. Immunol. 171, 2504–2509. Chaudhuri, J., and Alt, F. W. (2004). Class‐switch recombination: Interplay of transcription, DNA deamination and DNA repair. Nat. Rev. Immunol. 4, 541–552. Chaudhuri, J., Tian, M., Khuong, C., Chua, K., Pinaud, E., and Alt, F. W. (2003). Transcription‐ targeted DNA deamination by the AID antibody diversification enzyme. Nature 422, 726–730. Chaudhuri, J., Khuong, C., and Alt, F. W. (2004). Replication protein A interacts with AID to promote deamination of somatic hypermutation targets. Nature 430, 992–998. Chauveau, C., and Cogne, M. (1996). Palindromic structure of the IgH 30 locus control region. Nat. Genet. 14, 15–16. Chen, C., and Birshtein, B. K. (1997). Virtually identical enhancers containing a segment of homology to murine 30 IgE‐E(hs1,2) lie downstream of human Ig Ca1 and Ca2 genes. J. Immunol. 159, 1310–1318. Chen, H. T., Bhandoola, A., Difilippantonio, M. J., Zhu, J., Brown, M. J., Tai, X., Rogakou, E. P., Brotz, T. M., Bonner, W. M., Ried, T., and Nussenzweig, A. (2000). Response to RAG‐mediated VDJ cleavage by NBS1 and gamma‐H2AX. Science 290, 1962–1965. Chun, H. H., and Gatti, R. A. (2004). Ataxia‐telangiectasia, an evolving phenotype. DNA Repair (Amst.) 3, 1187–1196. Clatworthy, A. E., Valencia‐Burton, M. A., Haber, J. E., and Oettinger, M. A. (2005). The MRE11‐ RAD50‐XRS2 complex, in addition to other non‐homologous end‐joining factors, is required for V(D)J joining in yeast. J. Biol. Chem. 280, 20247–20252. Cogne, M., Lansford, R., Bottaro, A., Zhang, J., Gorman, J., Young, F., Cheng, H. L., and Alt, F. W. (1994). A class switch control region at the 30 end of the immunoglobulin heavy chain locus. Cell 77, 737–747. Cook, A. J., Oganesian, L., Harumal, P., Basten, A., Brink, R., and Jolly, C. J. (2003). Reduced switching in SCID B cells is associated with altered somatic mutation of recombined S regions. J. Immunol. 171, 6556–6564. Coutelier, J. P., van der Logt, J. T., Heessen, F. W., Warnier, G., and Van Snick, J. (1987). IgG2a restriction of murine antibodies elicited by viral infections. J. Exp. Med. 165, 64–69. Cunningham‐Rundles, C., Radigan, L., Knight, A. K., Zhang, L., Bauer, L., and Nakazawa, A. (2006). TLR9 activation is defective in common variable immune deficiency. J. Immunol. 176, 1978–1987. Dariavach, P., Williams, G. T., Campbell, K., Pettersson, S., and Neuberger, M. S. (1991). The mouse IgH 30 ‐enhancer. Eur. J. Immunol. 21, 1499–1504. Dedeoglu, F., Horwitz, B., Chaudhuri, J., Alt, F. W., and Geha, R. S. (2004). Induction of activation‐induced cytidine deaminase gene expression by IL‐4 and CD40 ligation is dependent on STAT6 and NFkB. Int. Immunol. 16, 395–404. Defrance, T., Vanbervliet, B., Briere, F., Durand, I., Rousset, F., and Banchereau, J. (1992). Interleukin 10 and transforming growth factor beta cooperate to induce anti‐CD40‐activated naive human B cells to secrete immunoglobulin A. J. Exp. Med. 175, 671–682.
46
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
Delbos, F., De Smet, A., Faili, A., Aoufouchi, S., Weill, J. C., and Reynaud, C. A. (2005). Contribution of DNA polymerase eta to immunoglobulin gene hypermutation in the mouse. J. Exp. Med. 201, 1191–1196. Demple, B., Herman, T., and Chen, D. S. (1991). Cloning and expression of APE, the cDNA encoding the major human apurinic endonuclease: Definition of a family of DNA repair enzymes. Proc. Natl. Acad. Sci. USA 88, 11450–11454. Denizot, Y., Pinaud, E., Aupetit, C., Le Morvan, C., Magnoux, E., Aldigier, J. C., and Cogne, M. (2001). Polymorphism of the human a1 immunoglobulin gene 30 enhancer hs1,2 and its relation to gene expression. Immunology 103, 35–40. Di Noia, J. M., Rada, C., and Neuberger, M. S. (2006). SMUG1 is able to excise uracil from immunoglobulin genes: Insight into mutation versus repair. EMBO J. 25, 585–595. Diaz, M., Verkoczy, L. K., Flajnik, M. F., and Klinman, N. R. (2001). Decreased frequency of somatic hypermutation and impaired affinity maturation but intact germinal center formation in mice expressing antisense RNA to DNA polymerase zeta. J. Immunol. 167, 327–335. Dickerson, S. K., Market, E., Besmer, E., and Papavasiliou, F. N. (2003). AID mediates hypermutation by deaminating single stranded DNA. J. Exp. Med. 197, 1291–1296. Difilippantonio, S., Celeste, A., Fernandez‐Capetillo, O., Chen, H. T., Reina San Martin, B., Van Laethem, F., Yang, Y. P., Petukhova, G. V., Eckhaus, M., Feigenbaum, L., Manova, K., Kruhlak, M., et al. (2005). Role of Nbs1 in the activation of the Atm kinase revealed in humanized mouse models. Nat. Cell Biol. 7, 675–685. Digweed, M., and Sperling, K. (2004). Nijmegen breakage syndrome: Clinical manifestation of defective response to DNA double‐strand breaks. DNA Repair (Amst.) 3, 1207–1217. Djurup, R. (1985). The subclass nature and clinical significance of the IgG antibody response in patients undergoing allergen‐specific immunotherapy. Allergy 40, 469–486. Doi, T., Kinoshita, K., Ikegawa, M., Muramatsu, M., and Honjo, T. (2003). De novo protein synthesis is required for the activation‐induced cytidine deaminase function in class‐switch recombination. Proc. Natl. Acad. Sci. USA 100, 2634–2638. Dryer, R. L., and Covey, L. R. (2005). A novel NF‐kappa B‐regulated site within the human Ig1 promoter requires p300 for optimal transcriptional activity. J. Immunol. 175, 4499–4507. Dudley, D. D., Chaudhuri, J., Bassing, C. H., and Alt, F. W. (2005). Mechanism and control of V(D)J recombination versus class switch recombination: Similarities and differences. Adv. Immunol. 86, 43–112. Dumon‐Jones, V., Frappart, P. O., Tong, W. M., Sajithlal, G., Hulla, W., Schmid, G., Herceg, Z., Digweed, M., and Wang, Z. Q. (2003). Nbn heterozygosity renders mice susceptible to tumor formation and ionizing radiation‐induced tumorigenesis. Cancer Res. 63, 7263–7269. Dunnick, W. A., Shi, J., Graves, K. A., and Collins, J. T. (2005). The 30 end of the heavy chain constant region locus enhances germline transcription and switch recombination of the four gamma genes. J. Exp. Med. 201, 1459–1466. Ehlers, M., Fukuyama, H., McGaha, T. L., Aderem, A., and Ravetch, J. V. (2006). TLR9/MyD88 signaling is required for class switching to pathogenic IgG2a and 2b autoantibodies in SLE. J. Exp. Med. 203, 553–561. Ehrenstein, M. R., and Neuberger, M. S. (1999). Deficiency in msh2 affects the efficiency and local sequence specificity of immunoglobulin class‐switch recombination: Parallels with somatic hypermutation. EMBO J. 18, 3484–3490. Ehrenstein, M. R., Rada, C., Jones, A. M., Milstein, C., and Neuberger, M. S. (2001). Switch junction sequences in PMS2‐deficient mice reveal a microhomology‐mediated mechanism of Ig class switch recombination. Proc. Natl. Acad. Sci. USA 98, 14553–14558. Eisenstein, E. M., Chua, K., and Strober, W. (1994). B cell differentiation defects in common variable immunodeficiency are ameliorated after stimulation with anti‐CD40 antibody and IL‐10. J. Immunol. 152, 5957–5968.
C L A S S S W I T C H R E C O M B I N AT I O N
47
Elson, A., Wang, Y., Daugherty, C. J., Morton, C. C., Zhou, F., Campos‐Torres, J., and Leder, P. (1996). Pleiotropic defects in ataxia‐telangiectasia protein‐deficient mice. Proc. Natl. Acad. Sci. USA 93, 13084–13089. Essers, J., Hendriks, R. W., Swagemakers, S. M., Troelstra, C., de Wit, J., Bootsma, D., Hoeijmakers, J. H., and Kanaar, R. (1997). Disruption of mouse RAD54 reduces ionizing radiation resistance and homologous recombination. Cell 89, 195–204. Faili, A., Aoufouchi, S., Flatter, E., Gueranger, Q., Reynaud, C. A., and Weill, J. C. (2002a). Induction of somatic hypermutation in immunoglobulin genes is dependent on DNA polymerase iota. Nature 419, 944–947. Faili, A., Aoufouchi, S., Gueranger, Q., Zober, C., Leon, A., Bertocci, B., Weill, J. C., and Reynaud, C. A. (2002b). AID‐dependent somatic hypermutation occurs as a DNA single‐strand event in the BL2 cell line. Nat. Immunol. 3, 815–821. Faili, A., Aoufouchi, S., Weller, S., Vuillier, F., Stary, A., Sarasin, A., Reynaud, C. A., and Weill, J. C. (2004). DNA polymerase eta is involved in hypermutation occurring during immunoglobulin class switch recombination. J. Exp. Med. 199, 265–270. Ferrari, S., Giliani, S., Insalaco, A., Al‐Ghonaium, A., Soresina, A. R., Loubser, M., Avanzini, M. A., Marconi, M., Badolato, R., Ugazio, A. G., Levy, Y., Catalan, N., et al. (2001). Mutations of CD40 gene cause an autosomal recessive form of immunodeficiency with hyper IgM. Proc. Natl. Acad. Sci. USA 98, 12614–12619. Frank, K. M., Sekiguchi, J. M., Seidl, K. J., Swat, W., Rathbun, G. A., Cheng, H. L., Davidson, L., Kangaloo, L., and Alt, F. W. (1998). Late embryonic lethality and impaired V(D)J recombination in mice lacking DNA ligase IV. Nature 396, 173–177. Frezza, D., Giambra, V., Cianci, R., Fruscalzo, A., Giufre, M., Cammarota, G., Martinez‐Labarga, C., Rickards, O., Scibilia, G., Sferlazzas, C., Bartolozzi, F., Starnino, S., et al. (2004). Increased frequency of the immunoglobulin enhancer HS1,2 allele 2 in coeliac disease. Scand. J. Gastroenterol. 39, 1083–1087. Friman, V., Hanson, L. A., Bridon, J. M., Tarkowski, A., Banchereau, J., and Briere, F. (1996). IL‐ 10‐driven immunoglobulin production by B lymphocytes from IgA‐deficient individuals correlates to infection proneness. Clin. Exp. Immunol. 104, 432–438. Fujieda, S., Zhang, K., and Saxon, A. (1995). IL‐4 plus CD40 monoclonal antibody induces human B cells gamma subclass‐specific isotype switch: Switching to g1, g3, and g4, but not g2. J. Immunol. 155, 2318–2328. Fujieda, S., Saxon, A., and Zhang, K. (1996). Direct evidence that gamma 1 and gamma 3 switching in human B cells is interleukin‐10 dependent. Mol. Immunol. 33, 1335–1343. Gao, Y., Chaudhuri, J., Zhu, C., Davidson, L., Weaver, D. T., and Alt, F. W. (1998a). A targeted DNA‐PKcs‐null mutation reveals DNA‐PK‐independent functions for KU in V(D)J recombination. Immunity 9, 367–376. Gao, Y., Sun, Y., Frank, K. M., Dikkes, P., Fujiwara, Y., Seidl, K. J., Sekiguchi, J. M., Rathbun, G. A., Swat, W., Wang, J., Bronson, R. T., Malynn, B. A., et al. (1998b). A critical role for DNA end‐joining proteins in both lymphogenesis and neurogenesis. Cell 95, 891–902. Gascan, H., Gauchat, J. F., Aversa, G., Van Vlasselaer, P., and de Vries, J. E. (1991). Anti‐CD40 monoclonal antibodies or CD4 þ T cell clones and IL‐4 induce IgG4 and IgE switching in purified human B cells via different signaling pathways. J. Immunol. 147, 8–13. Giambra, V., Fruscalzo, A., Giufre, M., Martinez‐Labarga, C., Favaro, M., Rocchi, M., and Frezza, D. (2005). Evolution of human IgH30 EX duplicated structures: Both enhancers HS1,2 are polymorphic with variation of transcription factor’s consensus sites. Gene 346, 105–114. Gibbs, R. A., Weinstock, G. M., Metzker, M. L., Muzny, D. M., Sodergren, E. J., Scherer, S., Scott, G., Steffen, D., Worley, K. C., Burch, P. E., Okwuonu, G., Hines, S., et al. (2004). Genome sequence of the Brown Norway rat yields insights into mammalian evolution. Nature 428, 493–521.
48
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
Gilfillan, S., Dierich, A., Lemeur, M., Benoist, C., and Mathis, D. (1993). Mice lacking TdT: Mature animals with an immature lymphocyte repertoire. Science 261, 1175–1178. Giovannetti, A., Mazzetta, F., Caprini, E., Aiuti, A., Marziali, M., Pierdominici, M., Cossarizza, A., Chessa, L., Scala, E., Quinti, I., Russo, G., and Fiorilli, M. (2002). Skewed T‐cell receptor repertoire, decreased thymic output, and predominance of terminally differentiated T cells in ataxia telangiectasia. Blood 100, 4082–4089. Gonda, H., Sugai, M., Nambu, Y., Katakai, T., Agata, Y., Mori, K. J., Yokota, Y., and Shimizu, A. (2003). The balance between Pax5 and Id2 activities is the key to AID gene expression. J. Exp. Med. 198, 1427–1437. Grant, P. A., Andersson, T., Neurath, M. F., Arulampalam, V., Bauch, A., Muller, R., Reth, M., and Pettersson, S. (1996). A T cell controlled molecular pathway regulating the IgH locus: CD40‐ mediated activation of the IgH 30 enhancer. EMBO J. 15, 6691–6700. Gregorek, H., Chrzanowska, K. H., Michalkiewicz, J., Syczewska, M., and Madalinski, K. (2002). Heterogeneity of humoral immune abnormalities in children with Nijmegen breakage syndrome: An 8‐year follow‐up study in a single centre. Clin. Exp. Immunol. 130, 319–324. Gritzmacher, C. A., and Liu, F. T. (1987). Conserved organization of the murine immunoglobulin epsilon gene region: Restriction endonuclease maps and switch‐region nucleotide sequence. J. Immunol. 139, 603–607. Gross, J. A., Dillon, S. R., Mudri, S., Johnston, J., Littau, A., Roque, R., Rixon, M., Schou, O., Foley, K. P., Haugen, H., McMillen, S., Waggie, K., et al. (2001). TACI‐Ig neutralizes molecules critical for B cell development and autoimmune disease: Impaired B cell maturation in mice lacking BLyS. Immunity 15, 289–302. Gu, Y., Seidl, K. J., Rathbun, G. A., Zhu, C., Manis, J. P., van der Stoep, N., Davidson, L., Cheng, H. L., Sekiguchi, J. M., Frank, K., Stanhope‐Baker, P., Schlissel, M. S., et al. (1997). Growth retardation and leaky SCID phenotype of Ku70‐deficient mice. Immunity 7, 653–665. Guglielmi, L., Truffinet, V., Magnoux, E., Cogne, M., and Denizot, Y. (2004). The polymorphism of the locus control region lying downstream the human IgH locus is restricted to hs1,2 but not to hs3 and hs4 enhancers. Immunol. Lett. 94, 77–81. Hackman, P., Tannergard, P., Osei‐Mensa, S., Chen, J., Kane, M. F., Kolodner, R., Lambert, B., Hellgren, D., and Lindblom, A. (1997). A human compound heterozygote for two MLH1 missense mutations. Nat. Genet. 17, 135–136. Hadi, M. Z., and Wilson, D. M., III (2000). Second human protein with homology to the Escherichia coli abasic endonuclease exonuclease III. Environ. Mol. Mutagen. 36, 312–324. Hadi, M. Z., Coleman, M. A., Fidelis, K., Mohrenweiser, H. W., and Wilson, D. M., III (2000). Functional characterization of Ape1 variants identified in the human population. Nucleic Acids Res. 28, 3871–3879. Hammarstro¨m, L., Lefranc, G., Lefranc, M. P., Persson, M. A., and Smith, C. I. (1986). Aberrant pattern of anti‐carbohydrate antibodies in immunoglobulin class or subclass‐deficient donors. Monogr. Allergy 20, 50–56. Hanai, J., Chen, L. F., Kanno, T., Ohtani‐Fujita, N., Kim, W. Y., Guo, W. H., Imamura, T., Ishidou, Y., Fukuchi, M., Shi, M. J., Stavnezer, J., Kawabata, M., et al. (1999). Interaction and functional cooperation of PEBP2/CBF with Smads. Synergistic induction of the immunoglobulin germline Calpha promoter. J. Biol. Chem. 274, 31577–31582. Harfst, E., Cooper, S., Neubauer, S., Distel, L., and Grawunder, U. (2000). Normal V(D)J recombination in cells from patients with Nijmegen breakage syndrome. Mol. Immunol. 37, 915–929. Harris, R. S., Sale, J. E., Petersen‐Mahrt, S. K., and Neuberger, M. S. (2002). AID is essential for immunoglobulin V gene conversion in a cultured B cell line. Curr. Biol. 12, 435–438. Hassan, M. S., Islam, K. B., Hammarstro¨m, L., and Smith, C. I. (1992). Regulation of Cg3 expression. Role of switch in the allotype‐associated variation of human serum IgG3 levels. J. Immunol. 148, 2555–2562.
C L A S S S W I T C H R E C O M B I N AT I O N
49
He, B., Qiao, X., and Cerutti, A. (2004). CpG DNA induces IgG class switch DNA recombination by activating human B cells through an innate pathway that requires TLR9 and cooperates with IL‐10. J. Immunol. 173, 4479–4491. Hegde, M. R., Chong, B., Blazo, M. E., Chin, L. H., Ward, P. A., Chintagumpala, M. M., Kim, J. Y., Plon, S. E., and Richards, C. S. (2005). A homozygous mutation in MSH6 causes Turcot syndrome. Clin. Cancer Res. 11, 4689–4693. Honjo, T., Nagaoka, H., Shinkura, R., and Muramatsu, M. (2005). AID to overcome the limitations of genomic information. Nat. Immunol. 6, 655–661. Hsieh, C. L., Arlett, C. F., and Lieber, M. R. (1993). V(D)J recombination in ataxia telangiectasia, Bloom’s syndrome, and a DNA ligase I‐associated immunodeficiency disorder. J. Biol. Chem. 268, 20105–20109. Hu, Y., Pan, Q., Pardali, E., Mills, F. C., Bernstein, R. M., Max, E. E., Sideras, P., and Hammarstro¨m, L. (2000). Regulation of germline promoters by the two human Ig heavy chain 30 a enhancers. J. Immunol. 164, 6380–6386. Ide, Y., Tsuchimoto, D., Tominaga, Y., Iwamoto, Y., and Nakabeppu, Y. (2003). Characterization of the genomic structure and expression of the mouse Apex2 gene. Genomics 81, 47–57. Ide, Y., Tsuchimoto, D., Tominaga, Y., Nakashima, M., Watanabe, T., Sakumi, K., Ohno, M., and Nakabeppu, Y. (2004). Growth retardation and dyslymphopoiesis accompanied by G2/M arrest in APEX2‐null mice. Blood 104, 4097–4103. Imai, K., Slupphaug, G., Lee, W. I., Revy, P., Nonoyama, S., Catalan, N., Yel, L., Forveille, M., Kavli, B., Krokan, H. E., Ochs, H. D., Fischer, A., et al. (2003). Human uracil‐DNA glycosylase deficiency associated with profoundly impaired immunoglobulin class‐switch recombination. Nat. Immunol. 4, 1023–1028. Islam, K. B., Nilsson, L., Sideras, P., Hammarstro¨m, L., and Smith, C. I. (1991). TGF‐beta 1 induces germ‐line transcripts of both IgA subclasses in human B lymphocytes. Int. Immunol. 3, 1099–1106. Islam, K. B., Baskin, B., Nilsson, L., Hammarstro¨m, L., Sideras, P., and Smith, C. I. (1994). Molecular analysis of IgA deficiency. Evidence for impaired switching to IgA. J. Immunol. 152, 1442–1452. Ito, S., Nagaoka, H., Shinkura, R., Begum, N., Muramatsu, M., Nakata, M., and Honjo, T. (2004). Activation‐induced cytidine deaminase shuttles between nucleus and cytoplasm like apolipoprotein B mRNA editing catalytic polypeptide 1. Proc. Natl. Acad. Sci. USA 101, 1975–1980. Iwasato, T., Shimizu, A., Honjo, T., and Yamagishi, H. (1990). Circular DNA is excised by immunoglobulin class switch recombination. Cell 62, 143–149. Jacobs, H., Fukita, Y., van der Horst, G. T., de Boer, J., Weeda, G., Essers, J., de Wind, N., Engelward, B. P., Samson, L., Verbeek, S., de Murcia, J. M., de Murcia, G., et al. (1998). Hypermutation of immunoglobulin genes in memory B cells of DNA repair‐deficient mice. J. Exp. Med. 187, 1735–1743. Jeannin, P., Lecoanet, S., Delneste, Y., Gauchat, J. F., and Bonnefoy, J. Y. (1998). IgE versus IgG4 production can be differentially regulated by IL‐10. J. Immunol. 160, 3555–3561. Jimi, E., and Ghosh, S. (2005). Role of nuclear factor‐kappaB in the immune system and bone. Immunol. Rev. 208, 80–87. Jung, D., and Alt, F. W. (2004). Unraveling V(D)J recombination; insights into gene regulation. Cell 116, 299–311. Kaminski, D. A., and Stavnezer, J. (2004). Antibody class switching: Uncoupling S region accessibility from transcription. Trends Genet. 20, 337–340. Kang, J., Bronson, R. T., and Xu, Y. (2002). Targeted disruption of NBS1 reveals its roles in mouse development and DNA repair. EMBO J. 21, 1447–1455.
50
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
Kawabe, T., Naka, T., Yoshida, K., Tanaka, T., Fujiwara, H., Suematsu, S., Yoshida, N., Kishimoto, T., and Kikutani, H. (1994). The immune responses in CD40‐deficient mice: Impaired immunoglobulin class switching and germinal center formation. Immunity 1, 167–178. Kawano, Y., Noma, T., and Yata, J. (1994). Regulation of human IgG subclass production by cytokines. IFN‐gamma and IL‐6 act antagonistically in the induction of human IgG1 but additively in the induction of IgG2. J. Immunol. 153, 4948–4958. Kett, K., Brandtzaeg, P., Radl, J., and Haaijman, J. J. (1986). Different subclass distribution of IgA‐ producing cells in human lymphoid organs and various secretory tissues. J. Immunol. 136, 3631–3635. Keyeux, G., and Bernal, J. E. (1996). New allele variants of the immunoglobulin switch (Salpha) regions. Hum. Genet. 97, 695–696. Kim, N., Kage, K., Matsuda, F., Lefranc, M. P., and Storb, U. (1997). B lymphocytes of xeroderma pigmentosum or Cockayne syndrome patients with inherited defects in nucleotide excision repair are fully capable of somatic hypermutation of immunoglobulin genes. J. Exp. Med. 186, 413–419. Kim, N., Bozek, G., Lo, J. C., and Storb, U. (1999). Different mismatch repair deficiencies all have the same effects on somatic hypermutation: Intact primary mechanism accompanied by secondary modifications. J. Exp. Med. 190, 21–30. Klinman, D. M. (2004). Immunotherapeutic uses of CpG oligodeoxynucleotides. Nat. Rev. Immunol. 4, 249–258. Komori, T., Okada, A., Stewart, V., and Alt, F. W. (1993). Lack of N regions in antigen receptor variable region genes of TdT‐deficient lymphocytes. Science 261, 1171–1175. Kracker, S., Bergmann, Y., Demuth, I., Frappart, P. O., Hildebrand, G., Christine, R., Wang, Z. Q., Sperling, K., Digweed, M., and Radbruch, A. (2005). Nibrin functions in Ig class‐switch recombination. Proc. Natl. Acad. Sci. USA 102, 1584–1589. Kuze, K., Shimizu, A., and Honjo, T. (1991). Characterization of the enhancer region for germline transcription of the gamma 3 constant region gene of human immunoglobulin. Int. Immunol. 3, 647–655. Lander, E. S., Linton, L. M., Birren, B., Nusbaum, C., Zody, M. C., Baldwin, J., Devon, K., Dewar, K., Doyle, M., FitzHugh, W., Funke, R., Gage, D., et al. (2001). Initial sequencing and analysis of the human genome. Nature 409, 860–921. Larijani, M., Frieder, D., Basit, W., and Martin, A. (2005). The mutation spectrum of purified AID is similar to the mutability index in Ramos cells and in ung(‐/‐) msh2(‐/‐) mice. Immunogenetics 6, 840–845. Larson, E. D., Cummings, W. J., Bednarski, D. W., and Maizels, N. (2005). MRE11/RAD50 cleaves DNA in the AID/UNG‐dependent pathway of immunoglobulin gene diversification. Mol. Cell 20, 367–375. Laurencikiene, J., Deveikaite, V., and Severinson, E. (2001). HS1,2 enhancer regulation of germline e and g2b promoters in murine B lymphocytes: Evidence for specific promoter‐enhancer interactions. J. Immunol. 167, 3257–3265. Lee, G. S., Brandt, V. L., and Roth, D. B. (2004). B cell development leads off with a base hit: dU: dG mismatches in class switching and hypermutation. Mol. Cell 16, 505–508. Levy, J., Espanol‐Boren, T., Thomas, C., Fischer, A., Tovo, P., Bordigoni, P., Resnick, I., Fasth, A., Baer, M., Gomez, L., Sanders, E. A., Tabone, M. D., et al. (1997). Clinical spectrum of X‐linked hyper‐IgM syndrome. J. Pediatr. 131, 47–54. Li, M. J., Peakman, M. C., Golub, E. I., Reddy, G., Ward, D. C., Radding, C. M., and Maizels, N. (1996). Rad51 expression and localization in B cells carrying out class switch recombination. Proc. Natl. Acad. Sci. USA 93, 10222–10227.
C L A S S S W I T C H R E C O M B I N AT I O N
51
Li, Z., Luo, Z., and Scharff, M. D. (2004a). Differential regulation of histone acetylation and generation of mutations in switch regions is associated with Ig class switching. Proc. Natl. Acad. Sci. USA 101, 15428–15433. Li, Z., Woo, C. J., Iglesias‐Ussel, M. D., Ronai, D., and Scharff, M. D. (2004b). The generation of antibody diversity through somatic hypermutation and class switch recombination. Genes Dev. 18, 1–11. Li, Z., Peled, J. U., Zhao, C., Svetlanov, A., Ronai, D., Cohen, P. E., and Scharff, M. D. (2006). A role for Mlh3 in somatic hypermutation. DNA Repair (Amst.) 5, 675–682. Liao, M. J., and van Dyke, T. (1999). Critical role for Atm in suppressing V(D)J recombination‐ driven thymic lymphoma. Genes Dev. 13, 1246–1250. Lieber, M. R., Ma, Y., Pannicke, U., and Schwarz, K. (2004). The mechanism of vertebrate nonhomologous DNA end joining and its role in V(D)J recombination. DNA Repair (Amst.) 3, 817–826. Lin, L., Gerth, A. J., and Peng, S. L. (2004). CpG DNA redirects class‐switching towards ‘‘Th1‐ like’’ Ig isotype production via TLR9 and MyD88. Eur. J. Immunol. 34, 1483–1487. Lin, S. C., and Stavnezer, J. (1996). Activation of NF‐kB/Rel by CD40 engagement induces the mouse germ line immunoglobulin Cgamma1 promoter. Mol. Cell. Biol. 16, 4591–4603. Lin, Y. C., and Stavnezer, J. (1992). Regulation of transcription of the germ‐line Ig a constant region gene by an ATF element and by novel transforming growth factor‐beta 1‐responsive elements. J. Immunol. 149, 2914–2925. Litinskiy, M. B., Nardelli, B., Hilbert, D. M., He, B., Schaffer, A., Casali, P., and Cerutti, A. (2002). DCs induce CD40‐independent immunoglobulin class switching through BLyS and APRIL. Nat. Immunol. 3, 822–829. Liu, N., Ohnishi, N., Ni, L., Akira, S., and Bacon, K. B. (2003). CpG directly induces T‐bet expression and inhibits IgG1 and IgE switching in B cells. Nat. Immunol. 4, 687–693. Liyanage, M., Weaver, Z., Barlow, C., Coleman, A., Pankratz, D. G., Anderson, S., Wynshaw‐Boris, A., and Ried, T. (2000). Abnormal rearrangement within the alpha/delta T‐cell receptor locus in lymphomas from Atm‐deficient mice. Blood 96, 1940–1946. Lopez Granados, E., Porpiglia, A. S., Hogan, M. B., Matamoros, N., Krasovec, S., Pignata, C., Smith, C. I., Hammarstro¨m, L., Bjorkander, J., Belohradsky, B. H., Casariego, G. F., Garcia Rodriguez, M. C., et al. (2002). Clinical and molecular analysis of patients with defects in mu heavy chain gene. J. Clin. Invest. 110, 1029–1035. Lou, Z., Minter‐Dykhouse, K., Franco, S., Gostissa, M., Rivera, M. A., Celeste, A., Manis, J. P., van Deursen, J., Nussenzweig, A., Paull, T. T., Alt, F. W., and Chen, J. (2006). MDC1 maintains genomic stability by participating in the amplification of ATM‐dependent DNA damage signals. Mol. Cell 21, 187–200. Lougaris, V., Badolato, R., Ferrari, S., and Plebani, A. (2005). Hyper immunoglobulin M syndrome due to CD40 deficiency: Clinical, molecular, and immunological features. Immunol. Rev. 203, 48–66. Lumsden, J. M., McCarty, T., Petiniot, L. K., Shen, R., Barlow, C., Wynn, T. A., Morse, H. C., III, Gearhart, P. J., Wynshaw‐Boris, A., Max, E. E., and Hodes, R. J. (2004). Immunoglobulin class switch recombination is impaired in Atm‐deficient mice. J. Exp. Med. 200, 1111–1121. Lundgren, M., Larsson, C., Femino, A., Xu, M., Stavnezer, J., and Severinson, E. (1994). Activation of the Ig germ‐line gamma 1 promoter. Involvement of C/enhancer‐binding protein transcription factors and their possible interaction with an NF‐IL‐4 site. J. Immunol. 153, 2983–2995. La¨hdesma¨ki, A., Taylor, A. M., Chrzanowska, K. H., and Pan‐Hammarstro¨m, Q. (2004). Delineation of the role of the Mre11 complex in class switch recombination. J. Biol. Chem. 279, 16479–16487.
52
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
Ma, Y., Pannicke, U., Schwarz, K., and Lieber, M. R. (2002). Hairpin opening and overhang processing by an Artemis/DNA‐dependent protein kinase complex in nonhomologous end joining and V(D)J recombination. Cell 108, 781–794. Macpherson, A. J., Lamarre, A., McCoy, K., Harriman, G. R., Odermatt, B., Dougan, G., Hengartner, H., and Zinkernagel, R. M. (2001). IgA production without mu or delta chain expression in developing B cells. Nat. Immunol. 2, 625–631. Madisen, L., and Groudine, M. (1994). Identification of a locus control region in the immunoglobulin heavy‐chain locus that deregulates c‐myc expression in plasmacytoma and Burkitt’s lymphoma cells. Genes Dev. 8, 2212–2226. Madsen, O., Scally, M., Douady, C. J., Kao, D. J., DeBry, R. W., Adkins, R., Amrine, H. M., Stanhope, M. J., de Jong, W. W., and Springer, M. S. (2001). Parallel adaptive radiations in two major clades of placental mammals. Nature 409, 610–614. Manis, J. P., Gu, Y., Lansford, R., Sonoda, E., Ferrini, R., Davidson, L., Rajewsky, K., and Alt, F. W. (1998a). Ku70 is required for late B cell development and immunoglobulin heavy chain class switching. J. Exp. Med. 187, 2081–2089. Manis, J. P., van der Stoep, N., Tian, M., Ferrini, R., Davidson, L., Bottaro, A., and Alt, F. W. (1998b). Class switching in B cells lacking 30 immunoglobulin heavy chain enhancers. J. Exp. Med. 188, 1421–1431. Manis, J. P., Morales, J. C., Xia, Z., Kutok, J. L., Alt, F. W., and Carpenter, P. B. (2004). 53BP1 links DNA damage‐response pathways to immunoglobulin heavy chain class‐switch recombination. Nat. Immunol. 5, 481–487. Martin, A., Bardwell, P. D., Woo, C. J., Fan, M., Shulman, M. J., and Scharff, M. D. (2002). Activation‐ induced cytidine deaminase turns on somatic hypermutation in hybridomas. Nature 415, 802–806. Martomo, S. A., Yang, W. W., and Gearhart, P. J. (2004). A role for msh6 but not msh3 in somatic hypermutation and class switch recombination. J. Exp. Med. 200, 61–68. Martomo, S. A., Yang, W. W., Vaisman, A., Maas, A., Yokoi, M., Hoeijmakers, J. H., Hanaoka, F., Woodgate, R., and Gearhart, P. J. (2006). Normal hypermutation in antibody genes from congenic mice defective for DNA polymerase iota. DNA Repair (Amst.) 5, 392–398. Maser, R. S., Zinkel, R., and Petrini, J. H. (2001). An alternative mode of translation permits production of a variant NBS1 protein from the common Nijmegen breakage syndrome allele. Nat. Genet. 27, 417–421. Masuda, K., Ouchida, R., Takeuchi, A., Saito, T., Koseki, H., Kawamura, K., Tagawa, M., Tokuhisa, T., Azuma, T., and O‐Wang, J. (2005). DNA polymerase theta contributes to the generation of C/G mutations during somatic hypermutation of Ig genes. Proc. Natl. Acad. Sci. USA 102, 13986–13991. Matsuoka, M., Yoshida, K., Maeda, T., Usuda, S., and Sakano, H. (1990). Switch circular DNA formed in cytokine‐treated mouse splenocytes: Evidence for intramolecular DNA deletion in immunoglobulin class switching. Cell 62, 135–142. McDonald, J. P., Frank, E. G., Plosky, B. S., Rogozin, I. B., Masutani, C., Hanaoka, F., Woodgate, R., and Gearhart, P. J. (2003). 129‐derived strains of mice are deficient in DNA polymerase iota and have normal immunoglobulin hypermutation. J. Exp. Med. 198, 635–643. Mills, F. C., Brooker, J. S., and Camerini‐Otero, R. D. (1990). Sequences of human immunoglobulin switch regions: Implications for recombination and transcription. Nucleic Acids Res. 18, 7305–7316. Mills, F. C., Mitchell, M. P., Harindranath, N., and Max, E. E. (1995). Human Ig S gamma regions and their participation in sequential switching to IgE. J. Immunol. 155, 3021–3036. Mills, F. C., Harindranath, N., Mitchell, M., and Max, E. E. (1997). Enhancer complexes located downstream of both human immunoglobulin Ca genes. J. Exp. Med. 186, 845–858. Milstein, C., Neuberger, M. S., and Staden, R. (1998). Both DNA strands of antibody genes are hypermutation targets. Proc. Natl. Acad. Sci. USA 95, 8791–8794.
C L A S S S W I T C H R E C O M B I N AT I O N
53
Mita, Y., Dobashi, K., Endou, K., Kawata, T., Shimizu, Y., Nakazawa, T., and Mori, M. (2002). Toll‐like receptor 4 surface expression on human monocytes and B cells is modulated by IL‐2 and IL‐4. Immunol. Lett. 81, 71–75. Morell, A., Skvaril, F., Hitzig, W. H., and Barandun, S. (1972a). IgG subclasses: Development of the serum concentrations in ‘‘normal’’ infants and children. J. Pediatr. 80, 960–964. Morell, A., Skvaril, F., Steinberg, A. G., Van Loghem, E., and Terry, W. D. (1972b). Correlations between the concentrations of the four sub‐classes of IgG and Gm Allotypes in normal human sera. J. Immunol. 108, 195–206. Moshous, D., Callebaut, I., de Chasseval, R., Corneo, B., Cavazzana‐Calvo, M., Le Deist, F., Tezcan, I., Sanal, O., Bertrand, Y., Philippe, N., Fischer, A., and de Villartay, J. P. (2001). Artemis, a novel DNA double‐strand break repair/V(D)J recombination protein, is mutated in human severe combined immune deficiency. Cell 105, 177–186. Mowatt, M. R., and Dunnick, W. A. (1986). DNA sequence of the murine gamma 1 switch segment reveals novel structural elements. J. Immunol. 136, 2674–2683. Muramatsu, M., Sankaranand, V. S., Anant, S., Sugai, M., Kinoshita, K., Davidson, N. O., and Honjo, T. (1999). Specific expression of activation‐induced cytidine deaminase (AID), a novel member of the RNA‐editing deaminase family in germinal center B cells. J. Biol. Chem. 274, 18470–18476. Muramatsu, M., Kinoshita, K., Fagarasan, S., Yamada, S., Shinkai, Y., and Honjo, T. (2000). Class switch recombination and hypermutation require activation‐induced cytidine deaminase (AID), a potential RNA editing enzyme. Cell 102, 553–563. Murphy, W. J., Eizirik, E., Johnson, W. E., Zhang, Y. P., Ryder, O. A., and O’Brien, S. J. (2001). Molecular phylogenetics and the origins of placental mammals. Nature 409, 614–618. Mussmann, R., Courtet, M., Schwager, J., and Du Pasquier, L. (1997). Microsites for immunoglobulin switch recombination breakpoints from Xenopus to mammals. Eur. J. Immunol. 27, 2610–2619. Muto, T., Okazaki, I. M., Yamada, S., Tanaka, Y., Kinoshita, K., Muramatsu, M., Nagaoka, H., and Honjo, T. (2006). Negative regulation of activation‐induced cytidine deaminase in B cells. Proc. Natl. Acad. Sci. USA 103, 2752–2757. Nambu, Y., Sugai, M., Gonda, H., Lee, C. G., Katakai, T., Agata, Y., Yokota, Y., and Shimizu, A. (2003). Transcription‐coupled events associating with immunoglobulin switch region chromatin. Science 302, 2137–2140. Neuberger, M. S., Di Noia, J. M., Beale, R. C., Williams, G. T., Yang, Z., and Rada, C. (2005). Somatic hypermutation at A.T pairs: Polymerase error versus dUTP incorporation. Nat. Rev. Immunol. 5, 171–178. Nick McElhinny, S. A., Havener, J. M., Garcia‐Diaz, M., Juarez, R., Bebenek, K., Kee, B. L., Blanco, L., Kunkel, T. A., and Ramsden, D. A. (2005). A gradient of template dependence defines distinct biological roles for family X polymerases in nonhomologous end joining. Mol. Cell 19, 357–366. Nikaido, T., Nakai, S., and Honjo, T. (1981). Switch region of immunoglobulin Cmu gene is composed of simple tandem repetitive sequences. Nature 292, 845–848. Nikaido, T., Yamawaki‐Kataoka, Y., and Honjo, T. (1982). Nucleotide sequences of switch regions of immunoglobulin Ce and C g genes and their comparison. J. Biol. Chem. 257, 7322–7329. Nilsson, L., and Sideras, P. (1993). The human Ia1 and Ia2 germline promoter elements: Proximal positive and distal negative elements may regulate the tissue specific expression of Ca1 and Ca2 germline transcripts. Int. Immunol. 5, 271–282. Nilsson, L., Islam, K. B., Olafsson, O., Zalcberg, I., Samakovlis, C., Hammarstro¨m, L., Smith, C. I., and Sideras, P. (1991). Structure of TGF‐beta 1‐induced human immunoglobulin Ca1 and Ca2 germ‐line transcripts. Int. Immunol. 3, 1107–1115.
54
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
Nilsson, L., Grant, P., Larsson, I., Pettersson, S., and Sideras, P. (1995). The human I alpha 1 region contains a TGF‐beta 1 responsive enhancer and a putative recombination hotspot. Int. Immunol. 7, 1191–1204. Nonoyama, S., Farrington, M., Ishida, H., Howard, M., and Ochs, H. D. (1993). Activated B cells from patients with common variable immunodeficiency proliferate and synthesize immunoglobulin. J. Clin. Invest. 92, 1282–1287. Nussenzweig, A., Chen, C., da Costa Soares, V., Sanchez, M., Sokol, K., Nussenzweig, M. C., and Li, G. C. (1996). Requirement for Ku80 in growth and immunoglobulin V(D)J recombination. Nature 382, 551–555. Okazaki, I. M., Kinoshita, K., Muramatsu, M., Yoshikawa, K., and Honjo, T. (2002). The AID enzyme induces class switch recombination in fibroblasts. Nature 416, 340–345. Omori, S. A., Cato, M. H., Anzelon‐Mills, A., Puri, K. D., Shapiro‐Shelef, M., Calame, K., and Rickert, R. C. (2006). Regulation of class‐switch recombination and plasma cell differentiation by phosphatidylinositol 3‐kinase signaling. Immunity 25, 545–557. Ong, J., Stevens, S., Roeder, R. G., and Eckhardt, L. A. (1998). 30 IgH enhancer elements shift synergistic interactions during B cell development. J. Immunol. 160, 4896–4903. Oxelius, V. A. (1979). IgG subclass levels in infancy and childhood. Acta Paediatr. Scand. 68, 23–27. Pan, Q., and Hammarstro¨m, L. (1999). Targeting of human switch recombination breakpoints: Implications for the mechanism of m‐g isotype switching. Eur. J. Immunol. 29, 2779–2787. Pan, Q., Lindersson, Y., Sideras, P., and Hammarstro¨m, L. (1997a). Structural analysis of human gamma 3 intervening regions and switch regions: Implication for the low frequency of switching in IgG3‐deficient patients. Eur. J. Immunol. 27, 2920–2926. Pan, Q., Rabbani, H., Mills, F. C., Severinson, E., and Hammarstro¨m, L. (1997b). Allotype‐ associated variation in the human g3 switch region as a basis for differences in IgG3 production. J. Immunol. 158, 5849–5859. Pan, Q., Rabbani, H., and Hammarstro¨m, L. (1998). Characterization of human g4 switch region polymorphisms suggests a meiotic recombinational hot spot within the Ig locus: Influence of S region length on IgG4 production. J. Immunol. 161, 3520–3526. Pan, Q., Petit‐Frere, C., Stavnezer, J., and Hammarstro¨m, L. (2000). Regulation of the promoter for human immunoglobulin g3 germ‐line transcription and its interaction with the 30 a enhancer. Eur. J. Immunol. 30, 1019–1029. Pan, Q., Petit‐Frere, C., Dai, S., Huang, P., Morton, H. C., Brandtzaeg, P., and Hammarstro¨m, L. (2001). Regulation of switching and production of IgA in human B cells in donors with duplicated alpha1 genes. Eur. J. Immunol. 31, 3622–3630. Pan, Q., Matamoros, N., Bjorkander, J., Conley, M. E., and Hammarstro¨m, L. (2002a). Lack of IgA in Cm‐deficient patients. Nat. Immunol. 3, 595. Pan, Q., Petit‐Frere, C., La¨hdesma¨ki, A., Gregorek, H., Chrzanowska, K. H., and Hammarstro¨m, L. (2002b). Alternative end joining during switch recombination in patients with ataxia‐ telangiectasia. Eur. J. Immunol. 32, 1300–1308. Pan‐Hammarstro¨m, Q., Dai, S., Zhao, Y., van Dijk‐Ha¨rd, I. F., Gatti, R. A., Børresen‐Dale, A. L., and Hammarstro¨m, L. (2003). ATM is not required in somatic hypermutation of VH, but is involved in the introduction of mutations in the switch m region. J. Immunol. 170, 3707–3716. Pan‐Hammarstro¨m, Q., Zhao, Y., and Hammarstro¨m, L. (2004). Lack of association between human switch recombination breakpoints and the secondary structure of targeted DNA regions. J. Immunol. 172, 2727. Pan‐Hammarstro¨m, Q., Jones, A. M., La¨hdesma¨ki, A., Zhou, W., Gatti, R. A., Hammarstro¨m, L., Gennery, A. R., and Ehrenstein, M. R. (2005). Impact of DNA ligase IV on nonhomologous
C L A S S S W I T C H R E C O M B I N AT I O N
55
end joining pathways during class switch recombination in human cells. J. Exp. Med. 201, 189–194. Pan‐Hammarstro¨m, Q., La¨hdesma¨ki, A., Zhao, Y., Du, L., Zhao, Z., Wen, S., Ruiz‐Perez, V. L., Dunn‐Walters, D. K., Goodship, J. A., and Hammarstro¨m, L. (2006). Disparate roles of ATR and ATM in immunoglobulin class switch recombination and somatic hypermutation. J. Exp. Med. 203, 99–110. Pardali, E., Xie, X. Q., Tsapogas, P., Itoh, S., Arvanitidis, K., Heldin, C. H., ten Dijke, P., Grundstro¨m, T., and Sideras, P. (2000). Smad and AML proteins synergistically confer transforming growth factor beta1 responsiveness to human germ‐line IgA genes. J. Biol. Chem. 275, 3552–3560. Pasqualucci, L., Kitaura, Y., Gu, H., and Dalla‐Favera, R. (2006). PKA‐mediated phosphorylation regulates the function of activation‐induced deaminase (AID) in B cells. Proc. Natl. Acad. Sci. USA 103, 395–400. Peng, S. L. (2005). Signaling in B cells via Toll‐like receptors. Curr. Opin. Immunol. 17, 230–236. Perelmutter, L. (1984). IgG4: Non‐IgE mediated atopic disease. Ann. Allergy 52, 64–69. Perkins, E. J., Nair, A., Cowley, D. O., van Dyke, T., Chang, Y., and Ramsden, D. A. (2002). Sensing of intermediates in V(D)J recombination by ATM. Genes Dev. 16, 159–164. Petersen, S., Casellas, R., Reina‐San‐Martin, B., Chen, H. T., Difilippantonio, M. J., Wilson, P. C., Hanitsch, L., Celeste, A., Muramatsu, M., Pilch, D. R., Redon, C., Ried, T., et al. (2001). AID is required to initiate Nbs1/g‐H2AX focus formation and mutations at sites of class switching. Nature 414, 660–665. Peterson, R. D. A., Blaw, M., and Good, R. A. (1963). Ataxia‐telangiectasia: A possible clinical counterpart of the animals rendered immunologically incompetent by thymectomy. J. Pediatr. 63, 701–703. Petiniot, L. K., Weaver, Z., Barlow, C., Shen, R., Eckhaus, M., Steinberg, S. M., Ried, T., Wynshaw‐Boris, A., and Hodes, R. J. (2000). Recombinase‐activating gene (RAG) 2‐mediated V(D)J recombination is not essential for tumorigenesis in Atm‐deficient mice. Proc. Natl. Acad. Sci. USA 97, 6664–6669. Petiniot, L. K., Weaver, Z., Vacchio, M., Shen, R., Wangsa, D., Barlow, C., Eckhaus, M., Steinberg, S. M., Wynshaw‐Boris, A., Ried, T., and Hodes, R. J. (2002). RAG‐mediated V(D)J recombination is not essential for tumorigenesis in Atm‐deficient mice. Mol. Cell. Biol. 22, 3174–3177. Pettersson, S., Cook, G. P., Bruggemann, M., Williams, G. T., and Neuberger, M. S. (1990). A second B cell‐specific enhancer 30 of the immunoglobulin heavy‐chain locus. Nature 344, 165–168. Pham, P., Bransteitter, R., Petruska, J., and Goodman, M. F. (2003). Processive AID‐catalysed cytosine deamination on single‐stranded DNA simulates somatic hypermutation. Nature 424, 103–107. Phung, Q. H., Winter, D. B., Cranston, A., Tarone, R. E., Bohr, V. A., Fishel, R., and Gearhart, P. J. (1998). Increased hypermutation at G and C nucleotides in immunoglobulin variable genes from mice deficient in the MSH2 mismatch repair protein. J. Exp. Med. 187, 1745–1751. Pinaud, E., Aupetit, C., Chauveau, C., and Cogne, M. (1997). Identification of a homolog of the Ca 30 /hs3 enhancer and of an allelic variant of the 30 IgE/hs1,2 enhancer downstream of the human immunoglobulin alpha 1 gene. Eur. J. Immunol. 27, 2981–2985. Pinaud, E., Khamlichi, A. A., Le Morvan, C., Drouet, M., Nalesso, V., Le Bert, M., and Cogne, M. (2001). Localization of the 30 IgH locus elements that effect long‐distance regulation of class switch recombination. Immunity 15, 187–199. Rabbani, H., Pan, Q., Kondo, N., Smith, C. I., and Hammarstro¨m, L. (1996). Duplications and deletions of the human IGHC locus: Evolutionary implications. Immunogenetics 45, 136–141.
56
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
Rada, C., Williams, G. T., Nilsen, H., Barnes, D. E., Lindahl, T., and Neuberger, M. S. (2002). Immunoglobulin isotype switching is inhibited and somatic hypermutation perturbed in UNG‐ deficient mice. Curr. Biol. 12, 1748–1755. Rada, C., Di Noia, J. M., and Neuberger, M. S. (2004). Mismatch recognition and uracil excision provide complementary paths to both Ig switching and the A/T‐focused phase of somatic mutation. Mol. Cell 16, 163–171. Ramiro, A. R., Stavropoulos, P., Jankovic, M., and Nussenzweig, M. C. (2003). Transcription enhances AID‐mediated cytidine deamination by exposing single‐stranded DNA on the nontemplate strand. Nat. Immunol. 4, 452–456. Regueiro, J. R., Porras, O., Lavin, M., and Gatti, R. A. (2000). Ataxia‐telangiectasia: A primary immunodeficiency revisited. Immunol. Allergy Clin. North Am. 20, 177–205. Reina‐San‐Martin, B., Difilippantonio, S., Hanitsch, L., Masilamani, R. F., Nussenzweig, A., and Nussenzweig, M. C. (2003). H2AX is required for recombination between immunoglobulin switch regions but not for intra‐switch region recombination or somatic hypermutation. J. Exp. Med. 197, 1767–1778. Reina‐San‐Martin, B., Chen, H. T., Nussenzweig, A., and Nussenzweig, M. C. (2004). ATM is required for efficient recombination between immunoglobulin switch regions. J. Exp. Med. 200, 1103–1110. Reina‐San‐Martin, B., Nussenzweig, M. C., Nussenzweig, A., and Difilippantonio, S. (2005). Genomic instability, endoreduplication, and diminished Ig class‐switch recombination in B cells lacking Nbs1. Proc. Natl. Acad. Sci. USA 102, 1590–1595. Renshaw, B. R., Fanslow, W. C., Armitage, R. J., Campbell, K. A., Liggitt, D., Wright, B., Davison, B. L., and Maliszewski, C. R. (1994). Humoral immune responses in CD40 ligand‐deficient mice. J. Exp. Med. 180, 1889–1900. Revy, P., Muto, T., Levy, Y., Geissmann, F., Plebani, A., Sanal, O., Catalan, N., Forveille, M., Dufourcq‐Labelouse, R., Gennery, A., Tezcan, I., Ersoy, F., et al. (2000). Activation‐induced cytidine deaminase (AID) deficiency causes the autosomal recessive form of the Hyper‐IgM syndrome (HIGM2). Cell 102, 565–575. Riballo, E., Kuhne, M., Rief, N., Doherty, A., Smith, G. C., Recio, M. J., Reis, C., Dahm, K., Fricke, A., Krempler, A., Parker, A. R., Jackson, S. P., et al. (2004). A pathway of double‐strand break rejoining dependent upon ATM, Artemis, and proteins locating to g‐H2AX foci. Mol. Cell 16, 715–724. Ricciardone, M. D., Ozcelik, T., Cevher, B., Ozdag, H., Tuncer, M., Gurgey, A., Uzunalimoglu, O., Cetinkaya, H., Tanyeli, A., Erken, E., and Ozturk, M. (1999). Human MLH1 deficiency predisposes to hematological malignancy and neurofibromatosis type 1. Cancer Res. 59, 290–293. Robson, C. N., and Hickson, I. D. (1991). Isolation of cDNA clones encoding a human apurinic/ apyrimidinic endonuclease that corrects DNA repair and mutagenesis defects in E. coli xth (exonuclease III) mutants. Nucleic Acids Res. 19, 5519–5523. Rolink, A., Melchers, F., and Andersson, J. (1996). The SCID but not the RAG‐2 gene product is required for Sm‐Se heavy chain class switching. Immunity 5, 319–330. Rooney, S., Alt, F. W., Lombard, D., Whitlow, S., Eckersdorff, M., Fleming, J., Fugmann, S., Ferguson, D. O., Schatz, D. G., and Sekiguchi, J. (2003). Defective DNA repair and increased genomic instability in Artemis‐deficient murine cells. J. Exp. Med. 197, 553–565. Rooney, S., Alt, F. W., Sekiguchi, J., and Manis, J. P. (2005). Artemis‐independent functions of DNA‐dependent protein kinase in Ig heavy chain class switch recombination and development. Proc. Natl. Acad. Sci. USA 102, 2471–2475.
C L A S S S W I T C H R E C O M B I N AT I O N
57
Ruiz, J. F., Lucas, D., Garcia‐Palomero, E., Saez, A. I., Gonzalez, M. A., Piris, M. A., Bernad, A., and Blanco, L. (2004). Overexpression of human DNA polymerase mu (Pol m) in a Burkitt’s lymphoma cell line affects the somatic hypermutation rate. Nucleic Acids Res. 32, 5861–5873. Saleque, S., Singh, M., Little, R. D., Giannini, S. L., Michaelson, J. S., and Birshtein, B. K. (1997). Dyad symmetry within the mouse 30 IgH regulatory region includes two virtually identical enhancers (Ca30 E and hs3). J. Immunol. 158, 4780–4787. Salzer, U., Chapel, H. M., Webster, A. D., Pan‐Hammarstro¨m, Q., Schmitt‐Graeff, A., Schlesier, M., Peter, H. H., Rockstroh, J. K., Schneider, P., Schaffer, A. A., Hammarstro¨m, L., and Grimbacher, B. (2005). Mutations in TNFRSF13B encoding TACI are associated with common variable immunodeficiency in humans. Nat. Genet. 37, 820–828. Sayegh, C. E., Quong, M. W., Agata, Y., and Murre, C. (2003). E‐proteins directly regulate expression of activation‐induced deaminase in mature B cells. Nat. Immunol. 4, 586–593. Scappino, L. A., Chu, C., and Gritzmacher, C. A. (1991). Extended nucleotide sequence of the switch region of the murine gene encoding immunoglobulin E. Gene 99, 295–296. Schaffer, A., Cerutti, A., Shah, S., Zan, H., and Casali, P. (1999). The evolutionarily conserved sequence upstream of the human Ig heavy chain Sg3 region is an inducible promoter: Synergistic activation by CD40 ligand and IL‐4 via cooperative NF‐kB and STAT‐6 binding sites. J. Immunol. 162, 5327–5336. Schatz, D. G. (2004). V(D)J recombination. Immunol. Rev. 200, 5–11. Schneider, P. (2005). The role of APRIL and BAFF in lymphocyte activation. Curr. Opin. Immunol. 17, 282–289. Schrader, C. E., Edelmann, W., Kucherlapati, R., and Stavnezer, J. (1999). Reduced isotype switching in splenic B cells from mice deficient in mismatch repair enzymes. J. Exp. Med. 190, 323–330. Schrader, C. E., Vardo, J., and Stavnezer, J. (2002). Role for mismatch repair proteins Msh2, Mlh1, and Pms2 in immunoglobulin class switching shown by sequence analysis of recombination junctions. J. Exp. Med. 195, 367–373. Schrader, C. E., Vardo, J., Linehan, E., Twarog, M. Z., Niedernhofer, L. J., Hoeijmakers, J. H., and Stavnezer, J. (2004). Deletion of the nucleotide excision repair gene Ercc1 reduces immunoglobulin class switching and alters mutations near switch recombination junctions. J. Exp. Med. 200, 321–330. Schrader, C. E., Linehan, E. K., Mochegova, S. N., Woodland, R. T., and Stavnezer, J. (2005). Inducible DNA breaks in Ig S regions are dependent on AID and UNG. J. Exp. Med. 202, 561–568. Seidl, K. J., Manis, J. P., Bottaro, A., Zhang, J., Davidson, L., Kisselgof, A., Oettgen, H., and Alt, F. W. (1999). Position‐dependent inhibition of class‐switch recombination by PGK‐neor cassettes inserted into the immunoglobulin heavy chain constant region locus. Proc. Natl. Acad. Sci. USA 96, 3000–3005. Seki, M., Gearhart, P. J., and Wood, R. D. (2005). DNA polymerases and somatic hypermutation of immunoglobulin genes. EMBO Rep. 6, 1143–1148. Sepulveda, M. A., Emelyanov, A. V., and Birshtein, B. K. (2004). NF‐kB and Oct‐2 synergize to activate the human 30 Igh hs4 enhancer in B cells. J. Immunol. 172, 1054–1064. Sepulveda, M. A., Garrett, F. E., Price‐Whelan, A., and Birshtein, B. K. (2005). Comparative analysis of human and mouse 30 Igh regulatory regions identifies distinctive structural features. Mol. Immunol. 42, 605–615. Seshasayee, D., Valdez, P., Yan, M., Dixit, V. M., Tumas, D., and Grewal, I. S. (2003). Loss of TACI causes fatal lymphoproliferation and autoimmunity, establishing TACI as an inhibitory BLyS receptor. Immunity 18, 279–288.
58
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
Shi, M. J., and Stavnezer, J. (1998). CBF a3 (AML2) is induced by TGF‐b1 to bind and activate the mouse germline Ig a promoter. J. Immunol. 161, 6751–6760. Shiloh, Y. (2001). ATM and ATR: Networking cellular responses to DNA damage. Curr. Opin. Genet. Dev. 11, 71–77. Shimizu, A., Takahashi, N., Yaoita, Y., and Honjo, T. (1982). Organization of the constant‐region gene family of the mouse immunoglobulin heavy chain. Cell 28, 499–506. Shimizu, T., Shinkai, Y., Ogi, T., Ohmori, H., and Azuma, T. (2003). The absence of DNA polymerase kappa does not affect somatic hypermutation of the mouse immunoglobulin heavy chain gene. Immunol. Lett. 86, 265–270. Shimizu, T., Azuma, T., Ishiguro, M., Kanjo, N., Yamada, S., and Ohmori, H. (2005). Normal immunoglobulin gene somatic hypermutation in Pol kappa‐Pol iota double‐deficient mice. Immunol. Lett. 98, 259–264. Shockett, P., and Stavnezer, J. (1991). Effect of cytokines on switching to IgA and alpha germline transcripts in the B lymphoma I.29 mu. Transforming growth factor‐beta activates transcription of the unrearranged C alpha gene. J. Immunol. 147, 4374–4383. Sideras, P., Mizuta, T. R., Kanamori, H., Suzuki, N., Okamoto, M., Kuze, K., Ohno, H., Doi, S., Fukuhara, S., and Hassan, M. S. (1989). Production of sterile transcripts of Cg genes in an IgM‐ producing human neoplastic B cell line that switches to IgG‐producing cells. Int. Immunol. 1, 631–642. Snapper, C. M., Kehry, M. R., Castle, B. E., and Mond, J. J. (1995). Multivalent, but not divalent, antigen receptor cross‐linkers synergize with CD40 ligand for induction of Ig synthesis and class switching in normal murine B cells. A redefinition of the TI‐2 vs T cell‐dependent antigen dichotomy. J. Immunol. 154, 1177–1187. Stavnezer, J. (1996). Antibody class switching. Adv. Immunol. 61, 79–146. Stavnezer, J. (2000). Molecular processes that regulate class switching. Curr. Top. Microbiol. Immunol. 245, 127–168. Stavnezer, J., and Schrader, C. E. (2005). Mismatch repair converts AID‐instigated nicks to double‐strand breaks for antibody class‐switch recombination. Trends Genet. 22, 23–28. Stavnezer‐Nordgren, J., and Sirlin, S. (1986). Specificity of immunoglobulin heavy chain switch correlates with activity of germline heavy chain genes prior to switching. EMBO J. 5, 95–102. Sun, Z. J., and Kitchingman, G. R. (1991). Sequencing of selected regions of the human immunoglobulin heavy‐chain gene locus that completes the sequence from JH through the delta constant region. DNA Seq. 1, 347–355. Szurek, P., Petrini, J., and Dunnick, W. (1985). Complete nucleotide sequence of the murine g3 switch region and analysis of switch recombination sites in two gamma 3‐expressing hybridomas. J. Immunol. 135, 620–626. Taccioli, G. E., Amatucci, A. G., Beamish, H. J., Gell, D., Xiang, X. H., Torres Arzayus, M. I., Priestley, A., Jackson, S. P., Marshak Rothstein, A., Jeggo, P. A., and Herrera, V. L. (1998). Targeted disruption of the catalytic subunit of the DNA‐PK gene in mice confers severe combined immunodeficiency and radiosensitivity. Immunity 9, 355–366. Taylor, A. M., Metcalfe, J. A., Thick, J., and Mak, Y. F. (1996). Leukemia and lymphoma in ataxia telangiectasia. Blood 87, 423–438. Tian, M., Shinkura, R., Shinkura, N., and Alt, F. W. (2004). Growth retardation, early death, and DNA repair defects in mice deficient for the nucleotide excision repair enzyme XPF. Mol. Cell. Biol. 24, 1200–1205. Tibbetts, R. S., Brumbaugh, K. M., Williams, J. M., Sarkaria, J. N., Cliby, W. A., Shieh, S. Y., Taya, Y., Prives, C., and Abraham, R. T. (1999). A role for ATR in the DNA damage‐induced phosphorylation of p53. Genes. Dev. 13, 152–157. Turner, M. W., Bennich, H. H., and Natvig, J. B. (1970). Simple method of subtyping human G‐myeloma proteins based on sensitivity to pepsin digestion. Nature 225, 853–855.
C L A S S S W I T C H R E C O M B I N AT I O N
59
van der Burgt, I., Chrzanowska, K. H., Smeets, D., and Weemaes, C. (1996). Nijmegen breakage syndrome. J. Med. Genet. 33, 153–156. Varon, R., Vissinga, C., Platzer, M., Cerosaletti, K. M., Chrzanowska, K. H., Saar, K., Beckmann, G., Seemanova, E., Cooper, P. R., Nowak, N. J., Stumm, M., Weemaes, C. M., et al. (1998). Nibrin, a novel DNA double‐strand break repair protein, is mutated in Nijmegen breakage syndrome. Cell 93, 467–476. Venter, J. C., Adams, M. D., Myers, E. W., Li, P. W., Mural, R. J., Sutton, G. G., Smith, H. O., Yandell, M., Evans, C. A., Holt, R. A., Gocayne, J. D., Amanatides, P., et al. (2001). The sequence of the human genome. Science 291, 1304–1351. Vilkki, S., Tsao, J. L., Loukola, A., Poyhonen, M., Vierimaa, O., Herva, R., Aaltonen, L. A., and Shibata, D. (2001). Extensive somatic microsatellite mutations in normal human tissue. Cancer Res. 61, 4541–4544. von Bulow, G. U., van Deursen, J. M., and Bram, R. J. (2001). Regulation of the T‐independent humoral response by TACI. Immunity 14, 573–582. von Schwedler, U., Jack, H. M., and Wabl, M. (1990). Circular DNA is a product of the immunoglobulin class switch rearrangement. Nature 345, 452–456. Wagner, S. D., Elvin, J. G., Norris, P., McGregor, J. M., and Neuberger, M. S. (1996). Somatic hypermutation of Ig genes in patients with xeroderma pigmentosum (XP‐D). Int. Immunol. 8, 701–705. Wang, L., Whang, N., Wuerffel, R., and Kenter, A. L. (2006). AID‐dependent histone acetylation is detected in immunoglobulin S regions. J. Exp. Med. 203, 215–226. Ward, I. M., Reina‐San‐Martin, B., Olaru, A., Minn, K., Tamada, K., Lau, J. S., Cascalho, M., Chen, L., Nussenzweig, A., Livak, F., Nussenzweig, M. C., and Chen, J. (2004). 53BP1 is required for class switch recombination. J. Cell. Biol. 165, 459–464. Warren, W. D., Roberts, K. L., Linehan, L. A., and Berton, M. T. (1999). Regulation of the germline immunoglobulin Cg1 promoter by CD40 ligand and IL‐4: Dual role for tandem NF‐kB binding sites. Mol. Immunol. 36, 31–44. Waterston, R. H., Lindblad‐Toh, K., Birney, E., Rogers, J., Abril, J. F., Agarwal, P., Agarwala, R., Ainscough, R., Alexandersson, M., An, P., Antonarakis, S. E., Attwood, J., et al. (2002). Initial sequencing and comparative analysis of the mouse genome. Nature 420, 520–562. Wei, K., Kucherlapati, R., and Edelmann, W. (2002). Mouse models for human DNA mismatch‐ repair gene defects. Trends Mol. Med. 8, 346–353. Weller, S., Faili, A., Garcia, C., Braun, M. C., Le Deist, F. F., de Saint Basile, G. G., Hermine, O., Fischer, A., Reynaud, C. A., and Weill, J. C. (2001). CD40‐CD40L independent Ig gene hypermutation suggests a second B cell diversification pathway in humans. Proc. Natl. Acad. Sci. USA 98, 1166–1170. Whiteside, D., McLeod, R., Graham, G., Steckley, J. L., Booth, K., Somerville, M. J., and Andrew, S. E. (2002). A homozygous germ‐line mutation in the human MSH2 gene predisposes to hematological malignancy and multiple cafe‐au‐lait spots. Cancer Res. 62, 359–362. Wiesendanger, M., Kneitz, B., Edelmann, W., and Scharff, M. D. (2000). Somatic hypermutation in MutS homologue (MSH)3‐, MSH6‐, and MSH3/MSH6‐deficient mice reveals a role for the MSH2‐ MSH6 heterodimer in modulating the base substitution pattern. J. Exp. Med. 191, 579–584. Williams, B. R., Mirzoeva, O. K., Morgan, W. F., Lin, J., Dunnick, W., and Petrini, J. H. (2002). A murine model of Nijmegen breakage syndrome. Curr. Biol. 12, 648–653. Winter, A. G., Samuel, K., Hsia, K. T., and Melton, D. W. (2003a). The repair and recombination enzyme ERCC1 is not required for immunoglobulin class switching. DNA Repair (Amst.) 2, 561–569. Winter, D. B., Phung, Q. H., Zeng, X., Seeberg, E., Barnes, D. E., Lindahl, T., and Gearhart, P. J. (2003b). Normal somatic hypermutation of Ig genes in the absence of 8‐hydroxyguanine‐DNA glycosylase. J. Immunol. 170, 5558–5562.
60
¨ M ET AL. Q I A N G PA N ‐ H A M M A R S T R O
Wuerffel, R., Jamieson, C. E., Morgan, L., Merkulov, G. V., Sen, R., and Kenter, A. L. (1992). Switch recombination breakpoints are strictly correlated with DNA recognition motifs for immunoglobulin Sg3 DNA‐binding proteins. J. Exp. Med. 176, 339–349. Wuerffel, R. A., Du, J., Thompson, R. J., and Kenter, A. L. (1997). Ig Sg3 DNA‐specifc double strand breaks are induced in mitogen‐activated B cells and are implicated in switch recombination. J. Immunol. 159, 4139–4144. Xanthoudakis, S., and Curran, T. (1992). Identification and characterization of Ref‐1, a nuclear protein that facilitates AP‐1 DNA‐binding activity. EMBO J. 11, 653–665. Xanthoudakis, S., Smeyne, R. J., Wallace, J. D., and Curran, T. (1996). The redox/DNA repair protein, Ref‐1, is essential for early embryonic development in mice. Proc. Natl. Acad. Sci. USA 93, 8919–8923. Xiao, Y., and Weaver, D. T. (1997). Conditional gene targeted deletion by Cre recombinase demonstrates the requirement for the double‐strand break repair Mre11 protein in murine embryonic stem cells. Nucleic Acids Res. 25, 2985–2991. Xie, X. Q., Pardali, E., Holm, M., Sideras, P., and Grundstrom, T. (1999). AML and Ets proteins regulate the I alpha1 germ‐line promoter. Eur. J. Immunol. 29, 488–498. Xu, J., Foy, T. M., Laman, J. D., Elliott, E. A., Dunn, J. J., Waldschmidt, T. J., Elsemore, J., Noelle, R. J., and Flavell, R. A. (1994). Mice deficient for the CD40 ligand. Immunity 1, 423–431. Xu, Y., Ashley, T., Brainerd, E. E., Bronson, R. T., Meyn, M. S., and Baltimore, D. (1996). Targeted disruption of ATM leads to growth retardation, chromosomal fragmentation during meiosis, immune defects, and thymic lymphoma. Genes Dev. 10, 2411–2422. Xue, K., Rada, C., and Neuberger, M. S. (2006). The in vivo pattern of AID targeting to immunoglobulin switch regions deduced from mutation spectra in msh2/‐ ung‐/‐ mice. J. Exp. Med. 203, 2085–2094. Yabuki, M., Fujii, M. M., and Maizels, N. (2005). The MRE11‐RAD50‐NBS1 complex accelerates somatic hypermutation and gene conversion of immunoglobulin variable regions. Nat. Immunol. 6, 730–736. Yadav, A., Olaru, A., Saltis, M., Setren, A., Cerny, J., and Livak, F. (2006). Identification of a ubiquitously active promoter of the murine activation‐induced cytidine deaminase (AICDA) gene. Mol. Immunol. 43, 529–541. Yan, M., Wang, H., Chan, B., Roose‐Girma, M., Erickson, S., Baker, T., Tumas, D., Grewal, I. S., and Dixit, V. M. (2001). Activation and accumulation of B cells in TACI‐deficient mice. Nat. Immunol. 2, 638–643. Yancopoulos, G. D., DePinho, R. A., Zimmerman, K. A., Lutzker, S. G., Rosenberg, N., and Alt, F. W. (1986). Secondary genomic rearrangement events in pre‐B cells: VHDJH replacement by a LINE‐1 sequence and directed class switching. EMBO J. 5, 3259–3266. Yavuz, S., Yavuz, A. S., Kraemer, K. H., and Lipsky, P. E. (2002). The role of polymerase eta in somatic hypermutation determined by analysis of mutations in a patient with xeroderma pigmentosum variant. J. Immunol. 169, 3825–3830. Yel, L., Minegishi, Y., Coustan‐Smith, E., Buckley, R. H., Trubel, H., Pachman, L. M., Kitchingman, G. R., Campana, D., Rohrer, J., and Conley, M. E. (1996). Mutations in the mu heavy‐chain gene in patients with agammaglobulinemia. N. Engl. J. Med. 335, 1486–1493. Yeo, T. C., Xia, D., Hassouneh, S., Yang, X. O., Sabath, D. E., Sperling, K., Gatti, R. A., Concannon, P., and Willerford, D. M. (2000). V(D)J rearrangement in Nijmegen breakage syndrome. Mol. Immunol. 37, 1131–1139. Yoshikawa, K., Okazaki, I. M., Eto, T., Kinoshita, K., Muramatsu, M., Nagaoka, H., and Honjo, T. (2002). AID enzyme‐induced hypermutation in an actively transcribed gene in fibroblasts. Science 296, 2033–2036.
C L A S S S W I T C H R E C O M B I N AT I O N
61
Yoshimoto, T., Okada, K., Morishima, N., Kamiya, S., Owaki, T., Asakawa, M., Iwakura, Y., Fukai, F., and Mizuguchi, J. (2004). Induction of IgG2a class switching in B cells by IL‐27. J. Immunol. 173, 2479–2485. Yu, K., Chedin, F., Hsieh, C. L., Wilson, T. E., and Lieber, M. R. (2003). R‐loops at immunoglobulin class switch regions in the chromosomes of stimulated B cells. Nat. Immunol. 4, 442–451. Yu, K., Huang, F. T., and Lieber, M. R. (2004). DNA substrate length and surrounding sequence affect the activation‐induced deaminase activity at cytidine. J. Biol. Chem. 279, 6496–6500. Zan, H., Komori, A., Li, Z., Cerutti, A., Schaffer, A., Flajnik, M. F., Diaz, M., and Casali, P. (2001). The translesion DNA polymerase zeta plays a major role in Ig and bcl‐6 somatic hypermutation. Immunity 14, 643–653. Zan, H., Wu, X., Komori, A., Holloman, W. K., and Casali, P. (2003). AID‐dependent generation of resected double‐strand DNA breaks and recruitment of Rad52/Rad51 in somatic hypermutation. Immunity 18, 727–738. Zan, H., Shima, N., Xu, Z., Al‐Qahtani, A., Evinger Iii, A. J., Zhong, Y., Schimenti, J. C., and Casali, P. (2005). The translesion DNA polymerase theta plays a dominant role in immunoglobulin gene somatic hypermutation. EMBO J. 24, 3757–3769. Zarrin, A. A., Tian, M., Wang, J., Borjeson, T., and Alt, F. W. (2005). Influence of switch region length on immunoglobulin class switch recombination. Proc. Natl. Acad. Sci. USA 102, 2466–2470. Zelazowski, P., Shen, Y., and Snapper, C. M. (2000). NF‐kB/p50 and NF‐kB/c‐Rel differentially regulate the activity of the 30 aE‐hsl,2 enhancer in normal murine B cells in an activation‐ dependent manner. Int. Immunol. 12, 1167–1172. Zeng, X., Winter, D. B., Kasmer, C., Kraemer, K. H., Lehmann, A. R., and Gearhart, P. J. (2001). DNA polymerase Z is an A‐T mutator in somatic hypermutation of immunoglobulin variable genes. Nat. Immunol. 2, 537–541. Zeng, X., Negrete, G. A., Kasmer, C., Yang, W. W., and Gearhart, P. J. (2004). Absence of DNA polymerase Z reveals targeting of C mutations on the nontranscribed strand in immunoglobulin switch regions. J. Exp. Med. 199, 917–924. Zhang, L., Duan, C. J., Binkley, C., Li, G., Uhler, M. D., Logsdon, C. D., and Simeone, D. M. (2004a). A transforming growth factor beta‐induced Smad3/Smad4 complex directly activates protein kinase A. Mol. Cell. Biol. 24, 2169–2180. Zhang, X., Succi, J., Feng, Z., Prithivirajsingh, S., Story, M. D., and Legerski, R. J. (2004b). Artemis is a phosphorylation target of ATM and ATR and is involved in the G2/M DNA damage checkpoint response. Mol. Cell. Biol. 24, 9207–9220. Zhao, Y., Pan‐Hammarstro¨m, Q., Zhao, Z., and Hammarstro¨m, L. (2005). Identification of the activation‐induced cytidine deaminase gene from zebrafish: An evolutionary analysis. Dev. Comp. Immunol. 29, 61–71. Zhong, H., SuYang, H., Erdjument‐Bromage, H., Tempst, P., and Ghosh, S. (1997). The transcriptional activity of NF‐kappaB is regulated by the IkappaB‐associated PKAc subunit through a cyclic AMP‐independent mechanism. Cell 89, 413–424. Zhou, C., Saxon, A., and Zhang, K. (2003). Human activation‐induced cytidine deaminase is induced by IL‐4 and negatively regulated by CD45: Implication of CD45 as a Janus kinase phosphatase in antibody diversification. J. Immunol. 170, 1887–1893. Zhu, C., Bogue, M. A., Lim, D. S., Hasty, P., and Roth, D. B. (1996). Ku86‐deficient mice exhibit severe combined immunodeficiency and defective processing of V(D)J recombination intermediates. Cell 86, 379–389. Zhu, J., Petersen, S., Tessarollo, L., and Nussenzweig, A. (2001). Targeted disruption of the Nijmegen breakage syndrome gene NBS1 leads to early embryonic lethality in mice. Curr. Biol. 11, 105–109.
Anti‐IgE Antibodies for the Treatment of IgE‐Mediated Allergic Diseases Tse Wen Chang,* Pheidias C. Wu,*,† C. Long Hsu,*,† and Alfur F. Hung*,† *Genomics Research Center, Academia Sinica, Nankang, Taipei 115, Taiwan Department of Life Science, National Tsing Hua University, Hsinchu 300, Taiwan
†
1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15.
Abstract ........................................................................................................... Introduction ..................................................................................................... Rationale Leading to the Invention of the Anti‐IgE Concept ..................................... Anti‐IgE Is Approved for Treating Moderate‐to‐Severe Asthma.................................. Studies on Other Allergic Diseases........................................................................ The Potential of Using Anti‐IgE to Assist Allergen‐Based Immunotherapy ................... Pivotal Roles of IgE and FceRI in Type I Hypersensitivity ........................................ Neutralization of Free IgE .................................................................................. Downregulation of FceRI.................................................................................... Potential Beneficial Effects of IgE:Anti‐IgE Immune Complexes................................ Can Anti‐IgE Modulate IgE‐Committed B Lymphoblasts and Memory B Cell?............. Other Immunoregulatory Effects of Anti‐IgE.......................................................... Can Anti‐IgE Attain a Long‐Term Remission State? ................................................. Are There Adverse Effects Associated with Anti‐IgE Therapy?................................... Other Approaches for Targeting IgE or IgE‐Expressing B Cells ................................. Concluding Remarks .......................................................................................... References .......................................................................................................
63 64 67 73 78 83 85 88 90 93 96 98 100 101 103 106 107
Abstract The pharmacological purposes of the anti‐IgE therapy are to neutralize IgE and to inhibit its production to attenuate type I hypersensitivity reactions. The therapy is based on humanized IgG1antibodies that bind to free IgE and to membrane‐ bound IgE on B cells, but not to IgE bound by the high‐affinity IgE.Fc receptors on basophils and mast cells or by the low‐affinity IgE.Fc receptors on B cells. After nearly 20 years since inception, therapeutic anti‐IgE antibodies (anti‐IgE) have been studied in about 30 Phase II and III clinical trials in many allergy indications, and a lead antibody, omalizumab, has been approved for treating patients (12 years and older) with moderate‐to‐severe allergic asthma. Anti‐IgE has confirmed the roles of IgE in the pathogenesis of asthma and helped define the concept ‘‘allergic asthma’’ in clinical practice. It has been shown to be safe and efficacious in treating pediatric allergic asthma and treating allergic rhinitis and is being investigated for treating peanut allergy, atopic dermatitis, latex allergy, and others. It has potential for use to combine with specific and rush immunotherapy for increased safety and efficacy. Anti‐IgE thus appears to provide a prophylactic and therapeutic option for moderate to severe cases of many allergic diseases and
63 advances in immunology, vol. 93 # 2007 Elsevier Inc. All rights reserved.
0065-2776/07 $35.00 DOI: 10.1016/S0065-2776(06)93002-8
64
TSE WEN CHANG ET AL.
conditions in which IgE plays a significant role. This chapter reviews the evolution of the anti‐IgE concept and the clinical studies of anti‐IgE on various disease indications, and presents a comprehensive analysis on the multiple intricate immunoregulatory pharmacological effects of anti‐IgE. Finally, it reviews other approaches that target IgE or IgE‐expressing B cells. 1. Introduction 1.1. The Current Status of the Anti‐IgE Development A therapeutic anti‐IgE antibody is a monoclonal antibody (MAb) designed to target IgE and IgE‐expressing B cells without the complication of its cross‐ linking IgE bound by the high‐affinity IgE.Fc receptors (also called type I IgE. Fc receptors, FceRI) on basophils and mast cells. Such an antibody is distinctively different from a common anti‐IgE antibody, which can bind to and cross‐ link IgE‐FceRI and hence sensitize the effector cells bearing them to discharge various pharmacological mediators. In this chapter, a therapeutic anti‐IgE antibody designed above is referred to as ‘‘anti‐IgE,’’ as has been used routinely in the allergy and asthma fields. Historically, research on IgE has arrived at an interesting juncture. IgE was discovered in 1967 by Johansson (Johansson, 1967) and Ishizakas (Ishizaka and Ishizaka, 1967), and 20 years later in early 1987, the anti‐IgE concept was invented by one of the authors (Chang) of this chapter. In 2007, it will be 20 years since the anti‐IgE concept was proposed and research on developing the first antibody prototype initiated (Chang et al., 1990). Today, various immunoassys relating to IgE are now essential tools in the care of allergic diseases, and the initial application of the anti‐IgE therapy for treating moderate‐to‐severe allergic asthma has been approved by health agencies in many countries—it has been used to treat more than 60,000 patients with difficult‐to‐treat allergic asthma. The diagram in Fig. 1 summarizes the main events in developing the anti‐IgE program. Initially, CGP51901 (a chimeric anti‐IgE derived from mouse MAb TESC‐21; Davis et al., 1993), which was studied in a Phase I and II clinical trial (Corne et al., 1997; Racine‐Poon et al., 1997), and CGP56901 (or TNX‐901, a humanized anti‐IgE based on TESC‐21; Kolbinger et al., 1993) were developed in one corporate program. Later, omalizumab (a humanized anti‐IgE, also referred to as E25) emerged in another corporate program (Presta et al., 1993). In 1996, the two programs were combined and omalizumab was chosen for further development on the basis of its superior manufacturing process. TNX‐901, which was shown to be safe and efficacious in a Phase II trial on allergic rhinitis (using CGP51901) and in a Phase II trial on peanut allergy (Leung et al., 2003), should serve as a backup drug candidate.
THERAPEUTIC ANTI-IgE ANTIBODIES
65
Phase II trial Invention 1987
Phase I trial 1990 1991 1993 1994
Chimeric MAb CGP51901
First phase III trial
Humanized MAb TNX-901
USA approval for asthma
Australia approval for asthma
Tanox/Novartis
EU approval for asthma
1996 1999
2002 2003 2005 2006
Omalizumab >30 phase II, III trials on asthma, allergic rhinitis, latex allergy, and so on Genentech Humanized MAb omalizumab
60,000 asthmatic patients treated TNX-901 Phase II trial on peanut allergy
Figure 1 The major events in the development of the anti‐IgE therapeutic approach.
Among the key events in the clinical development of the anti‐IgE concept are that omalizumab was approved by the United States in 2003 and by the European Union in 2005 for use in treating patients with moderate‐to‐severe allergic asthma. Omalizumab has now been studied in nearly 30 Phase II and III human trials in various allergic diseases and conditions (Sections 3–5). 1.2. The Main Chemical Features of the Anti‐IgE Therapeutic For most clinicians treating allergic diseases, omalizumab would appear as a very different drug among the battery of drugs for treating allergic diseases. An anti‐ IgE is a protein, a macromolecular (150,000 Da) biological substance; it is a humanized IgG (g1,k) antibody or a recombinant antibody, which has been substantially improved by genetic engineering methodologies for in vivo use in human patients. In overall structure, chemical and physical properties (such as kinetic properties), and ability to mediate a wide spectrum of Fc‐related immune mechanisms, a recombinant, humanized anti‐IgE IgG1 is similar to an authentic human IgG1. Only the three short complementarity‐determining regions (CDRs) in the VH domain and the three CDRs in the Vk domain from the parental mouse antibody are retained; nearly the entire four framework segments in each of the VH and the Vk are derived from sequence‐matched human VH and Vk; the entire CH1, CH2, and CH3 domains of the heavy chain are from human g1 and the Ck
66
TSE WEN CHANG ET AL.
domain of the light chain is from human k (Kolbinger et al., 1993; Presta et al., 1993). A striking feature of omalizumab and TNX‐901 is that, like a human IgG1, they circulate in the treated patients with a half‐life of about 21 days. Omalizumab is presently provided by the manufacturers in a dry powder formulation, which requires the reconstitution with water to resume a solution form for subcutaneous injection (Strunk and Bloomberg, 2006). Other formulations such as a solution in prefilled syringes for easier administration are under development. Unlike other small molecular compounds synthesized in organic chemical plants, omalizumab is produced by a host Chinese hamster ovary (CHO) cell line in 12,000‐ or 15,000‐liter bioreactor tanks. CHO cell line has become a standard for producing protein pharmaceuticals for human applications (Wurm, 2004). In our case, the CHO cell line was engineered by transfecting with the recombinant ‘‘humanized’’ genes coding the improved g1 and k chains. The CHO cells express the exogenously introduced antibody genes and produce the humanized antibody in very high yields. 1.3. IgE‐Mediated Allergy Is a Vast Medical Field IgE is well known for its roles in mediating type I hypersensitivity reaction (Gould et al., 2003; Janeway et al., 2005). Through the work of many researchers in the last few decades and the clinical studies of anti‐IgE more recently, IgE is now known to play important roles in many allergic diseases. Allergic diseases are generally defined as significant pathological changes that are caused by excessive reactions of the immune system to innocuous substances which the patients are exposed to. While allergic reactions to some substances involves nearly entirely type II, III, or IV hypersensitivity reactions (Janeway et al., 2005), most allergic reactions to inhaled or ingested protein substances involves at least partly type I hypersensitivity reaction and IgE (Oettgen and Geha, 1999). The main allergic diseases or conditions that involve IgE by some extent include allergic asthma (Menz et al., 1998; Oettgen and Geha, 2001), allergic rhinitis (Bodtger et al., 2006; Tschopp et al., 1998) and conjunctivitis (Mimura et al., 2004), allergic or anaphylactic reactions to certain foods (such as peanuts, tree nuts, shell fish, and so on; Sabra et al., 2003), allergic reactions to certain drugs (such as protamin and heparin; Sicherer and Leung, 2005; Weiss et al., 1989), allergic reactions to insect bites (especially wasp and fire ant stings; King and Spangfort, 2000; Schafer and Przybilla, 1996), atopic dermatitis (Leung, 1993), allergic reactions to natural rubber latex (Ebo and Stevens, 2002), allergic reactions to certain raw materials (such as papain, subtilisin, yeasts, and so on) (Baur, 1979; Lemiere et al., 1996) or products in factories (Bernstein, 1997), and allergic reactions to other less common harmless substances.
THERAPEUTIC ANTI-IgE ANTIBODIES
67
Many of the allergic diseases mentioned above affect ever‐increasing population in most regions of the world (Isolauri et al., 2004). The prevalence is related to economical development (Section 7.1) (Gold and Wright, 2005) and in developed countries the aggregate rates of cases of allergic diseases that are serious enough to seek doctors’ help are more than 10% generally and maybe 2030% in some regions. These diseases affect the health and the quality of life (sleep, school, work, family, and so on) of millions of patients and consume large amounts of healthcare resources. 1.4. The Scope of This Chapter An earlier review (Chang, 2000) by the lead author of this chapter presented an overview of the rationale and pharmacological basis of the anti‐IgE therapy. Since then, a lot of progress relating to anti‐IgE has been made. A large number of review articles have been published on anti‐IgE, especially reviews summarizing the clinical trials on allergic asthma and discussing the utility of this treatment modality in managing asthma (Busse, 2001; Holgate et al., 2005a; Lanier et al., 2003; Milgrom, 2004; Strunk and Bloomberg, 2006). In this chapter, we will focus on aspects of the anti‐IgE concept and development, which have been largely left out by most previous anti‐IgE reviews. We will discuss the rationale behind the anti‐IgE invention, the clinical development of anti‐IgE on various disease indications, and present a comprehensive analysis on the multiple intricate immunoregulatory pharmacological effects of anti‐IgE. We will also discuss the development of other approaches that target IgE and IgE‐expressing B cells. 2. Rationale Leading to the Invention of the Anti‐IgE Concept 2.1. IgE Isotype‐Specific Control and IgE Targeting The idea of isotype‐specific suppression of antibodies had already been pursued academically (Bich‐Thuy et al., 1984; Hoover and Lynch, 1983) by researchers before the anti‐IgE approach was conceptualized. In the field of IgE suppression, a group led by Haba and Nisonoff investigated the potential of inducing intolerance to IgE in mice by administering IgE within a few days after birth when the mice did not produce any IgE. This could suppress the production of IgE even when the mice grew to adulthood. After the anti‐IgE concept became known, Haba’s group identified syngeneic anti‐IgE antibodies in the mice that had been injected with IgE at a neonatal age. They also found that IgE‐secreting B cells in these mice were substantially reduced (Haba and Nisonoff, 1990, 1994). Among the antibody isotypes, substantial suppression would not seem logical except perhaps for IgE. While there is a general belief that IgE plays a role
68
TSE WEN CHANG ET AL.
in the defense against parasitic worms, especially helminthes (Capron and Capron, 1994), the results from many studies could best be grossly characterized as suggestive, but not conclusive (Pritchard, 1993; to be discussed in more detail in Section 13.1). Up until 1980s and even until now, most of the research done on IgE since its discovery in 1967 had been related to the adverse effects of IgE on allergic diseases. The activity of mast cells and basophils in inflammatory processes associated with allergenic responses (Lewis and Austen, 1981; Wasserman, 1989) and the roles of IgE in sensitizing those inflammatory cells had become established (Metzger et al., 1982; Razin et al., 1983). Thus, therapeutic approaches that could decrease the production of IgE would seem to be very logical. The concentrations of IgE in most patients with allergy are minute, ranging from less than 30–1000 international units (IU) per milliliter (1 IU ¼ 2.4 ng), which corresponds to a total amount of 12 mg or less in the entire body (calculated based on a total volume of 5 liters of body fluid in a person), for more than 90% of the patients (Manz et al., 2005). The B cells, which express mIgE as part of the B cell receptor and can potentially differentiate to IgE‐ producing plasma cells, also account for minute proportions among lymphocytes (Kasaian et al., 1995). Thus, it appears that IgE and mIgE‐expressing B cells are very attractive therapeutic targets. A few years before setting foot on the anti‐IgE program, the lead author (Chang) of this chapter, had been carrying out research on the OKT3 antibody, a mouse MAb against a human T cell surface component, in another corporation. Chang et al. (1981) proposed that the antigen recognized by OKT3 is part of then yet unidentified T cell receptor linking to a signal‐transducing process. In the next few years, the a/b and d/g chains of the T cell receptors were discovered and OKT3 antigen, which was later renamed as CD3 in an International Leukocyte Association, was found to be indeed part of the T cell receptor. While Chang’s interest on OKT3 was mainly academic, to his amazement, the antibody was developed by the corporation as an immunosuppressive agent and approved by the US Food and Drug Administration (FDA) in 1986 for use in preventing organ rejection in kidney transplantation (Weimar et al., 1988). OKT3 is the first approved therapeutic antibody. It acts on the T cell receptor and causes T cell depletion. In the spring allergy season in 1987, Chang, being affected by severe allergic rhinitis himself, drew from the experience on OKT3 and designed the anti‐IgE approach. 2.2. The Unique Set of Anti‐IgE‐Binding Specificities On the basis of the rationale in the Section 2.1, free IgE in the blood and in interstitial fluid and mIgE‐expressing B cells, which include mIgE‐committed B lymphoblasts and memory B cells, are very attractive therapeutic targets by
THERAPEUTIC ANTI-IgE ANTIBODIES
69
specific immunological agents. On the surface of mIgE‐expressing B cells, a specific cell surface marker that is unique for those B cells and that is reachable by an immunological agent had not been identified, except perhaps mIgE itself. mIgE is part of the B cell receptor, which is linked via associated subunits to signal‐transducing pathways (DeFranco, 1993; Niiro and Clark, 2002), on B cells expressing mIgE. This makes mIgE a viable immunological site to target for modulating mIgE‐expressing B cells. Thus, an antibody could potentially be designed to target free IgE in the body fluid and mIgE on B cells simultaneously, because the relatively small amounts of soluble, free IgE should not consume or neutralize a potential targeting antibody prohibitively. The trick in designing an antibody to target IgE and mIgE was that the antibody must not bind to IgE that is already bound by FceRI. It had been known that antibodies made against IgE could sensitize basophils and mast cells and, in fact, several laboratories had used these antibodies to study the mechanisms of activation of those effector cells (Conroy et al., 1977; Ishizaka et al., 1984). By applying hybridoma methodology and a series of screening procedures, hybridoma clones secreting MAbs with the set of desired specificities were identified. Figure 2 summarizes the binding specificities of anti‐IgE found at the time of its discovery and in later studies. The selected MAbs have high binding affinity to human IgE (Kd about 1 10–10 M), for they are designed to compete with the high‐affinity IgE receptor, FceRI, for binding to IgE (Corne et al., 1997; Davis et al., 1993). The MAbs have no crossbinding activities toward other serum substances and other cell types. They were examined for crossbinding activities to various histological tissue sections, which represented all tissues in the human body, and found to be free of such activities. 2.3. Structural Basis of the Unique Binding Specificities The mouse antihuman IgE MAbs with the required set of binding specificities were obtained before the 3D structures of IgE, its high‐affinity receptor, FceRI, and low‐affinity receptor, FceRII, had been solved. The bent conformation of IgE and of the 1:1 binding stoichiometry between the a chain of FceRI and IgE were elucidated by various approaches (Keown et al., 1997; Zheng et al., 1991). The X‐ray structures of the FceRI a chain, free (PDB entry 1f2q, 2.4 A˚; Garman et al., 1998) and complexed with human IgE CH3–CH4 domains (PDB entry 1f6a, 3.5 A˚; Garman et al., 2000), have provided a structural basis for understanding the binding properties of the anti‐IgE MAbs (see below). The structure of FceRII, also known as CD23, and the characteristics of its binding to IgE have also been elucidated in detail (Hibbert et al., 2005; Wurzburg et al., 2006).
70
TSE WEN CHANG ET AL.
lgE
lgE: anti-lgE complexes
In blood, interstitial fluid
In blood, interstitial fluid
t1/2 ~ 1−2 days
t1/2 ~ 2−3 weeks
IgE on FceRI
Anti-lgE A humanized lgG1,k t1/2 ~ 21days
X On mast cells, basophils
lgE on CD23 X
On B cells
X lgE on sol. CD23 In blood, interstitial fluid
mIgE On B lymphoblasts, memory B cells Figure 2 The unique set of binding specificities an anti‐IgE antibody. The half‐lives of IgE, anti‐IgE, and the immune‐complexes of IgE and anti‐IgE are also indicated.
It is now clear that both omalizumab and TNX‐901 IgG1 antibodies, the FceRI a chain, and CD23 bind to the CH3 domain of IgE. They affect the binding of each other, suggesting that their binding sites on IgE either overlap or are probably in proximity to one another. The binding of IgE by anti‐IgE will prevent IgE from binding to FceRI and to CD23 on B cells. Conversely, the binding of IgE by FceRI will prevent anti‐IgE from binding to IgE. The binding of IgE by CD23 will also block anti‐IgE binding to IgE. At first glance, such an explanation seems straight forward, based on a simple understanding that the binding of IgE by one molecule will sterically hinder the access by another. In other words, the binding of IgE by one entity masks the binding site for another. This would be perfectly rationale, had there been only one CH3 domain in one IgE molecule. However, there are two CH3 domains (two e chains) in one IgE molecule. The Fc (CH2–CH3–CH4 region) of IgE exists in a bent conformation, with the CH2 lobes bending toward one side by a large angle against the two CH3 lobes and hanging not distant from the CH4 lobes (Wan et al., 2002). The two trunks of CH2–CH3–CH4 domains do not have an axis of twofold symmetry between them. The two CH3 domains have a pseudo dyad axis between them;
THERAPEUTIC ANTI-IgE ANTIBODIES
71
the two CH4 domains also have one; the two dyad axes are offset by 3 . The two CH2 domains are linked to their respective CH3 domains by linker segments that are part of CH3 and lay crossed. Looking down from atop, the two CH2 domains and two CH3 domains are like a bent letter ‘‘X.’’ The fact that one IgE molecule can be bound by two anti‐IgE molecules may explain why anti‐IgE blocks IgE binding to CD23 or FceRI. The membrane‐bound form of CD23 exists on the cell surface as a trimer, each of which extends a C‐type lectin‐like ‘‘head’’ domain through a long ‘‘stalk’’ and a ‘‘neck’’ structure (Hibbert et al., 2005). The head domain binds to the outer side of a CH3 domain of IgE in a Ca2þ‐dependent, nonlectin‐like manner (independent of carbohydrates). A single head domain of CD23 binds to IgE with very low affinity (Kd ¼ 10–5 M) and hence two of the heads must bind to two CH3 domains to hold the IgE in place (Kd ¼ 10–8 M). Thus, the binding by CD23 precludes anti‐IgE to bind to IgE simultaneously. Figure 3 shows that the two CH3 domains and two CH4 domains form a rhombic shape with a large opening in the center. The a chain of FceRI binds to both CH3 domains (indicated by shaded parts), which is uncommon in receptor–ligand interaction. The wide opening of the two CH3 lobes allows the a chain to bind to the inner sides of the CH3 domains. Even more strikingly, the two sites on the CH3 domains bound by the a chain of FceRI, with one larger than the other, share 4‐amino acid residues between their respective CH3 peptide chains. The binding by a chain of FceRI causes significant conformational change pushing apart the two CH3 domains and enlarging the opening between them (compare Fig. 3A and C, also D and E). It is not yet solved where on the dimeric CH3 domains the two anti‐IgE molecules bind to. Presumably, they are near the binding site for the a chain of FceRI such that binding by the a chain of FceRI would hinder both anti‐IgE molecules to bind to. However, the fact that CH2 domains bend to and hang over closely one side of the CH3 domains would suggest that the binding sites for anti‐IgE should not be near the inner sides of the CH3 lobes (because two anti‐IgE molecules can bind to one IgE molecule). A crystal structure of CH3 and the Fv of anti‐IgE would be of great interest. 2.4. Prevailing Concepts at the Time of the Invention At the present time, the prospects of anti‐IgE as a treatment option for many allergic diseases look promising. However, leaders in the field of allergy and immunology were largely skeptical about the approach in the early years of the program. In the realm of pharmaceutical development in the late 1980s, the thrust was to identify, by a combination of compound screening and organic synthesis, small molecules (as opposed to protein drugs) that could block
72
TSE WEN CHANG ET AL.
A
Ce 3 A
Ce3 B
Ce 4 A
Ce 4 B
B
C
D
E
Figure 3 The binding site of the a chain of FceRI on CH3 domains. (A) The two CH3 lobes and two CH4 lobes form a rhombic shape with an opening in the center; the binding site for a chain is on the inner sides of both CH3 lobes, near the junctions with CH2 lobes. (B) The ‘‘frontal’’ view of CH3 domains before a chain binding. (C) The frontal view of CH3 domains after a chain binding. (D) The ‘‘top’’ view of CH3 domains before a chain binding. (E) The top view of CH3 domains after a chain binding. The structures show that the binding by a chain causes the opening of the two CH3 lobes wider. The binding sites for FceRII (CD23) and potential binding sites for anti‐IgE are discussed in the text.
THERAPEUTIC ANTI-IgE ANTIBODIES
73
targeted biological processes. In the field of allergy, most of the pharmaceutical research was to develop drugs that could be used to block leukotrienes, tryptase, or other inflammatory mediators (Barnes, 2004). Researchers had also started to screen compound libraries for drug leads that can bind to the a chain of FceRI and block its binding by IgE. The notion of using an antibody to treat allergic disease was beyond the imagination of most academic researchers and clinicians then (Chang, 2006). An immediate feeling among scientists first told of the anti‐IgE approach was that other anti‐IgE antibodies had already been known to be potent inducers of basophil and mast cell activation, and would cause anaphylactic reactions, if they were injected into a person. Hence, the idea of injecting an anti‐IgE antibody, albeit different from ordinary anti‐IgE antibodies, was met with skepticism. Among other major arguments put forth by immunologists was that even if IgE could be neutralized to better than 99%, the remainder would still be sufficient to charge the receptors on basophils and mast cells, keeping them sensitive to allergens (Pruzansky and Patterson, 1988). Another thought was that as IgE is bound by the high‐affinity receptors on mast cells for many months or perhaps more than a year, the neutralization of free IgE by administrating anti‐IgE would not affect the sensitivity of those cells. Yet another argument was that IgE is essential for immune defense functions and cannot be compromised (Capron and Capron, 1994; Capron and Dessaint, 1992). Despite these overall dubious sentiments, the new therapeutic concept eventually found a few supporters from a large pharmaceutical company and has been actively developed, although bumps were hit on the way, in the last 20 years. Officials and scientists at the FDA in the United States and at the Medicines Control Agency (now reorganized) in United Kingdom encouraged the development of this drastically different experimental drug for allergic diseases with cautious interest and provided guidance to us in preparing for the first human experimentation. The chimeric anti‐IgE antibody, CGP51901, was first administered to patients in Southampton, United Kingdom in 1991. Initially, while we had difficulty dissecting the biological results, mainly the rapidly rising total IgE (accumulating immune complexes), safety was not a major concern. 3. Anti‐IgE Is Approved for Treating Moderate‐to‐Severe Asthma In 19941995, the first Phase II trial of anti‐IgE was performed with CGP51901 at three medical centers in Central Texas on patients with severe allergic rhinitis caused by mountain cedar pollens. The patients were randomized in four groups and given weekly injections of placebo or CGP51901 at
74
TSE WEN CHANG ET AL.
15‐, 30‐, or 60‐mg dose. The results revealed a robustly clear dose response, showing that the antibody was safe and efficacious in alleviating nasal and ocular allergic symptoms (results not published; the lead author of this chapter participated in the study). In 1996, the two corporate anti‐IgE development programs were combined (Fig. 1). The new partnership planned clinical development paths for omalizumab and decided that several Phase II trials be carried out on both allergic asthma and allergic rhinitis. As the development program proceeded in the following years, increased emphasis was placed on allergic asthma. It was reasoned that the incidences of asthma, especially pediatric asthma, were rising in most regions of the world at alarming rates (Cookson, 1999; Kussin and Fulkerson, 1995). Also, the most severe cases (10%) of asthma are life‐ threatening and consume large amounts of healthcare resources. In the new awareness of pharmacoeconomic environment, the costs of a drug per patient per year must be weighed against the therapeutic benefits achieved and the healthcare dollar saved (Hoskins et al., 2000). Many excellent review articles have been written by clinical investigators summarizing and analyzing in great detail the results obtained in the series of trials of omalizumab on allergic rhinitis. To avoid repeating such a task, this section will summarize the clinical studies succinctly for immunologists, who normally do not survey clinically oriented journals, and discuss aspects of the effects of anti‐IgE on asthma that are not covered by other reviews. 3.1. ‘‘Allergic Asthma’’ Has Been Adopted as a New Clinical Indication ‘‘Allergic asthma,’’ a term that had already appeared in the literature in the 1950s (Prickman, 1951) but used sparingly in the ensuing few decades, has emerged as an important concept as the anti‐IgE concept gradually takes hold. Practically, most clinicians treating asthma patients do not need to know possible immunological or allergic involvement in the asthmatic disease they treat. They use corticosteroids to suppress inflammatory responses and b2 adrenergic receptor agonists to relax constricted airway smooth muscles. In pharmaceutical development, a candidate drug is studied for use to treat a defined clinical indication. Normally, a drug being developed for asthma, such as a new chemical entity or a new formulation of b2 agonist, antileukotriene, or corticosteroid, is tested for treating asthma without considering the asthmatic cases’ possible allergic nature. The frequent news and official reports of the clinical study results of the anti‐IgE drug candidates in the past decade have gradually brought an awakening among clinicians treating asthma patients that in a large proportion of asthma cases, allergy is involved (Holgate et al., 2005a). In the clinical trials of anti‐IgE, a skin prick test was required to
THERAPEUTIC ANTI-IgE ANTIBODIES
75
screen patients for positive reactivity toward at least one allergen suspected to be the cause of potential allergy in the examined patient. Now that omalizumab has been approved for marketing for ‘‘allergic asthma,’’ clinicians use positive skin prick test reactivity as one criterion to determine the suitability of an asthma patient to receive omalizumab medication. 3.2. Clinical Parameters Determined in the Clinical Studies The clinical studies of omalizumab for treating patients with allergic asthma, with either moderate‐to‐severe or severe disease, in either adolescent and adult or pediatric populations, with or without the combination of other drugs, all adopted a general protocol design (Fig. 4; Buhl et al., 2002; Milgrom et al., 2001; Soler et al., 2001), which has been regarded as highly effective. As a major clinical objective of the new anti‐IgE drug was to reduce corticosteroid use, a key component in the clinical study design was that it enabled the examination whether the patients’ dependence on corticosteroids can be partially reduced or withdrawn entirely. In the multicenter, double‐blinded clinical studies, patients with allergic asthma were recruited with a set of screening criteria and randomized into placebo and treatment groups. Generally, patients were allowed a 4‐ to 6‐week ‘‘run‐in’’ period to establish their use of adequate amounts of corticosteroids, then a 28‐week core‐study or ‘‘add‐on’’ period, in which the patients were given placebo or omalizumab of 150‐ or 300‐mg dose every 2 or 4 weeks according to their plasma IgE levels and body weights, and lastly, a 4‐, 6‐, or 12‐month ‘‘extension period’’ for continual observation (Fig. 4). In the first 16 weeks of the 28‐week add‐on period, patients were maintained at their regular doses of corticosteroid; in the last 12 weeks of the 28‐week add‐on period, a ‘‘steroid reduction’’ schedule was implemented for each patient. Beginning at the starting point of the 12‐week period, a quarter of the stabilized amount of corticosteroid was taken off. If, in the 2‐week interval, the patient maintained symptom‐free, another quarter amount of the steroid would be reduced, whereas if a patient became symptomatic as defined by the chart in Fig. 4, the steroid would be resumed to the dose of 2 weeks before and kept at that dose throughout the remaining period of the trial (Buhl et al., 2002; Milgrom et al., 2001; Soler et al., 2001). To date, a total of 17 clinical studies of omalizumab on allergic asthma, covering adult, adolescent, and pediatric patients, with varying degrees of disease severity, and with different accompanying medications, have been performed and published. Those results clearly indicate that anti‐IgE was effective in reducing the numbers of asthma attacks (exacerbations) at the same time when corticosteroids were substantially reduced or completely
76
TSE WEN CHANG ET AL.
Study time frame Run-in
Add-on
4−6 weeks
Extension
28 weeks
Phase
16 weeks to 12 months
Anti-lgE add-on period Steroid maintenance
Steroid reduction
16 weeks
12 weeks
Steroid reduction scheme (Dosage) 100% S 75% NS
S
50% NS
25%
S NS
S
6 Weeks
8
0% 0
2
4
10
12
S, symptomatic; NS, non-symptomatic Symptomatic criteria (as appeared in Holgate et al., 2004): 1. >50% increase in 24-h rescue medication use on at least 2 of any 3 consecutive days compared to mean use over the last 7 days of the preceding phase. > 4 over the previous 7 days. 2. Mean daily asthma symptom score − 3. Fall in morning peak expiratory flow (PEF) of >20% on at least 2 of any 3 consecutive days relative to the mean morning PEF over the last 7 days of the proceeding phase. 4. Worsening of disease between visits requiring an unscheduled practitioner or hospital visit. 5. At least 2 of 3 consecutive nights with awakenings due to asthma symptoms requiring rescue medication. 6. An asthma exacerbation. Figure 4 The clinical trial protocol used in most of the trials of omalizumab in allergic asthma.
withdrawn in most of the patients (Bousquet et al., 2005; Soler et al., 2001). The numbers of unscheduled doctor’s office visits, emergency department visits, days of hospitalization were also significantly reduced (Bousquet et al., 2005; Humbert et al., 2005). Lung functions, in terms of forced expiratory
THERAPEUTIC ANTI-IgE ANTIBODIES
77
volume, were increased (Ayres et al., 2004). The other measurements, which were of concern to the patients and the clinicians and whose changes were statistically significant, included many quality‐of‐life measurements, including reduction of missing days to school or to work and loss of sleep (Ayres et al., 2004; Buhl et al., 2002; Lemanske et al., 2002). 3.3. The Clinical Studies Confirm the Roles of IgE in the Pathogenesis of Asthma At the time when the anti‐IgE therapeutic concept was conceptualized and during its initial clinical development, it was still debated whether IgE is involved in asthma. The situation was different in allergic rhinitis, where there was a general belief that IgE is involved in the disease. In the United States and Western European countries, clinicians treating moderate to severe cases of allergic rhinitis were mostly allergists, who were trained in the specialty of allergy. These clinicians were familiar with allergen‐based immunotherapy and applied it to treat patients. They used patch tests and skin prick tests to gauge immune responses to suspected allergens and measured plasma total IgE and allergen‐specific IgE levels to assist their therapeutic practice. Immunology and IgE have been a big part of the knowledge and tool base of the medicine applied for allergic rhinitis (Sections 4.1 and 5). Asthma patients were generally not treated by allergists, but by pulmonary or thoracic physicians, or internists, who did not receive substantial amounts of immunology in their training. These clinicians treated mainly the inflammation and bronchial constriction associated with asthma. The knowledge on possible involvement of the immune system or IgE in asthma would not matter in their care of asthmatic patients. Very few cases of asthma are treated with immunotherapy. Perhaps the most relevant research linking IgE to asthma were a number of surveys investigating the correlation between (1) asthma and serum IgE levels (Burrows et al., 1989) and (2) the severity of asthma and serum IgE levels (Borish et al., 2005). However, the overall clinical setting and the lack of experimental evidence linking directly IgE activities to asthma left open an unsettled dispute whether IgE is involved in the pathogenesis of asthma. The clinical studies of anti‐IgE demonstrate that anti‐IgE, by virtue of its ability to incapacitate IgE, can not only inhibit the early‐phase reactions, occurring within the first 4 h of an asthma attack, but also the late‐phase reactions, occurring beyond the first 4 h (Boulet et al., 1997; Fahy et al., 1997). These inhibitory effects of anti‐IgE result in improving various symptoms of allergic asthma, as shown convincingly in more than 15 Phase II and III clinical studies. Thus, anti‐IgE has helped to confirm unambiguously the roles of IgE in the pathogenesis of allergic asthma (Holgate et al., 2005a).
78
TSE WEN CHANG ET AL.
3.4. Analyses of Good Responders Among Asthma Patients For an expensive drug like omalizumab, a diagnostic or screening procedure that helps identify patients who are likely to respond well to and benefit substantially from the drug is highly desirable (Heaney and Robinson, 2005). Asthmatic patients with protracting conditions present variable sets of pathogenic components and probably respond to anti‐IgE therapy with different degrees of improvement. In addition to a positive skin test to allergens, criteria such as a suitable range of IgE would be highly desirable for identifying potential good responders. The various clinical trials of omalizumab on asthma and the corporations marketing omalizumab have indicated that omalizumab achieved response rates in the range of 60–90%. It appeared that when the studied or targeted patients are more severe, the response rates are higher. Statistical analyses performed on the aggregated results of clinical trials on asthma indicate that anti‐IgE benefit best the most severe, difficult‐to‐treat patients, coincidentally matching a pharmacoeconomic criterion (Oba and Salzman, 2004). Most of those difficult‐to‐treat asthma patients cannot be controlled even with very high doses of inhaled and injectable corticosteroid (BDP > 800 mg/day) and have poor lung functions (FEV1 < 65%) (Bousquet et al., 2004). Anti‐IgE appears to be able to remove the root cause of inflammation in those difficult‐to‐treat patients (Ayres et al., 2004; Humbert et al., 2005). Clinicians have also suggested that asthma patients who have concomitant allergic rhinitis also respond well to anti‐IgE treatment (Vignola et al., 2004). The basal levels of IgE do not seem to correlate with responsiveness or degrees of efficacy. In the large number of clinical trials on omalizumab, patients with plasma IgE outside the 30700 IU range were excluded. The dosing schedule allowed omalizumab to be in excess of replenished IgE during the clinical trial periods and hence IgE levels within this range should make no difference to the effectiveness of anti‐IgE. That plasma IgE levels affect the density of FceRI on effector cells and the accumulation of anti‐IgE:IgE immune complexes will be discussed in Sections 7–9. 4. Studies on Other Allergic Diseases Among the large populations of patients affected by allergic rhinitis, food allergy (especially peanut allergy), or atopic dermatitis are severe cases, which cannot be adequately treated with currently available drugs and are in need of better medicine. There are smaller patient populations who are affected by sensitivity to occupation‐related materials, such as natural rubber latex, papain, yeast, and so on, to certain drugs, or to insect stings. While it is
THERAPEUTIC ANTI-IgE ANTIBODIES
79
clear that IgE is involved in the pathogenesis of allergic rhinitis, the information in the literature is not indicative of whether IgE is a dominant factor in other allergic diseases or conditions. Thus, anti‐IgE offers not only a valuable tool to study the extent of IgE’s involvement in these allergic diseases but also a possible treatment modality for the severe cases of these clinical indications. 4.1. Clinical Applications in Treating Allergic Rhinitis Ten to forty percent of the general population is affected by allergic rhinitis in different regions of the world (Asher et al., 2006; Schoenwetter, 2000). Proportions of those populations have substantial symptoms and use over‐the‐counter medicine or seek physicians’ help. In the United States, patients visit doctors’ offices more times for allergic rhinitis than for any other disease. There are more than 10,000 licensed allergists in the United States (information from American Academy of Allergy, Asthma, and Immunology), who treat mainly patients with allergic rhinitis with immunotherapy. Unlike most allergic asthmatic cases, which are caused by indoor allergens such as dust mites and cat dander, most allergic rhinitis cases are caused by outdoor airborne protein antigens such as tree pollens in the spring and grass pollens in the late summer and fall (Boulet et al., 1997; Leynaert et al., 1999). This interesting dichotomy is a curious subject for investigation. By mechanisms that are yet not well understood, the exposure of the body to minute amounts of protein antigen at the mucosal surface in the respiratory and the gastrointestinal tracts can induce antigen‐specific IgE production in some people. Some patients have sensitivity toward one or very few allergens, while others are sensitive to a large numbers of allergens. Some patients have very defined allergic rhinitis, while others have concomitantly asthmatic and dermatitis symptoms. Some patients have distinctive seasonal patterns, suffering seasonal allergic rhinitis only in the spring when tree pollens are dense, or only in the fall when grass pollens are rampant, or in both seasons, whereas others have perennial allergic rhinitis and are affected by a number of allergens that together are present throughout the whole year (Beck and Leung, 2000; Braunstahl, 2005). Altogether more than a dozen Phase II and III clinical trials have been performed on allergic rhinitis in the United States, Germany, Scandinavian countries, Australia, New Zealand, Japan, and other countries. These include studies that investigated the efficacy and safety of (1) CGP51901 on patients with severe allergic reactions to mountain cedar pollens and (2) omalizumab on patients with sensitivity on birch pollens, ragweed pollens, pollens of other grasses, and others (Adelroth et al., 2000; Casale, 2001; Casale et al., 1997, 2001; Nayak et al., 2003). In both clinical trials on seasonal allergic rhinitis and
80
TSE WEN CHANG ET AL.
on perennial allergic rhinitis, anti‐IgE was shown to be effective in improving allergic rhinitis symptoms, reducing the inflammation and mucous secretions in the nasal and conjunctiva linings and reducing sneezing attacks. The treatment also improved quality of life measurements. These studies have amply demonstrated that IgE and type I hypersensitivity are clearly a dominant mechanism for most cases of allergic rhinitis. Despite the robust data on the safety and efficacy of anti‐IgE in treating allergic rhinitis, governmental regulatory approval of marketing omalizumab for allergic rhinitis indication is not imminent. It appears that FDA requires a sufficiently long postmarketing period to ensure that the long‐term use of anti‐IgE by asthma patients does not cause undesirable side effects. 4.2. Anti‐IgE Studies on Treating Peanut Sensitivity Researchers working on anti‐IgE recognized early the importance of investigating the utility of anti‐IgE in treating sensitivity or anaphylactic reactions to peanuts. In economically developed countries, some people, mostly children, develop extreme sensitivity to peanuts (Skolnick et al., 2001). They mount severe allergic reactions, often in the form of anaphylaxis, from ingesting or inhaling peanut product at an amount as small as half a peanut. The incidences are often accidental and life‐threatening, hence peanut allergy often causes constant fear in the patients and their families. The treatment of peanut allergy is strict avoidance of peanut‐containing food product. Patients and their relatives are advised to carry a prefilled epinephrine (b2 agonist) syringe for relieving anaphylactic reactions induced by inadvertent exposures. It is also known that allergen‐based immunotherapy and corticosteroids do not treat peanut allergy effectively. Thus, a therapy that can substantially reduce patient’s sensitivity to peanut would be of great relief for these patients and their families. TNX‐901 was studied in a Phase II clinical trial on peanut allergy (Leung et al., 2003). In the study, 84 volunteering patients were randomized into four groups and given placebo or TNX‐901 at 150, 300, or 450 mg subcutaneously every 4 weeks for four times. Two to three weeks after the last injection, the patients were challenged with increasing amounts of encapsulated peanut flour, which the patients swallowed. It was shown that TNX‐901 could increase the tolerable amounts with increasing doses of the anti‐IgE. At the 450‐mg dose, the tolerability was increased from an average of half a peanut to 28 peanuts in most patients. These results do not suggest that the patients can venture out eating peanut packages or peanut‐containing food, but the anti‐IgE drug will protect patients from anaphylactic reactions, when they accidentally eat peanut‐containing meals or food products or breathe in peanut‐containing powders.
THERAPEUTIC ANTI-IgE ANTIBODIES
81
A Phase II trial of a similar design was also carried out for omalizumab. However, it was terminated in the middle of the trial, because a few patients developed severe hypersensitivity reactions, while they were tested for their baseline levels of sensitivity to peanuts by taking in peanut flour, prior to receiving omalizumab. A new study with a different design will be started later this year (information from news releases from the corporations developing omalizumab). Furthermore, the favorable results of TNX‐901 on peanut allergy should encourage clinical studies on allergy toward other foods. 4.3. Clinical Application in Latex Sensitivity Some people are sensitized to natural rubber latex and products made from it, especially latex gloves for healthcare workers (physicians, dentists, nurses, and so on) and balloons for children (Sussman et al., 2002). Patients are exposed to natural rubber latex by direct skin contact to latex products and by inhaling latex‐containing powders used for packing and aiding use of latex products. The most frequent symptoms associated with latex are respiratory and skin complications (Fish, 2002). Most patients develop IgE responses to proteins contained in natural rubber latex. This raises the following intriguing question: if a patient is exposed to latex products mainly by direct skin contact, how do the proteins contained in the latex powder or in the latex sheets induce IgE immune response? In addition to avoidance of latex products, immunotherapy using natural rubber latex extracts have also been tested on children with latex sensitivity and found to have partial response. A small Phase II trial was performed investigating the efficacy of omalizumab on 18 healthcare workers with allergy to latex products (Leynadier et al., 2004). The patients developed nasal and ocular symptoms and mild‐to‐moderate asthma on using latex gloves and their sera were shown to contain IgE specific for latex proteins. In the double‐ blinded study, patients received omalizumab (150–750 mg/month) or placebo for 16 weeks. They were evaluated in terms of ‘‘conjunctival challenge test total scores’’ after 8 and 16 weeks of treatment. The results indicated very convincingly that anti‐IgE helps alleviate allergic reactions to natural rubber latex. 4.4. Allergic Diseases or Conditions for Which Anti‐IgE Has Been Tested in Case Studies As the safety and efficacy of anti‐IgE have been well established in allergic asthma and allergic rhinitis, clinicians have become adventurous in testing the effects of anti‐IgE on diseases that manifest allergic symptoms and are known to be associated with elevated levels of IgE. These tests have not been
82
TSE WEN CHANG ET AL.
performed systematically and generally involve only one or a few patients. Most of these tests have not been published, but a few have been published as case reports. Among many other allergic diseases that are prevalent and have an apparent association with IgE is atopic dermatitis (also called urticaria; Leung and Soter, 2001; Shehade et al., 1988), which affects mainly children at an alarming rate in economically advanced countries (Eigenmann et al., 1998; Novak et al., 2003a). The hallmark of atopic dermatitis is the generally very high blood IgE levels, which are in excess of 1000 IU/ml in most patients and reach more than 10,000 IU/ml in a sizable fraction of patients (Laske et al., 2003; Somos et al., 2001). The clinical studies of omalizumab only included patients with plasma IgE in the range of 30–700 IU/ml. It was estimated that administrating anti‐IgE at the designed protocol would maintain anti‐IgE in excess of newly synthesized IgE in the treatment period. Thus, the high IgE in atopic dermatitis patients would dissuade use of anti‐IgE, which administered at comparable doses could not neutralize the newly synthesized IgE and hence would not be effective. The three reports of off‐label use of omalizumab on 3, 3, and 7 patients, respectively, yielded mixed, but promising results. In the first report, the three adult patients aged 3448, who had baseline serum IgE at 23,000, 5440, and 24,400 IU/ml, respectively, failed to benefit from omalizumab administered at 450‐mg dose every other week for 4 months (Krathen and Hsu, 2005). In the second report, three young recalcitrant atopic dermatitis patients 1113 in age, who had baseline serum IgE in the range of 1990–6120 IU/ml, received omalizumab at 150–450 mg every other week for 22 weeks and experienced substantial improvement. In the third report, seven patients, 758 in age, who had persistent asthma and severe atopic dermatitis and baseline serum IgE in the range of 265–2020 IU/ml, received omalizumab at 375 mg every other week for 7 months (two patients got omalizumab for only 3 months because their insurance companies refused to cover the costs of the treatment). All patients improved in their eczema severity scores measured at 3 months (for all seven patients) and 7 months (for five patients) after treatment (Lane et al., 2006; Vigo et al., 2006). It is not clear why the first patient group responded differently from the other two; IgE levels might be a factor (Section 9.2). Two other very interesting clinical indications have been tested with omalizumab, for which the results have been published. There was a case report on a patient with serious cold‐induced urticaria/anaphylaxis (Boyce, 2006). A regimen of 375 mg of omalizumab biweekly resolved the patient’s urticaria, asthma, and rhinitis symptoms, with noticeable improvement occurring after the second injection of omalizumab. There was also a case report on a patient with serious interstitial cystitis, which does not seem to be an allergic disease
THERAPEUTIC ANTI-IgE ANTIBODIES
83
(Lee et al., 2006). Because the patient also had allergic rhinitis and asthma, specific immunotherapy (SIT) was recommended for her. However, she would develop anaphylactic reactions even to 1000‐fold diluted antigens, and hence omalizumab was suggested to tame the anaphylactic reactions. The patient was given omalizumab at 300 mg every 4 weeks. To the surprise of the patient and the treating clinician, the patient’s interstitial cystitis was improved on the first injection. While both of those cases cannot be used to support that anti‐IgE be approved for these disease indications, they encourage further investigation on the roles of IgE in these diseases and the potential of anti‐IgE in treating them. The case reports also provide extraordinary insights into the pharmacological mechanisms of anti‐IgE. 5. The Potential of Using Anti‐IgE to Assist Allergen‐Based Immunotherapy In economically advanced countries in North America and Western Europe, allergy is a well‐defined medical specialty serving substantial medical needs. In this specialty, vast amounts of research and development have been carried out and clinical tools accumulated. Undoubtedly, the most significant body of knowledge base in the allergy specialty is the know‐how on immunotherapy. Since immunotherapy was introduced by Noon nearly a century ago (in 1911), a sea of experience has been organized for clinical practice. Clinicians are familiar with the hundreds of allergens present in the local area where they practice. They have established mechanisms for acquiring, stocking, and using large numbers of antigen preparations for performing patch or prick skin tests and for providing allergen‐based hyposensitization immunotherapy. They also use various immunoassays to measure total IgE and allergen‐specific IgE in patients to assist therapeutic procedures. Immunotherapy is often chosen by patients to treat severe allergic rhinitis and venom anaphylaxis (Ross et al., 2000). A major reason is that it can sometimes achieve cure. The immunization with allergens adopted in immunotherapy drives an array of effects, including the production of protective IgG4 antibodies, the shift from TH2 to TH1, and others, which dampen the actions mediated by allergen‐specific IgE (Carlsen, 2004; Ross et al., 2000; Till et al., 2004). The shortcomings of immunotherapy are that it does not alleviate the allergic symptoms in about half of the patients who receive the treatment and is generally not effective for treating asthma (Bousquet et al., 1991; Limb et al., 2006; Nelson, 2003). Another main drawback is that the administration of allergens can sometimes cause anaphylactic reactions (Bernstein et al., 2004; Borchers et al., 2004), especially if the doses of allergens are increased and the injection schedule is compressed. Thus, it is a rational proposition that immunotherapy and anti‐IgE therapy are combined to enhance the advantages of
84
TSE WEN CHANG ET AL.
immunotherapy and to minimize its shortcomings (Chang, 2000). This may expand the practice of immunotherapy to cover broader patient populations (Parks and Casale, 2006). 5.1. The Combination of Anti‐IgE and SIT In four well‐designed clinical studies carried out in Germany (Bez et al., 2004; Kopp et al., 2003; Kuehr et al., 2002; Rolinck‐Werninghaus et al., 2004), the effects of omalizumab were investigated for augmenting the efficacy of SIT on polysensitized allergic rhinitis patients, who were allergic to birch pollens in the initial period and subsequently to grass pollens in the following period during the pollen season from approximately February to July, depending on the locations of the patients. The birch and grass pollen periods were distinctly separated by 12 weeks and nonoverlapping. The grass pollen antigen used in the trial was prepared by mixing six grass pollens and secale pollens. In the first segment (period) of the trial, grass antigen was used as an irrelevant antigen control, and in the second segment (period), birch pollen antigen was used as a control. The results indicated that omalizumab alone could achieve an efficacy comparable to that of SIT, and the combination of SIT and omalizumab could achieve an efficacy better than either SIT or omalizumab alone. 5.2. Priming Patients with Anti‐IgE for Rush Immunotherapy In a typical rush immunotherapy (RIT) protocol, a patient receives several antigen injections in steeply escalating doses within a few hours on the first treatment day. In some but not all protocols, the patient continues to receive several antigen injections in still sharply increasing doses within a few hours in each of the following few days in an inpatient procedure. In the following several months, the patient receives weekly increasing doses of antigen (Sharkey and Portnoy, 1996). RIT, which can be performed in an ‘‘off‐season’’ or an ‘‘off‐site,’’ is suggested for patients with severe allergy that needs to be treated promptly. Because the rates of increments of antigen in RIT are much more aggressive than those in a typical SIT, the incidences of severe reactions, including anaphylaxis, are inevitably much higher (Greineder, 1996). Thus, while RIT is highly desirable for resolving the allergic problems of patients in short time frames, it is highly risky. In a recently published double‐blinded, placebo‐controlled clinical study investigating the utility of anti‐IgE in protecting patients receiving RIT from anaphylactic reactions, the patients, who had ragweed pollen‐induced seasonal allergic rhinitis, were pretreated with three doses of 4‐weekly or five doses of biweekly omalizumab injections, started 9 weeks before the RIT protocol.
THERAPEUTIC ANTI-IgE ANTIBODIES
85
One week after the last omalizumab injection, patients were given six injections of Amb a 1 antigen, a major ragweed pollen antigen (100‐fold increase in dosages) in 3 h or eight injections (330‐fold increase in dosages) in 5 h. In the following 12 weeks, the patients received increasing doses of the ragweed pollen antigen. The results indicated that pretreatment with omalizumab could reduce the incidences of anaphylactic reactions by 80%, while significantly reducing severity scores of allergic symptoms (Casale et al., 2006). 6. Pivotal Roles of IgE and Fc«RI in Type I Hypersensitivity 6.1. Stages Along IgE‐Mediated Allergic Pathway Omalizumab has already been approved in many countries for treating allergic asthma and has potential for broad use in treating severe allergic rhinitis and several other IgE‐mediated allergic diseases. In order to understand how anti‐ IgE renders its pharmacological mechanisms to achieve the effects of alleviating allergic symptoms, it is important to dissect the IgE‐mediated allergic pathway and analyze the intricate interactions among its elements and related factors. Figure 5 shows that the IgE‐mediated pathway can be divided into sensitization, triggering, and manifestation stages. In these three stages, the key elements are also indicated. The sensitization stage in a patient may take many months to several years (Zeiger and Heller, 1993), depending on a complex set of intrinsic and extrinsic (environmental) factors particular to the patient. The intrinsic factors include genetic and nongenetic ones (Cookson, 1999; Novak and Bieber, 2003). In the progressive process of sensitization in a patient toward certain foreign, harmless, mostly protein antigens encountered by the patient, the B cells are influenced to switch to IgE‐expressing B cells (KleinJan et al., 2000). The end result of this sensitization stage is the continual production of IgE specific to these antigens, consequently creating a sensitive state, in which the patient may be triggered to mount IgE‐mediated reactions on exposure to the antigens. In the triggering stage of a patient sensitized to an allergen, the allergen‐ specific IgE is present at a significant proportion in total IgE (more detail in Section 6). The allergen‐specific IgE occupies a significant number of FceRI on mast cells, basophils, and activated eosinophils. These effector cells are said to be in an ‘‘armed’’ state and ready to ‘‘fire’’ anytime a threshold number of allergen‐specific IgE‐charged FceRI on them is cross‐linked and aggregated by allergen molecules (Ishizaka et al., 1984). The triggering stage in an allergic response can be an astonishingly fast process. For example, in an allergic response to tree pollens or house dust mites, a patient takes in the pollen particles or fecal particles of mites through inhalation. The allergen particles are brought into mucous fluid in the nasal lining or lower airway and broken
86
TSE WEN CHANG ET AL.
Res t lgM ing /lgD B ce ll
a-E a-E
Allergens
lgE B ce ll Sen s
lgE plas ma cell
itiza
tion
lgE
a-E
se
rypta
ne, t
mi Hista
nes
otrie
leuk
a-E
a-E
sophil ell/ba
es
kin emo s, ch
Mastc
kine
cyto
Triggering
Inflam bronch mation ocons triction
Allerg ic rhin asthm itis anaph a ylaxis
Man
ifes
tion
Figure 5 The IgE‐mediated allergic pathway. Sites denoted by a circled aE indicated the steps where anti‐IgE has been shown to act or can potentially act at.
apart and the proteins contained therein dissolved. Certain (not all) proteins find ways to get across the mucosal epithelia into the basal side, where the allergenic proteins bind to the allergen‐specific IgE on mast cells, cross‐linking the IgE and thereby aggregating the underlying FceRI, initiating a signal‐ transducing cascade, leading to Ca2þ mobilization and exocytotic processes, and ultimately the discharge of pharmacological mediators from mediator‐packed
THERAPEUTIC ANTI-IgE ANTIBODIES
87
granules (Janeway et al., 2005; Kinet, 1999). The entire process can sometimes take less than a minute. The triggering process involving many mast cells in the local area will continue during the period a patient is exposed to over‐threshold concentration of allergens. The mediators released from sensitized mast cells and basophils are of three categories (Bingham and Austen, 2000; Serafin and Austen, 1987). The prepacked mediators include histamines, tryptase, and chymase. In the second category are lipid mediators such as leukotrienes, which are synthesized within minutes after the sensitization of the cells. The third category includes cytokines and chemokines (Bingham and Austen, 2000; Williams and Galli, 2000), whose genes are activated and expressed as the cells are activated. These protein factors are synthesized and released after cells are activated for about 4 h. The manifestation stage, which may last from minutes to hours to days, can be divided into periods of early‐ and late‐phase reactions, which are mediated largely by the prepacked mediators and small molecular mediators and by the cytokines and chemokines, respectively. The mediators released from mast cells, basophils, and activated eosinophils bind to respective receptors on various cell types and cause inflammatory processes directly or indirectly, seen in all types of allergic responses. The factors also bind to smooth muscles of the airway and cause bronchoconstriction. In an anaphylaxis, a systematic, sometimes violent, reaction occurs and can pose life‐threatening situations. Numerous elements, including histamines, tryptase, leukotrienes, cytokines, and other mediators, as well as the ‘‘instability’’ of mast cells (Section 8.2), in the IgE‐mediated allergic pathway are targets of therapeutic intervention for the purpose of attenuating allergic responses. On the basis of the pivotal role of IgE in arming mast cells and basophils, IgE is a rational target for therapeutic intervention, because blockage at this step shuts off the later steps, including the release of all mediators by mast cells and basophils. 6.2. Direct Pharmacological Effects of Anti‐IgE IgE mediates its broad range of effects via binding to FceRI and FceRII expressed on various cell types. The interaction of IgE with FceRI in the IgE‐ mediated allergic pathway is central to almost all effects leading to the manifestation of allergic symptoms. The most direct effect resulting from the binding of anti‐IgE to free IgE is that IgE is blocked from binding to FceRI on basophils, mast cells, and activated eosinophils, which should turn off the IgE‐mediated pathway shown in Fig. 5. The other direct effects are that IgE is blocked from binding to FceRII (membrane‐bound CD23) on B cells, macrophages, granulocytes, platelets, and many other cell types and to soluble CD23 in the blood and interstitial space. How the inhibitory effect on IgE binding to
88
TSE WEN CHANG ET AL.
FceRI will disarm the FceRI‐equipped effectors must be assessed in terms of extent and timing as to be discussed in Section 8. How blocking IgE binding to FceRII will affect the activity of the IgE‐mediated allergic pathway and overall immune activity will be discussed in Section 11.2. 7. Neutralization of Free IgE Because IgE is a key molecule in the IgE‐mediated allergic pathway, neutralizing IgE and decreasing its synthesis would seem to be a logical approach to mitigate the IgE‐mediated allergic pathway. In applying anti‐IgE to neutralize the activity of IgE in the blood and interstitial space in a patient, a question stands out: to how low should the free IgE be brought down? In a few early clinical trials, answers in terms of the percentages of the baseline levels of plasma IgE were provided. However, those data are probably not correct, because the immunoassays for determining free IgE involved high dilution of plasma samples, which would liberate IgE from the immune complexes, resulting in an overestimation of the free IgE levels. In addition, in considering the great variations of total IgE and allergen‐specific IgE concentrations among different patients, there is probably no simple answer. This section intends to analyze these issues in detail. 7.1. Total IgE and the Proportion of Allergen‐Specific IgE Anti‐IgE targets the entire isotype of IgE in a patient. Now that anti‐IgE is known to be capable of achieving therapeutic efficacy in treating IgE‐mediated allergic diseases, one would logically ask to how low IgE should be reduced for causing a significant extent of loss of sensitivity of mast cells and basophils. The sensitivity of mast cells and basophils is a function of a host of factors. This chapter proposes that among these factors, the most critical ones are (1) the density of FceRI occupied by allergen‐specific IgE on the surface of mast cells and basophils and (2) the concentration of allergens in the fluid surrounding the cells (at the particular tissue site and at the moment of concern). Furthermore, the density of FceRI occupied by allergen‐specific IgE on the surface of mast cells and basophils are a function of two variables: (1) the proportion of allergen‐specific IgE in total IgE and (2) the concentration of total IgE. Different IgE molecules bind through their common Fc to FceRI with an equal affinity, regardless of their antigenic specificities. Over time, the proportion of FceRI that is occupied by allergen‐specific IgE is the same as that of this allergen‐specific IgE in total IgE. In the other part of the equation, the serum IgE concentration correlates with the density of FceRI (occupied by IgE) on basophils. In a classical study published by Litchenstein and colleagues in the
THERAPEUTIC ANTI-IgE ANTIBODIES
89
late 1970s (Malveaux et al., 1978), it was found that among 26 donors analyzed, the serum IgE concentrations ranged from 2.6 to 5500 ng/ml (about 2000‐folds in range), and the numbers of surface IgE molecules per basophil ranged in a well‐correlating fashion from 6000 to 600,000 (about 100‐folds in range). Thus, the density of FceRI occupied by allergen‐specific IgE on the surface of basophils and probably mast cells are determined by the above two variables. Parenthetically, the above concept provides a molecular basis for explaining the ‘‘hygiene hypothesis,’’ which states that people who lack frequent microbial infection during infancy and early childhood, as the result of much improved hygienic conditions, have increased likelihood of developing allergic diseases. A popular explanation is that microbial infections during the first years of life condition the immune system toward the TH1 mode and hence weaken the immune activities stimulated by IL‐4, Il‐5, and other drivers of the TH2 branch, and conversely, in the absence of frequent microbial infections the immune system is skewed toward the TH2 mode. It is now established that IgE is involved in a dominant fashion in the pathogenesis of allergic asthma, allergic rhinitis, and probably several major allergic diseases. Therefore, the hygiene hypothesis must be explained in terms of how the IgE‐mediated allergic pathway is enhanced in some individuals, who had few infections in early childhood. We believe that a plausible molecular elucidation of the hygiene hypothesis can be made by analyzing how the decrease of infections by microorganisms, viruses, and helminthic worms, and the increase of exposure to harmless environmental antigens affect in patients the total IgE concentration, the proportion of allergen‐specific IgE in total IgE, and the concentration of allergens in the body fluids the inflammatory cells encounter. 7.2. IgE Concentration versus IgE Occupancy of FceRI The density of allergen‐specific IgE‐occupied FceRI on mast cells will be reduced, if the total density of FceRI is reduced. Figure 6 examines the percentages of FceRI on a mast cell that are occupied by IgE over a broad range (5 logs) of IgE concentrations, from 0.1 to 10,000 IU/ml. This analysis indicates that in almost the entire range of IgE concentration present in the human population, the FceRI are essentially all occupied. Only at the extremely low range of IgE levels, the percentage of FceRI occupancy is reduced significantly: at 3 IU/ml of IgE, the proportion of occupied FceRI is about 25%; at 1 IU/ml of IgE, the occupancy of FceRI is about 10%. This suggests that for patients with baseline IgE levels higher than the average 300 IU/ml of asthmatic patients, IgE levels must be reduced to more than 99% for the receptor occupancy to fall below 25%. In Section 8, the stability of IgE‐ occupied and ‐unoccupied FceRI and the turnover of FceRI will be discussed.
90
TSE WEN CHANG ET AL.
Receptor occupancy
200 75% 150 50%
100
25%
0% 0.1
50
1
10
100
1000
Number of occupied receptor per cell (⫻10−3)
100%
0 10,000
lgE concentration (lU/ml) Figure 6 The relationship between IgE concentration and occupancy rate of FceRI on basophils. The calculation is based on Kd of 1 10–10 M for anti‐IgE’s binding to IgE and 220,000 FceRI (receptors) per basophil.
8. Downregulation of Fc«RI 8.1. The Dynamical Relationship Between Free IgE and FceRI The above analysis that IgE must be reduced to >99% in order for FceRI on mast cells and basophils to become significantly unoccupied is based on steady state kinetic properties, reflecting the concentration of IgE and the density of FceRI and the interaction between them. However, on the surface of living mast cells and basophils, the presence of IgE‐unoccupied and ‐occupied FceRI is highly dynamic and regulated, and not merely dictated by the chemical kinetics between IgE and FceRI. As discussed in Section 7.1, the density of FceRI on basophils is related to the concentration of IgE in the blood (Malveaux et al., 1978). The meticulous research carried out by the groups of MacGlashan, Casale, and others on the effects of anti‐IgE on downregulating FceRI on basophils (Lin et al., 2004; MacGlashan et al., 1997), mast cells (Beck et al., 2004), and dendritic cells (Prussin et al., 2003) has provided insight into the dynamical relationship between IgE and FceRI. New molecules of FceRI are being synthesized and routed to the surface by basophils (used in most studies), and FceRI molecules on the cell surface are rerouted back (internalized) and degraded. On the cell surface, FceRI are occupied by IgE according to the kinetics of binding (Kd, kon, and koff) between IgE and FceRI. Statistically, when the IgE concentration is not limiting, a bare FceRI is occupied by IgE swiftly and does not stay
THERAPEUTIC ANTI-IgE ANTIBODIES
91
unoccupied for a long time. When the IgE concentration becomes limiting, a bare FceRI, which is freshly synthesized and routed to the cell surface or has lost its bound IgE through thermodynamic process, may not be reoccupied by IgE for a long time (MacGlashan et al., 1998, 1999). As a part of the mechanism evolved to regulate the concentration of FceRI on basophils, IgE‐occupied FceRI are stable and maintained on the surface. FceRI that are not occupied by IgE are structurally unstable and recognized and internalized for degradation (Kubo et al., 2001). Thus, as free IgE is reduced to under a certain concentration, the replenishment of newly synthesized FceRI does not compensate for the degradation of FceRI, resulting in a gradual loss of FceRI on the cell surface, until a balance between replenishment and degradation is reached. The kinetics of maintaining FceRI on basophils is further compounded by the fact that basophils have a life span of 12 weeks. As old basophils die, all FceRI are degraded; as new basophils are generated via the differentiation of precursor cells, FceRI are synthesized. However, if IgE concentration is very low, the synthesized FceRI on the newly generated basophils are not occupied and are degraded rapidly, leaving a low number of FceRI on the cell surface (MacGlashan, 2004). Unlike basophils, mast cells have a longer life span of several weeks to several months (Fodinger et al., 1994), hence the renewal process of these cells plays a lesser factor in the kinetics of FceRI maintenance on the cells (Borkowski et al., 2001). 8.2. Anti‐IgE as a Mast ‘‘Cell‐Stabilizing’’ Agent A subcutaneous injected anti‐IgE antibody (humanized IgG1) should diffuse into the vasculature and get dissipated via the blood circulation and distributed in various tissues in the body within a few days. On the basis of the high affinity of anti‐IgE for binding to IgE, if anti‐IgE is provided in large excess over the free IgE in a person, the free IgE will be reduced to more than 99% in hours or within 12 days (Corne et al., 1997). Such a depletion of free IgE should initiate the gradual loss of FceRI on basophils and mast cells via the molecular and cellular dynamics discussed in Section 8.1. FceRI on basophils are reportedly reduced by 70% in 2 weeks and by more than 97% in 3 months (Lin et al., 2004; MacGlashan et al., 1997). The downregulation of FceRI on mast cells follows slower kinetics. Nonetheless, mast cells in patients treated with anti‐ IgE gradually lose their sensitivity to allergen stimulation, as much higher amounts of allergen are required to induce a positive skin prick test (Beck et al., 2004). In the IgE‐mediated allergic pathway, mast cells are the major source of pharmacological mediators in various allergic responses, perhaps most vividly
92
TSE WEN CHANG ET AL.
displayed in the nasal linings, the lower airway, conjunctiva, and skin, as observed in allergic rhinitis, asthma, and atopic dermatitis. Thus, a general hyposensitization of mast cells by ‘‘mast cell‐stabilizing’’ agents (a somewhat imprecise term, for it assumes that the mast cells in the patients are unstable) has been an attractive therapeutic approach for decades. Since as early as in the 1970s, a class of molecules, known as cromones, including disodium cromoglycogate and sodium nedocromil, has been used clinically and being investigated to treat asthma, allergic rhinitis, and allergic conjunctivitis. Cromones have been shown to be able to retard the processes of exocytosis, degranulation, and lipid mediator synthesis induced by allergen‐initiated, FceRI‐mediated cascades (Edwards, 2005; Storms and Kaliner, 2005; van Cauwenberge et al., 2000). In a rough sense, the mast cells in an allergic patient are either too sensitive or undesirably too ‘‘potent.’’ Anti‐IgE, by depleting IgE, indirectly causes the loss of FceRI on these mast cells and renders them insensitive to stimulation by allergens. Cromones, which are generally mild in action, work by modulating the lipid membrane and slowing Ca2þ mobilization, which is required for the exocytotic process. Thus, cromones make mast cells impotent, while anti‐IgE renders them insensitive (Chang and Shiung, 2006). 8.3. How Low Should FceRI‐IgE Fall for a Mast Cell to Become Insensitive? In relating the density of allergen‐specific IgE‐occupied FceRI to the sensitivity of mast cells, one inevitably encounters the question whether there is a threshold of density of such receptors, which could be expressed in terms of a certain number per cell. In reality, there is no specific number, because the cells are exposed to a horde of factors, all of which contribute in large or small parts to determining the threshold level of allergen‐specific IgE‐occupied FceRI of a mast cell. On closer examination, among the various factors, the concentration of allergens in the fluid surrounding the mast cell (Section 7.1) is probably a dominant one. This factor is obviously highly variable among patients, as they are sensitized to different sets of allergens by different degrees. The amounts of allergens in the air or food also vary at different time points. Furthermore, the mast cells located in different mucosal areas in the body also receive different amounts of allergens. The quantification of threshold densities of allergen‐specific IgE‐occupied receptors has been approached in cell culture using a hapten‐specific monospecific IgE. In the estimation, when the concentration of allergens was not limited, a minimal number of 100200 FceRI–IgE complexes would be enough to sensitize a basophil (Maeyama et al., 1986; Posner et al., 2002). If allergen‐specific IgE accounts for 10% of the total IgE, a minimal of 10002000 FceRI molecules would be sufficient for the basophil to be sensitive to allergen
THERAPEUTIC ANTI-IgE ANTIBODIES
93
stimulation (MacGlashan et al., 1997). This would suggest that under the particular set of conditions, in which allergen‐specific IgE accounts for 10% of total IgE and allergen concentration is not limiting, the total IgE concentration in the particular patient must be reduced to below 0.8 IU/ml (based on Fig. 5). In an asthmatic patient with an average plasma IgE concentration of 300 IU/ml, this represents a 99.7% reduction of total IgE. It should be noted that this analysis accounts for steady state kinetics only, without considering the dynamic FceRI regulation on the cell. The above data might lead to the notion that the FceRI density must fall to very low levels for the basophils and mast cells to lose sensitivity in the patients treated with anti‐IgE. This notion may not be correct, because when the proportion of allergen‐specific IgE in total IgE is small and the concentration of allergens in the blood or particular mucosal areas is limiting, the density of allergen‐specific IgE‐charged FceRI on the basophils or mast cells may be near a threshold level, even though the total FceRI on these effector cells have not fallen to drastically low levels. 9. Potential Beneficial Effects of IgE:Anti‐IgE Immune Complexes The precipitous drop of FceRI on basophils and mast cells has provided a plausible, convincing explanation for the pharmacological effect of anti‐IgE in improving IgE‐mediated allergic symptoms. Indeed, as basophils and mast cells are rendered insensitive to allergen stimulation, the discharge of mediators by these cells on exposure to allergens will be retarded and hence manifestation of allergic symptoms greatly diminished. Can this FceRI downregulation effect provides the whole explanation for the pharmacological benefit of anti‐IgE? In Sections 9–11, we will discuss other potential pharmacological effects of anti‐IgE, which may also contribute to its therapeutic effects. 9.1. How Soon Can Clinical Improvement Be Observed? Understanding the kinetics of the course of symptom improvement on anti‐ IgE treatment is obviously very important for clinicians to apply such a treatment for allergic patients. It is also important to delineate the various pharmacological mechanisms that contribute to the therapeutic effects of anti‐ IgE. Although a large number of trials have been performed, there has not been a detailed analysis on the kinetics of improvement, especially in the initial weeks of anti‐IgE treatment. In the unpublished first Phase II trial of anti‐IgE, namely, the trial of CGP51901 on mountain cedar pollens caused allergic rhinitis in Central Texas in 19941995, weekly symptom severity scores were
94
TSE WEN CHANG ET AL.
obtained and plotted. This was possible because the trial design adopted a weekly injection schedule and allowed the study investigators to examine the trial patients on weekly time points. There was a significant drop in the overall severity score 1 week after the first injection of anti‐IgE. These results were consistent with the observations made in another clinical study on allergic rhinitis, in which patients were found to make reduced response to allergen challenge within 714 days after the initial treatment with omalizumab (Lin et al., 2004). A detailed analysis on how soon clinical symptoms improved in asthmatic patients treated with anti‐IgE was also performed, although the trial design provided mostly 4‐weekly data. It was found that among the patients who eventually responded to omalizumab, 61% in 4 weeks and 87% in 12 weeks showed significant improvement (Bousquet et al., 2004). In the case report of three patients with recalcitrant atopic dermatitis (Section 4.4), the patients responded favorably within 2 weeks of omalizumab treatment (Lane et al., 2006). In the case report of one patient with interstitial cystitis (Section 4.4), the patient improved immediately after the first anti‐IgE injection (Lee et al., 2006). In the case study of one patient with cold‐induced urticaria (Section 4.4), the patient improved after the second biweekly anti‐IgE injection (Boyce, 2006). It is possible that the molecular and cellular pharmacological mechanisms of anti‐IgE progress in a similar time frame in patients with allergic rhinitis, allergic asthma, or other IgE‐mediated allergic diseases. However, the broader involvement of inflammation and tissue damages in modest‐to‐severe asthma may take longer time to heal and to become clinically evident. It was found in the study by Lin et al. (2004) that 1 week after the subcutaneous injection of omalizumab, the basophils in the treated allergic rhinitis patients, who were sensitive to ragweed pollens, lost about 70% of the FceRI on cell surface. It is conceivable that the mast cells in the nasal lining of these patients should not have lost as much FceRI as basophils. However, a nasal antigen challenge test indicated that the allergic response in the nasal lining had already been attenuated at day 7, suggesting that the mast cells in the area had already been attenuated. Could the loss of less than 70% of FceRI on mast cells render those cells insensitive? One would reason that the observed 70% loss of FceRI should not be sufficient for the mast cells in the nasal lining of those patients to lose sensitivity to respond to inhaled allergens. The counts of pollen particles, such as those of ragweed and birch, per unit volume per day of air may rise 510 times in a 1‐week period during the pollen season of a plant type (information from daily pollen counts reported in metropolitan areas). If an allergic rhinitis patient already responds to the specific pollens and is symptomatic in the
THERAPEUTIC ANTI-IgE ANTIBODIES
95
beginning of the week, and fails to respond to the pollens at 510 times the concentration at the end of the week due to a treatment, the 70% drop in FceRI on those mast cells is not the likely mechanism accounting for the aforementioned attenuated allergic response. Chang (2000) presented a rational hypothesis that other pharmacological mechanisms contribute to the therapeutic effects of anti‐IgE, especially in the early stages of the treatment. 9.2. The Rapidly Accumulated Immune Complexes May Serve as Antigen Trappers The half‐life of IgE in humans is 12 days, that of anti‐IgE (a human IgG1) about 21 days, and that of anti‐IgE:IgE complexes about 20 days (Fig. 2; Fox et al., 1996; Lanier, 2003). The administration of anti‐IgE either subcutaneously or intravenously brings free IgE to near zero concentrations within a few days. However, the IgE‐secreting plasma cells, which are not targets of anti‐ IgE and have a life span of several months or longer, continue to secrete IgE (Section 10.1). This causes a rapid accumulation of anti‐IgE:IgE immune complexes to 5–10 times the baseline levels of IgE within a week (Corne et al., 1997; Milgrom et al., 2001). One IgE molecule has two antigenic sites for anti‐IgE and can be bound by two anti‐IgE molecules at the same time; one anti‐IgE molecule has two antigen‐binding arms and can bind to two IgE molecules at the same time. It is hence peculiar (and scientifically fascinating) that anti‐IgE and IgE form small complexes both in the test tubes and in the blood of patients treated with anti‐IgE, with the largest being a hexamer complex, formed by three anti‐IgE and three IgE molecules (Liu et al., 1995). The anti‐IgE:IgE complexes are soluble and do not precipitate in the kidney and do not cause immune complex problems (Fox et al., 1996). Both anti‐IgE (an IgG) and IgE are freely diffusible across the vascular capillaries and should equilibrate between the vascular and extravascular spaces. The immune complexes are stable, owing to the high binding affinity of anti‐IgE for IgE, cannot cross blood capillaries, and should remain in the blood circulation or local tissue sites, where they are formed. Thus, the anti‐ IgE:IgE immune complexes will be accumulated to high concentrations in the blood or in local tissue sites such as in the mucosal linings of the nasal passage and the lower airway. The IgE comprising the immune complexes have their antigen‐binding sites available for binding to antigens. Because the IgE can no longer bind to FceRI, it should function as a blocking, protective IgG. In this way, anti‐IgE converts potentially adverse, effector cell‐sensitizing IgE molecules into beneficial, antigen‐blocking IgE species. Thus, the rapidly accumulating immune complexes probably can serve as antigen‐sweeping agents. As the allergen molecules
96
TSE WEN CHANG ET AL.
break through the mucosal epithelia and get into the interstitial fluid on the basal side, they are bound by the immune complexes, before reaching to IgE bound by FceRI on mast cells residing in the area. While direct experimental evidence has yet to be obtained, it is a rational hypothesis that anti‐IgE:IgE immune complexes should contribute to the therapeutic effects of anti‐IgE within the first and second weeks after the first anti‐IgE injection. It remains a curious question as to whether on anti‐IgE treatment patients with high IgE levels fare better in the first 1 or 2 weeks than patients with much lower IgE levels. In the off‐label study of omalizumab on three patients with atopic dermatitis (Krathen and Hsu, 2005) discussed in Section 4.4, one of the patients had concomitant severe asthma and a baseline IgE level of 24,400 IU/ml. A regimen of 450 mg of omalizumab every 2 weeks for 4 months did not relieve her atopic dermatitis, but her asthma was significantly improved after starting omalizumab. It was estimated that the patient had a total of 290‐mg IgE in her body and synthesized 145‐mg IgE every 12 days. Clearly, dosing of anti‐IgE at 450 mg every other week cannot neutralize all of the IgE in her body. Also, even a 99.9% drop in total basal IgE would still leave 24 IU/ml, which is sufficient to charge and maintain normal levels of FceRI on basophils and mast cells. These numbers suggest that the patient’s asthma was improved by mechanisms other than the depletion of IgE and the downregulation of FceRI. Perhaps, the effect of immune complexes is one of those mechanisms. The immune complexes may possibly function in another aspect. The trapping of incoming allergens by the immune complexes should prevent the allergens from interacting with the mIgE expressed on mIgE‐committed B lymphoblasts and memory B cells. This neutralization of the antigen should inhibit allergen‐driven, IgE‐destined immune response (Hamelmann et al., 1997; Takhar et al., 2005) and hence have long‐term attenuating effects on allergic response. 10. Can Anti‐IgE Modulate IgE‐Committed B Lymphoblasts and Memory B Cell? One of the most intriguing issues that remain to be addressed definitively is whether anti‐IgE can modulate mIgE‐expressing B cells. This question is of great interest, because if anti‐IgE can inhibit mIgE‐committed B memory cells or B lymphoblasts, the generation of allergen‐specific IgE that is induced by the new exposure to allergens should be intercepted, resulting in a profound attenuation of the allergic pathway. Several lines of in vitro and animal model studies amply support that anti‐IgE can inhibit IgE production by B cells and cause the lysis of IgE‐expressing B cells (Davis et al., 1993; Haak‐Frendscho
THERAPEUTIC ANTI-IgE ANTIBODIES
97
et al., 1994). In a cell culture system, where human peripheral mononuclear cells were driven by IL‐4 and other factors to increase IgE‐committed B cells, so that the e chain mRNA expression and IgE production became measurable, anti‐IgE (CGP51901) inhibited the synthesis of e chain mRNA and IgE. In an in vivo mouse model, in which BALB/c mice were transplanted with cells of SE44 cell line (Sun et al., 1991), which was an NS0 myeloma that had been transfected with human e chain DNA and expressed human mIgE on surface, TESC‐21 (mouse MAb anti‐IgE, see Section 1.1) stopped SE44 tumor growth (Davis et al., 1993). Studies by other groups also showed in mice that endogenously produced syngeneic anti‐IgE antibodies could suppress IgE synthesis and decreased IgE‐secreting plaques, probably by eliminating IgE‐expressing B cells before they matured to plasma cells (Haba and Nisonoff, 1994). In contrast to the abundant results obtained in animal model and in vitro studies, similar potential effects of anti‐IgE have not been revealed resolutely in human patients. That mIgE is part of the B cell receptor on IgE‐committed B cells explains the in vitro and animal model results. Studies with IgM‐expressing B cells also demonstrate that anti‐IgM antibodies, in the absence of costimulatory factors, cause apoptosis (Chan et al., 1990; Mayumi et al., 1996) and mediated antibody‐dependent cell cytotoxicity (Walker et al., 1985) and complement‐ mediated cell lysis of the IgM‐expressing B cells (Caraux and Weigle, 1983a,b). The possible decrease of IgE synthesis has been difficult to observe in vivo in humans because the long‐living IgE‐secreting plasma cells, which express very low levels of mIgE and are not targets of anti‐IgE, in the bone marrow and other lymphoid tissues continue to secrete IgE (Shapiro‐Shelef and Calame, 2005). Thus, even if the generation of allergen‐specific mIgE‐expressing B cells and IgE‐secreting plasma cells is interrupted, the effect is masked by the production of total IgE. The inhibition or downregulation of mIgE‐expressing B cells by anti‐IgE is suggestive in some observations. In the case report of an interstitial cystitis patient treated with anti‐IgE (Lee et al., 2006; Section 4.4), the initial baseline total serum IgE concentration was 653 IU/ml. Seven months after the anti‐IgE treatment, the total IgE (the sum of IgE in immune complexes and free IgE) decreased to 168 IU/ml. This drop of IgE suggests that existing IgE‐secreting plasma cells were gradually dying off and new plasma cells were not replenished. In the clinical study of anti‐IgE on 225 pediatric patients with asthma, it was found that total IgE increased to multiples of baseline levels and then gradually declined after 16 weeks of anti‐IgE treatment (Berger et al., 2003). In another trial, a significant proportion of patients had IgE levels after 6 months of treatment lower than their baseline IgE levels before omalizumab (Lanier, 2006). These data indicate that at least in some patients, the
98
TSE WEN CHANG ET AL.
generation of new IgE‐secreting plasma cells appears to be inhibited (Infuhr et al., 2005). 11. Other Immunoregulatory Effects of Anti‐IgE 11.1. Anti‐IgE Should Neutralize the Cytokinergic Properties of IgE IgE is one of the five classes of antibodies. Its overall structure is very similar to that of antibodies from other classes and its antigen‐binding domains are from the pool of variable regions shared by other classes of antibodies. Its production is induced by exposure to antigens, albeit preferentially by parasitic worms (Capron et al., 1987) and a wide range of environmental antigens. The immunological mechanisms of IgE leading to the protective and pathological effects are initiated and aggravated by its interaction with the respective antigens. Thus, in almost all regards, IgE is a bona fide antibody class that has evolved to bear a set of immune defense functions. Aside from the ability to interact with antigens for initiating immunological processes, IgE has a characteristic that is strikingly different from those of the other antibody classes—it can bind to its receptor (FceRI) with very high affinity by itself without prior engagement with its antigen (Metzger et al., 1986). This binding to the receptor initiates an array of effects on mast cells without antigen participation, thus enabling IgE to function like a cytokine‐like substance and exhibit the following cytokinergic properties. Studies by several research groups have shown that IgE alone can initiate FceRI‐mediated signal‐transducing cascade (Kawakami and Kitaura, 2005), leading to Ca2þ influx (Lam et al., 2003; Pandey et al., 2004; Tanaka et al., 2005), histamine release, leukotriene synthesis and release, and synthesis of IL‐6 and other cytokines (Kalesnikoff et al., 2001; Kohno et al., 2005), although such activities are much less intense than those induced by allergens and IgE combined. As for the effects on the survival (Asai et al., 2001; Kalesnikoff et al., 2001; Kawakami and Galli, 2002), histamine content (Tanaka et al., 2002), and migratory activity of mast cells (Kitaura et al., 2005), IgE’s effect is no less than that of IgE‐allergen complexes. Thus, IgE by itself potentiates mast cells in inflammatory processes (Kawakami and Kitaura, 2005). Monoclonal IgE antibodies have been shown to be either highly or poorly cytokinergic. The difference appears to lie in the variable domains (Foote, 2003; James et al., 2003) and the molecular mechanisms concerning such a baffling difference remain to be elucidated. The native polyclonal IgE as a whole in a human body resembles highly cytokinergic IgE (Kitaura et al., 2003). By virtue of its ability to bind to IgE and block IgE binding to FceRI, anti‐IgE can impede the various cytokinergic activities of IgE, damping the inflammatory makeup in the immune system.
THERAPEUTIC ANTI-IgE ANTIBODIES
99
11.2. The Overall Attenuation of Immune Reactivity The IgE‐mediated allergic pathway, which generates mediators manifesting allergic symptoms, flames up the immune activities broadly in the local areas or systematically. The wide spectrum of cytokines, such as TNF‐a, interferon‐a, IL‐4, and IL‐5, and various chemokines, secreted by mast cells and basophils are inflammatory in nature. These factors not only cause symptoms directly but also activate and recruit various cell types augmenting the inflammatory state. Anti‐IgE, by tying up IgE, eventually attenuates the IgE‐ mediated pathway and hence the inflammatory conditions. Such an inhibitory effect can even be observed by the overall decrease of T and B cells in the immune system (Holgate et al., 2005b; Noga et al., 2003; Ong et al., 2005). CD23 on cell surface and soluble CD23 play multiple roles in regulating IgE synthesis and in inducing immune response to allergens. IgE:allergen complexes bind to membrane CD23 (via Fc of IgE) and facilitate antigen presentation (Getahun et al., 2005; Kilmon et al., 2004). Simultaneous binding of soluble CD23 to mIgE and CD21 on B cells will lead to the enhancement of IgE production (Aubry et al., 1992; Reljic et al., 1997). It has been found that in the gastrointestinal tract, CD23 on mucosal epithelial cells can transport IgE from the basal side to the lumen through transcytosis (Tu et al., 2005). This IgE in the lumen binds to food‐derived antigens and facilitates its entry across the mucosal epithelial layer (Li et al., 2006). Anti‐IgE blocks IgE binding to CD23 and hence inhibits many of these processes. The depletion of free IgE by anti‐IgE has a profound, fast effect on downregulating FceRI on dendritic cells (Prussin et al., 2003). Seven days after administrating anti‐IgE, the FceRI on both subsets of precursor dendritic cells were already decreased significantly (estimated 30–50%). This should inhibit the antigen‐presenting process going through IgE and dendritic cells (Kraft et al., 2001; Novak et al., 2003b). 11.3. Local Environment in Disease‐Affected Tissues is of Utmost Interest Much of our understanding on the dynamic interactions between IgE and anti‐IgE has been derived from studies analyzing such interactions in the blood. However, mast cells, which are key players in allergic rhinitis, asthma, dermatitis, reside in extravascular space in disease‐affected tissues (Brody and Metcalfe, 1998; Liu, 1997). It is believed that mast cells establish residency in specific locations and develop different sets of characteristics (Church and Levi‐Schaffer, 1997). It is conceivable that mast cells residing in the nasal lining, lower airway, other areas of the mucosal tracts, and in the skin, differ in tryptase and chymase content, sensitivity, receptor regulation, and life span (Chang and Shiung, 2006; Galli and Hammel, 1994; Irani and Schwartz, 1994;
100
TSE WEN CHANG ET AL.
Lowman et al., 1988; Miller and Schwartz, 1989; Peng et al., 2003). Interestingly, clinicians participating in the anti‐IgE clinical trials observed that the symptoms of allergic rhinitis or allergic asthma were improved much sooner than skin prick test reactivity (Beck et al., 2004). Are the mast cells in the airway and nasal mucosal linings different from those in the skin (Pawankar et al., 1997)? The local microenvironment in the allergic disease‐affected tissues is of great interest, awaiting vigorous investigation. Airborne allergen particles are trapped at the mucosal surfaces in the nasal lining and the bronchial tracts and the allergen molecules contained therein find ways to get through the mucosal epithelia to the basal side. Here the allergen molecules interact with many cell types, including mast cells, dendritic cells, and probably IgE‐ and IgG‐ committed lymphoblasts and memory B cells. It is now known that allergen‐ specific IgE‐secreting plasma cells in the local mucosa exist (KleinJan et al., 2000; Smurthwaite et al., 2001) and that allergen‐specific B cells are driven by allergens to switch to IgE‐expressing B cells and to undergo affinity maturation (class switch recombination) in situ in the mucosa (Coker et al., 2003; Tanaka et al., 2005; Wilson et al., 2002). The IgE secreted by those plasma cells in the local area can sensitize mast cells in the same site. On subcutaneous injection of anti‐IgE, the anti‐IgE molecules diffuse into the vascular space and are dissipated by the blood circulation. They diffuse into the local microenvironment of the affected tissues and bind to free IgE, forming immune complexes, which can no longer diffuse into the vascular space. Because the locally synthesized IgE may be rich in allergen‐specific IgE, the accumulated immune complexes should contain IgE that can help capture the incoming allergens (Section 9.2). 12. Can Anti‐IgE Attain a Long‐Term Remission State? The value and impact of the anti‐IgE therapy will be greatly expanded, if it can achieve a long‐term remission state at least in some of the treated patients. The clinical trials performed so far have not incorporated a study segment to address this aspect for a few considerations. A major concern among officials at governmental regulatory agencies and researchers developing the anti‐IgE program during the early phase of the clinical development of anti‐IgE was that the effect of anti‐IgE in depleting IgE is not reversible. Since the initial concept was to use anti‐IgE to target or deplete IgE‐expressing B cells and since IgE was believed to be required for certain immune defense functions such a concern was logical. Now that the depletion of IgE for 1 or 2 years is known not to pose great risks (Ayres et al., 2004; Berger et al., 2003; Finn et al., 2003; Lanier et al., 2003), we should address whether anti‐IgE can (1) have
THERAPEUTIC ANTI-IgE ANTIBODIES
101
long‐term effects on the functions of IgE and (2) attain long‐term remission state in the treated patients. Information concerning whether anti‐IgE can attain a long‐term remission state originates from anecdotal, nonsystematic observations made by clinicians treating asthma patients. Clearly, some patients appeared to have achieved remission state. However, there are no statistical data on the proportion of cases and the duration of such remission states. There is no information as to what makes an anti‐IgE treatment to achieve a remission state. Nonetheless, anti‐IgE, when used in chronic protracting allergic asthma, helps tame an inflammatory state and tune‐up or rebuild a healthy airway. If anti‐IgE can drive toward a remission state, it probably causes a shift in the balance between IgE‐mediated and non‐IgE‐mediated responses. Many pharmacological mechanisms of anti‐IgE should contribute to such a shift. Among them, potentially the most potent one is the modulation and downregulation of IgE‐committed B cells by anti‐IgE, as discussed in Section 10. In a patient, the generation of IgE‐committed allergen‐specific memory B cells is an important end result of the sensitization process that may take as long as a few years (Weissman and Lewis, 2002). Thus, if anti‐IgE can downregulate or eliminate IgE‐committed B memory cells, it should have very profound, long‐term attenuating effects on the state of sensitivity against allergens. When a patient is under anti‐IgE treatment, the IgE‐mediated allergic pathway is eventually blocked off and the numerous IgE‐related activities discussed in Sections 9–11 inhibited. Since the patient is exposed to allergens as usual, the allergens should induce other immune responses, such as protective IgG, against the allergens. These responses should gradually drive a shift in the balance between IgE versus non‐IgE‐related responses toward the non‐ IgE compartments. When a substantial shift is created, the patient should achieve a remission state. Along this line of rationalization (Chang, 2000), since the shift to favorable non‐IgE‐related responses may be induced by allergen‐ based immunotherapy (SIT or RIT, discussed in Section 5), a combination of anti‐IgE with SIT or RIT may help patients achieve long‐term remission state or even cure more effectively and safely than with SIT or RIT alone. 13. Are There Adverse Effects Associated with Anti‐IgE Therapy? 13.1. Is Immune Defense Function Compromised? It is a rational assumption that the IgE antibody class had evolved in a branch of the vertebrate species for immune defense (Warr et al., 1995). While there is not a large body of evidence in the literature supporting IgE’s roles in immune defense, a significant number of papers suffice to indicate that IgE contributes in part to the defense of various infectious agents, especially
102
TSE WEN CHANG ET AL.
parasitic worms, in many animal species. Because immunity against infectious agents is critical for the survival of many animal species, the immune system has evolved to be highly redundant, so that multiple immune mechanisms corroborate to defend against an invading infectious pathogen (Litman et al., 2005). Thus, IgE is probably still essential for animals and even humans living in primitive habitats. However, for humans living in many regions of the world today, or for pets, laboratory animals, even live stocks housed in relatively clean, confined facilities, IgE appears to have become nonessential (Lanier and Chang, 2004). This understanding is supported by the following research findings. The roles of IgE in immune defense, especially against parasitic worms, have been studied in various types of laboratory mice, including wild‐type ones producing normal ranges of IgE and biologically or genetically manipulated ones, which are devoid of either IgE or IgE‐mediated effector functions. In some studies, wild‐type mice were treated with anti‐IL‐4 antibody to abolish their ability to produce any IgE. In other studies (Madden et al., 1991; Sher et al., 1990), two strains of mice, which failed to produce any IgE, were employed: in one strain the gene for the IgE e chain was knocked out (Gurish et al., 2004; King et al., 1997), while in the other strain, the IL‐4 gene was impaired (El Ridi et al., 1998; Watanabe et al., 1988, 1993). Other studies used another strain of mice, in which the gene of the FceRIa subunit was knocked out (Jankovic et al., 1997), and IgE could not sensitize the mast cells and basophils in them. In another set of experiments, mice were treated with polyclonal antibodies that neutralize IgE (Amiri et al., 1994). Studies have been performed by a number of groups to investigate whether these mice incapable of producing IgE or devoid of FceRI were weakened in their ability to defend the challenges of various parasites, including Schistosoma masoni, Nippostrongylus brasiliensis, and Trichinella spiralis. The results as a whole were inconsistent and failed to prove that a lack of IgE pathways impairs the ability to eliminate parasites. One of the anti‐IgE clinical trials on asthma, which was carried out in Brazil, had monitored parasite infection as part of the study protocol. No increased rate of parasite infection was observed. The question, whether IgE is involved in the immune surveillance of malignantly transformed cells and whether anti‐IgE compromises such a function, had been raised. On the basis of the numbers of malignancies identified during the anti‐IgE treatment period, it was cautioned that an apparent increase of malignancy incidences was found in the anti‐IgE‐treated population (Strunk and Bloomberg, 2006). Since the overall rate was within the range found in the general population, and the malignancies found in these mostly older allergy patients were of heterogeneous tissue origins, governmental regulatory agencies
THERAPEUTIC ANTI-IgE ANTIBODIES
103
did not sound an alarm for such a concern, but required that a multiyear postmarket follow‐up be performed. 13.2. Observed Adverse Reactions Aside from the concern that anti‐IgE may compromise certain immune functions, anti‐IgE is well tolerated and causes relatively few serious adverse effects (Strunk and Bloomberg, 2006). The various symptoms of discomfort, such as fever, headache, injection site rashes, are common for a subcutaneous injectable and for an antibody drug, since the rates of these complications were similar in patients receiving anti‐IgE treatment or placebo. There have been a few cases of anaphylactic reactions among patients with very sensitive disposition and complex, multiple diseases. Anti‐IgE may still benefit those highly sensitive patients, but caution must be taken while administering the drug (Dreyfus and Randolph, 2006). There has been no report of immune complex diseases or serum sickness disease. Omalizumab was found not to induce antibody response against itself. 14. Other Approaches for Targeting IgE or IgE‐Expressing B Cells 14.1. Approaches for Attenuating IgE‐Mediated Allergic Pathway Various therapeutic approaches have been developed to modulate the immune system to inhibit IgE synthesis, to inhibit TH2 response, or to drive a shift from TH2 to TH1 response (Stokes and Casale, 2004). These include anti‐IL‐4, anti‐IL‐5, and IL‐4 and IL‐5 receptor antagonists (Barnes, 2002; Kips et al., 2001; Yamagata and Ichinose, 2006). These immune modulators appear to be very attractive agents for attenuating the IgE‐mediated pathway and of the TH2 arm. However, the results from clinical studies are not satisfactory in terms of their abilities to alleviate clinical symptoms. Anti‐CD23 has also been studied in human clinical studies and been shown to downregulate blood IgE levels by 50% (Nakamura et al., 2000; Rosenwasser et al., 2003). The initial assessment was that anti‐CD23 probably cannot improve clinical symptoms (Poole et al., 2005). The ineffectiveness of these various approaches may be due to their inability to downregulate IgE to a great extent. On the basis of the results of anti‐IgE on neutralizing IgE and on downregulating FceRI on basophils and mast cells, for most patients with IgE concentrations above 10 IU/ml, if the IgE concentration is not reduced by more than 95% or 99%, downregulation of FceRI would not result. Since anti‐IL‐4‐treated and IL‐4 gene knocked out mice do not produce any IgE (Watanabe et al., 1988), why can anti‐IL‐4 and soluble IL‐4
104
TSE WEN CHANG ET AL.
receptor not lower IgE to near zero levels (Borish et al., 2001; Hart et al., 2002)? One plausible explanation is the fact that IL‐4 acts at very low concentrations in short distances in the lymphoid microenvironment (de Vries et al., 1993) and therefore, it requires very large amounts of anti‐IL‐4 to flush the local microenvironments. 14.2. An Approach to Target a Unique Epitope on mIgE The many molecular attributes of anti‐IgE, such as having a long half‐life, forming small immune complexes, not inducing antibody response, and multiple proven and potential pharmacological mechanisms, are very difficult to attain with another therapeutic. However, anti‐IgE is expensive and will probably not be affordable for most patients with very high IgE (Ames et al., 2004) such as those with plasma IgE higher than 1000 IU/ml. Therefore, an approach that can target IgE‐committed B cells directly and inhibit the synthesis of IgE substantially will be very desirable (Chang et al., 1990). IgE‐committed B lymphoblasts and memory B cells express mIgE. IgE‐ expressing B lymphoblasts are in the differentiation and maturation process to become IgE‐producing plasma B cells. In addition, mIgE is not expressed in other cell types. Thus, mIgE appears to be an ideal target for immunological agents that aim at modulating mIgE‐expressing B cells. Our group had made a seemingly unlikely discovery (Peng et al., 1992) that the e chain of human mIgE contains a 52‐amino acid peptide segment (referred to as the CemX domain) between the CH4 domain and the C‐terminal membrane‐anchoring transmembrane peptide (Fig. 7). Using mouse membrane e chain as a reference, CemX is resulted from an alternative splicing using an acceptor site 156‐ base pairs upstream of the previous known site. In human mIgE, e chains without CemX, while faintly expressed at the mRNA level, are not detectable at the protein level (Peng et al., 1992). The sequence of CemX shares no significant homology with sequences in the entire DNA and protein databases. Thus, the uniqueness of CemX has provided an attractive site for targeting mIgE and mIgE‐expressing B cells. Because mIgE is part of the B cell receptor, antibodies targeting mIgE should activate signal‐tranducing process, leading to the anergization or apoptotic pathway of those cells, in the absence of costimulators (Donjerkovic and Scott, 2000; Gauld et al., 2005; Tighe et al., 1997). Mouse anti‐CemX MAbs, such as a20, have been prepared (Chen et al., 2002) and are in the process of being humanized in our laboratory. It is possible that anti‐CemX antibodies can be used in combination with anti‐IgE for treating patients with very high IgE. The potential advantage of an anti‐CemX antibody is that because the antibodies are not neutralized by IgE, a much smaller amount of the
THERAPEUTIC ANTI-IgE ANTIBODIES
105
mlgE
s s
Anti-lgE omalizumab TNX-901
s s GLAGGSAQSQ RAPDRVLCHS GQQQGLPRAA GGSVPHPRCH CGAGRADWPG PP
Anti-Cε mX Cε mX Plasm
a mem
brane
Cytopla B cell
sm
Figure 7 The location and sequence of CemX domain in mIgE. The antigenic sites targeted by anti‐IgE MAbs, such as omalizumab and TNX‐901, and by anti‐CemX MAbs, such as a20, are indicated.
antibody will be required for each administration. If IgE‐committed B cells are indeed purged by the anti‐CemX antibody, the new synthesis of allergen‐ specific IgE will be interrupted, resulting in a long‐term attenuating effect on the sensitization state of patients. Perhaps after a decade of use of anti‐IgE, the concern over long‐term depletion of IgE will subside, and a therapeutic approach for developing a vaccine‐like product based on the CemX peptide should become attractive. The CemX peptide can be linked to a T cell reactive foreign peptide and used as an immunogen to elicit in patients antibodies that, like the passively administered anti‐CemX antibodies, bind to mIgE and modulate mIgE‐expressing B cells. Such a treatment will not require large amounts of the immunogen product and may have long‐term effects on suppressing IgE production.
106
TSE WEN CHANG ET AL.
15. Concluding Remarks The clinical utility of omalizumab for pediatric asthma, allergic rhinitis, peanut allergy, atopic dermatitis, and others, and for combining with SIT and RIT will probably take another 5–10 years to develop for most regions of the world. The therapeutic efficacy exhibited by omalizumab and TNX‐901 in about 30 Phase II and III clinical trials amply demonstrates that IgE plays significant roles in the pathogenesis of not only allergic rhinitis but also allergic asthma, peanut allergy, and probably atopic dermatitis. The clinical trial results also establish that IgE depletion is a feasible strategy for treating various IgE‐mediated allergic diseases. Furthermore, the results from anti‐IgE and from other experimental drugs, such as anti‐IL‐5 and anti‐CD23, also reveal that the IgE depletion should be nearly complete and should last for a long term, at least several months. The successful development of anti‐IgE has provided a treatment option for many patients with difficult‐to‐treat allergic asthma and in the future, anti‐IgE may also provide a treatment option for patients with other IgE‐mediated allergic diseases that are severe and difficult to treat. Anti‐IgE will not be an affordable treatment option for most patients in economically less developed countries. The yearly requirement of omalizumab for an asthma patient is about 2–8 g, which represents substantial production costs. Even with such sizable quantities, they are only suitable for those patients whose serum IgE levels are less than 700 IU/ml. About 10–15% of patients have IgE levels above 700 IU/ml. Thus, for economically less fortunate patients and those with high IgE, including most atopic dermatitis patients, a rather different thinking in providing anti‐IgE or and on the understanding of the diseases must be stimulated. It should be noted that while excluding patients with IgE above 700 IU/ml had a rationale basis, excluding patients with IgE below 30 IU/ml did not have sound basis (Lanier, 2006). As long as their allergic diseases are IgE‐mediated, those patients should respond to anti‐IgE well. While many researchers have unraveled multiple intriguing pharmacological effects of anti‐IgE, we still fall short in elucidating definitively the pharmacological mechanisms responsible for the therapeutic efficacy of anti‐IgE. While the downregulation of FceRI antibodies on basophils and mast cells has been established, numerous other pharmacological mechanisms, as outlined herein (Sections 9–12) have not yet been convincingly validated. These other mechanisms very likely play important roles, especially in the first few weeks, before the downregulation of FceRI has reached physiologically significant levels. Among many of the questions that remain to be resolved regarding the pharmacological effects and therapeutic efficacy of anti‐IgE is whether anti‐ IgE can modulate or inhibit IgE‐committed B lymphoblasts and memory B cells.
THERAPEUTIC ANTI-IgE ANTIBODIES
107
Such an effect is critical for anti‐IgE to (1) intercept the new synthesis of allergen‐ specific IgE, (2) cause a decisive shift from TH2 to TH1 conditions, and hence (3) achieve a long‐term effect on attenuating IgE‐mediated diseases. In this aspect, different patients may respond differently. Also, different anti‐IgE antibodies, such as omalizumab and TNX‐901, may act differently. In this regard, the development of an anti‐IgE antibody with an affinity much higher (by say 100‐ fold) than omalizumab and TNX‐901 will be of great interest. Thus, while applications based on the anti‐IgE concept has been in active development for nearly 20 years, much research is needed to address the many questions posed herein. Acknowledgments Supported by grant no. 94–2320‐B007–004 from the National Science Council, Taiwan.
References Adelroth, E., Rak, S., Haahtela, T., Aasand, G., Rosenhall, L., Zetterstrom, O., Byrne, A., Champain, K., Thirlwell, J., Cioppa, G. D., and Sandstrom, T. (2000). Recombinant humanized mAb‐ E25, an anti‐IgE mAb, in birch pollen‐induced seasonal allergic rhinitis. J. Allergy Clin. Immunol. 106, 253–259. Ames, S. A., Gleeson, C. D., and Kirkpatrick, P. (2004). Omalizumab. Nat. Rev. Drug. Discov. 3, 199–200. Amiri, P., Haak‐Frendscho, M., Robbins, K., McKerrow, J. H., Stewart, T., and Jardieu, P. (1994). Anti‐immunoglobulin E treatment decreases worm burden and egg production in Schistosoma mansoni‐infected normal and interferon gamma knockout mice. J. Exp. Med. 180, 43–51. Asai, K., Kitaura, J., Kawakami, Y., Yamagata, N., Tsai, M., Carbone, D. P., Liu, F. T., Galli, S. J., and Kawakami, T. (2001). Regulation of mast cell survival by IgE. Immunity 14, 791–800. Asher, M. I., Montefort, S., Bjorksten, B., Lai, C. K., Strachan, D. P., Weiland, S. K., and Williams, H. (2006). Worldwide time trends in the prevalence of symptoms of asthma, allergic rhinoconjunctivitis, and eczema in childhood: ISAAC Phases One and Three repeat multicountry cross‐ sectional surveys. Lancet 368, 733–743. Aubry, J. P., Pochon, S., Graber, P., Jansen, K. U., and Bonnefoy, J. Y. (1992). CD21 is a ligand for CD23 and regulates IgE production. Nature 358, 505–507. Ayres, J. G., Higgins, B., Chilvers, E. R., Ayre, G., Blogg, M., and Fox, H. (2004). Efficacy and tolerability of anti‐immunoglobulin E therapy with omalizumab in patients with poorly controlled (moderate‐to‐severe) allergic asthma. Allergy 59, 701–708. Barnes, P. J. (2002). Cytokine modulators as novel therapies for asthma. Annu. Rev. Pharmacol. Toxicol. 42, 81–98. Barnes, P. J. (2004). New drugs for asthma. Nat. Rev. Drug Discov. 3, 831–844. Baur, X. (1979). Studies on the specificity of human IgE‐antibodies to the plant proteases papain and bromelain. Clin. Allergy 9, 451–457. Beck, L. A., and Leung, D. Y. (2000). Allergen sensitization through the skin induces systemic allergic responses. J. Allergy Clin. Immunol. 106, S258–S263.
108
TSE WEN CHANG ET AL.
Beck, L. A., Marcotte, G. V., MacGlashan, D., Togias, A., and Saini, S. (2004). Omalizumab‐ induced reductions in mast cell Fce psilon RI expression and function. J. Allergy Clin. Immunol. 114, 527–530. Berger, W., Gupta, N., McAlary, M., and Fowler‐Taylor, A. (2003). Evaluation of long‐term safety of the anti‐IgE antibody, omalizumab, in children with allergic asthma. Ann. Allergy Asthma Immunol. 91, 182–188. Bernstein, D. I. (1997). Allergic reactions to workplace allergens. JAMA 278, 1907–1913. Bernstein, D. I., Wanner, M., Borish, L., and Liss, G. M. (2004). Twelve‐year survey of fatal reactions to allergen injections and skin testing: 1990–2001. J. Allergy Clin. Immunol. 113, 1129–1136. Bez, C., Schubert, R., Kopp, M., Ersfeld, Y., Rosewich, M., Kuehr, J., Kamin, W., Berg, A. V., Wahu, U., and Zielen, S. (2004). Effect of anti‐immunoglobulin E on nasal inflammation in patients with seasonal allergic rhinoconjunctivitis. Clin. Exp. Allergy 34, 1079–1085. Bich‐Thuy, L. T., Banchereau, J., and Revillard, J. P. (1984). Suppression of polyclonal human B cell activation by IgG binding factors: Interference with the maturation of Ig‐containing cells into Ig‐secreting cells. Cell. Immunol. 87, 231–239. Bingham, C. O.,III, and Austen, K. F. (2000). Mast‐cell responses in the development of asthma. J. Allergy Clin. Immunol. 105, S527–S534. Bodtger, U., Poulsen, L. K., and Linneberg, A. (2006). Rhinitis symptoms and IgE sensitization as risk factors for development of later allergic rhinitis in adults. Allergy 61, 712–716. Borchers, A. T., Keen, C. L., and Gershwin, M. E. (2004). Fatalities following allergen immunotherapy. Clin. Rev. Allergy Immunol. 27, 147–158. Borish, L., Chipps, B., Deniz, Y., Gujrathi, S., Zheng, B., and Dolan, C. M. (2005). Total serum IgE levels in a large cohort of patients with severe or difficult‐to‐treat asthma. Ann. Allergy Asthma Immunol. 95, 247–253. Borish, L. C., Nelson, H. S., Corren, J., Bensch, G., Busse, W. W., Whitmore, J. B., and Agosti, J. M. (2001). Efficacy of soluble IL‐4 receptor for the treatment of adults with asthma. J. Allergy Clin. Immunol. 107, 963–970. Borkowski, T. A., Jouvin, M. H., Lin, S. Y., and Kinet, J. P. (2001). Minimal requirements for IgE‐ mediated regulation of surface Fc epsilon RI. J. Immunol. 167, 1290–1296. Boulet, L. P., Turcotte, H., Laprise, C., Lavertu, C., Bedard, P. M., Lavoie, A., and Hebert, J. (1997). Comparative degree and type of sensitization to common indoor and outdoor allergens in subjects with allergic rhinitis and/or asthma. Clin. Exp. Allergy 27, 52–59. Bousquet, J., Becker, W. M., Hejjaoui, A., Chanal, I., Lebel, B., Dhivert, H., and Michel, F. B. (1991). Differences in clinical and immunologic reactivity of patients allergic to grass pollens and to multiple‐pollen species. II. Efficacy of a double‐blind, placebo‐controlled, specific immunotherapy with standardized extracts. J. Allergy Clin. Immunol. 88, 43–53. Bousquet, J., Wenzel, S., Holgate, S., Lumry, W., Freeman, P., and Fox, H. (2004). Predicting response to omalizumab, an anti‐IgE antibody, in patients with allergic asthma. Chest 125, 1378–1386. Bousquet, J., Cabrera, P., Berkman, N., Buhl, R., Holgate, S., Wenzel, S., Fox, H., Hedgecock, S., Blogg, M., and Cioppa, G. D. (2005). The effect of treatment with omalizumab, an anti‐IgE antibody, on asthma exacerbations and emergency medical visits in patients with severe persistent asthma. Allergy 60, 302–308. Boyce, J. A. (2006). Successful treatment of cold‐induced urticaria/anaphylaxis with anti‐IgE. J. Allergy Clin. Immunol. 117, 1415–1418. Braunstahl, G. J. (2005). The unified immune system: Respiratory tract‐nasobronchial interaction mechanisms in allergic airway disease. J. Allergy Clin. Immunol. 115, 142–148.
THERAPEUTIC ANTI-IgE ANTIBODIES
109
Brody, D., and Metcalfe, D. D. (1998). Mast cells: A unique and functional diversity. Clin. Exp. Allergy 28, 1167–1170. Buhl, R., Hanf, G., Soler, M., Bensch, G., Wolfe, J., Everhard, F., Champain, K., Fox, H., and Thirlwell, J. (2002). The anti‐IgE antibody omalizumab improves asthma‐related quality of life in patients with allergic asthma. Eur. Respir. J. 20, 1088–1094. Burrows, B., Martinez, F. D., Halonen, M., Barbee, R. A., and Cline, M. G. (1989). Association of asthma with serum IgE levels and skin‐test reactivity to allergens. N. Engl. J. Med. 320, 271–277. Busse, W. W. (2001). Anti‐immunoglobulin E (omalizumab) therapy in allergic asthma. Am. J. Respir. Crit. Care Med. 164, S12–S17. Capron, A., and Dessaint, J. P. (1992). Immunologic aspects of schistosomiasis. Annu. Rev. Med. 43, 209–218. Capron, M., and Capron, A. (1994). Immunoglobulin E and effector cells in schistosomiasis. Science 264, 1876–1877. Capron, A., Dessaint, J. P., Capron, M., Ouma, J. H., and Butterworth, A. E. (1987). Immunity to schistosomes: Progress toward vaccine. Science 238, 1065–1072. Caraux, J., and Weigle, W. O. (1983a). Anti‐idiotype antibody‐dependent cell‐mediated cytotoxicity (ADCC) against idiotype‐bearing cells. Cell. Immunol. 78, 23–32. Caraux, J., and Weigle, W. O. (1983b). Surface immunoglobulins as targets for anti‐immunoglobulin‐ dependent cell‐mediated lysis of B cells. Cell. Immunol. 76, 372–378. Carlsen, K. H. (2004). Therapeutic strategies for allergic airways diseases. Paediatr. Respir. Rev. 5, 45–51. Casale, T. B. (2001). Anti‐immunoglobulin E (omalizumab) therapy in seasonal allergic rhinitis. Am. J. Respir. Crit. Care Med. 164, S18–S21. Casale, T. B., Bernstein, I. L., Busse, W. W., LaForce, C. F., Tinkelman, D. G., Stoltz, R. R., Dockhorn, R. J., Reimann, J., Su, J. Q., Fick, R. B., Jr., and Adelman, D. C. (1997). Use of an anti‐IgE humanized monoclonal antibody in ragweed‐induced allergic rhinitis. J. Allergy Clin. Immunol. 100, 110–121. Casale, T. B., Condemi, J., LaForce, C., Nayak, A., Rowe, M., Watrous, M., McAlary, M., Fowler‐ Taylor, A., Racine, A., Gupta, N., Fick, R., and Della Cioppa, G. (2001). Effect of omalizumab on symptoms of seasonal allergic rhinitis: A randomized controlled trial. JAMA 286, 2956–2967. Casale, T. B., Busse, W. W., Kline, J. N., Ballas, Z. K., Moss, M. H., Townley, R. G., Mokhtarani, M., Seyfert‐Margolis, V., Asare, A., Bateman, K., and Deniz, Y. (2006). Omalizumab pretreatment decreases acute reactions after rush immunotherapy for ragweed‐induced seasonal allergic rhinitis. J. Allergy Clin. Immunol. 117, 134–140. Chan, C. S., Soehnlen, F., and Schechter, G. P. (1990). Differential response of malignant human B‐cells to anti‐IgM immunoglobulin (anti‐mu) and B‐cell growth factor: Unique direct cytotoxicity of anti‐mu on prolymphocytic leukemia cells. Blood 76, 1601–1606. Chang, T. W. (2000). The pharmacological basis of anti‐IgE therapy. Nat. Biotechnol. 18, 157–162. Chang, T. W. (2006). Developing antibodies for targeting immunoglobulin and membrane‐bound immunoglobulin E. Allergy Asthma Proc. 27, S7–S14. Chang, T. W., and Shiung, Y. Y. (2006). Anti‐IgE as a mast cell‐stabilizing therapeutic agent. J. Allergy Clin. Immunol. 117, 1203–1212. Chang, T. W., Kung, P. C., Gingras, S. P., and Goldstein, G. (1981). Does OKT3 monoclonal antibody react with an antigen‐recognition structure on human T cells? Proc. Natl. Acad. Sci. USA 78, 1805–1808. Chang, T. W., Davis, F. M., Sun, N. C., Sun, C. R., MacGlashan, D. W., Jr., and Hamilton, R. G. (1990). Monoclonal antibodies specific for human IgE‐producing B cells: A potential therapeutic for IgE‐mediated allergic diseases. Biotechnology (NY) 8, 122–126.
110
TSE WEN CHANG ET AL.
Chen, H. Y., Liu, F. T., Hou, C. M., Huang, J. S., Sharma, B. B., and Chang, T. W. (2002). Monoclonal antibodies against the C(epsilon)mX domain of human membrane‐bound IgE and their potential use for targeting IgE‐expressing B cells. Int. Arch. Allergy Immunol. 128, 315–324. Church, M. K., and Levi‐Schaffer, F. (1997). The human mast cell. J. Allergy Clin. Immunol. 99, 155–160. Coker, H. A., Durham, S. R., and Gould, H. J. (2003). Local somatic hypermutation and class switch recombination in the nasal mucosa of allergic rhinitis patients. J. Immunol. 171, 5602–5610. Conroy, M. C., Adkinson, N. F., Jr., and Lichtenstein, L. M. (1977). Measurement of IgE on human basophils: Relation to serum IgE and anti‐IgE‐induced histamine release. J. Immunol. 118, 1317–1321. Cookson, W. (1999). The alliance of genes and environment in asthma and allergy. Nature 402, B5–B11. Corne, J., Djukanovic, R., Thomas, L., Warner, J., Botta, L., Grandordy, B., Gygax, D., Heusser, C., Patalano, F., Richardson, W., Kilchherr, E., Staehelin, T., et al. (1997). The effect of intravenous administration of a chimeric anti‐IgE antibody on serum IgE levels in atopic subjects: Efficacy, safety, and pharmacokinetics. J. Clin. Invest. 99, 879–887. Davis, F. M., Gossett, L. A., Pinkston, K. L., Liou, R. S., Sun, L. K., Kim, Y. W., Chang, N. T., Chang, T. W., Wagner, K., Bews, J., Brinkmann, V., Towbin, H., et al. (1993). Can anti‐IgE be used to treat allergy? Springer Semin. Immunopathol. 15, 51–73. DeFranco, A. L. (1993). Structure and function of the B cell antigen receptor. Annu. Rev. Cell Biol. 9, 377–410. de Vries, J. E., Punnonen, J., Cocks, B. G., de Waal Malefyt, R., and Aversa, G. (1993). Regulation of the human IgE response by IL4 and IL13. Res. Immunol. 144, 597–601. Donjerkovic, D., and Scott, D. W. (2000). Activation‐induced cell death in B lymphocytes. Cell Res. 10, 179–192. Dreyfus, D. H., and Randolph, C. C. (2006). Characterization of an anaphylactoid reaction to omalizumab. Ann. Allergy Asthma Immunol. 96, 624–627. Ebo, D. G., and Stevens, W. J. (2002). IgE‐mediated natural rubber latex allergy: Practical considerations for health care workers. Ann. Allergy Asthma Immunol. 88, 568–575. Edwards, A. M. (2005). The discovery of cromolyn sodium and its effect on research and practice in allergy and immunology. J. Allergy Clin. Immunol. 115, 885–888. Eigenmann, P. A., Sicherer, S. H., Borkowski, T. A., Cohen, B. A., and Sampson, H. A. (1998). Prevalence of IgE‐mediated food allergy among children with atopic dermatitis. Pediatrics 101, 8–13. El Ridi, R., Ozaki, T., and Kamiya, H. (1998). Schistosoma mansoni infection in IgE‐producing and IgE‐deficient mice. J. Parasitol. 84, 171–174. Fahy, J. V., Fleming, H. E., Wong, H. H., Liu, J. T., Su, J. Q., Reimann, J., Fick, R. B., Jr., and Boushey, H. A. (1997). The effect of an anti‐IgE monoclonal antibody on the early‐ and late‐ phase responses to allergen inhalation in asthmatic subjects. Am. J. Respir. Crit. Care Med. 155, 1828–1834. Finn, A., Gross, G., van Bavel, J., Lee, T., Windom, H., Everhard, F., Fowler‐Taylor, A., Liu, J., and Gupta, N. (2003). Omalizumab improves asthma‐related quality of life in patients with severe allergic asthma. J. Allergy Clin. Immunol. 111, 278–284. Fish, J. E. (2002). Occupational asthma and rhinoconjunctivitis induced by natural rubber latex exposure. J. Allergy Clin. Immunol. 110, S75–S81. Fodinger, M., Fritsch, G., Winkler, K., Emminger, W., Mitterbauer, G., Gadner, H., Valent, P., and Mannhalter, C. (1994). Origin of human mast cells: Development from transplanted hematopoietic stem cells after allogeneic bone marrow transplantation. Blood 84, 2954–2959.
THERAPEUTIC ANTI-IgE ANTIBODIES
111
Foote, J. (2003). Immunology. Isomeric antibodies. Science 299, 1327–1328. Fox, J. A., Hotaling, T. E., Struble, C., Ruppel, J., Bates, D. J., and Schoenhoff, M. B. (1996). Tissue distribution and complex formation with IgE of an anti‐IgE antibody after intravenous administration in cynomolgus monkeys. J. Pharmacol. Exp. Ther. 279, 1000–1008. Galli, S. J., and Hammel, I. (1994). Mast cell and basophil development. Curr. Opin. Hematol. 1, 33–39. Garman, S. C., Kinet, J. P., and Jardetzky, T. S. (1998). Crystal structure of the human high‐affinity IgE receptor. Cell 95, 951–961. Garman, S. C., Wurzburg, B. A., Tarchevskaya, S. S., Kinet, J. P., and Jardetzky, T. S. (2000). Structure of the Fc fragment of human IgE bound to its high‐affinity receptor Fc epsilonRI alpha. Nature 406, 259–266. Gauld, S. B., Benschop, R. J., Merrell, K. T., and Cambier, J. C. (2005). Maintenance of B cell anergy requires constant antigen receptor occupancy and signaling. Nat. Immunol. 6, 1160–1167. Getahun, A., Hjelm, F., and Heyman, B. (2005). IgE enhances antibody and T cell responses in vivo via CD23þ B cells. J. Immunol. 175, 1473–1482. Gold, D. R., and Wright, R. (2005). Population disparities in asthma. Annu. Rev. Public Health 26, 89–113. Gould, H. J., Sutton, B. J., Beavil, A. J., Beavil, R. L., McCloskey, N., Coker, H. A., Fear, D., and Smurthwaite, L. (2003). The biology of IGE and the basis of allergic disease. Annu. Rev. Immunol. 21, 579–628. Greineder, D. K. (1996). Risk management in allergen immunotherapy. J. Allergy Clin. Immunol. 98, S330–S334. Gurish, M. F., Bryce, P. J., Tao, H., Kisselgof, A. B., Thornton, E. M., Miller, H. R., Friend, D. S., and Oettgen, H. C. (2004). IgE enhances parasite clearance and regulates mast cell responses in mice infected with Trichinella spiralis. J. Immunol. 172, 1139–1145. Haak‐Frendscho, M., Robbins, K., Lyon, R., Shields, R., Hooley, J., Schoenhoff, M., and Jardieu, P. (1994). Administration of an anti‐IgE antibody inhibits CD23 expression and IgE production in vivo. Immunology 82, 306–313. Haba, S., and Nisonoff, A. (1990). Inhibition of IgE synthesis by anti‐IgE: Role in long‐term inhibition of IgE synthesis by neonatally administered soluble IgE. Proc. Natl. Acad. Sci. USA 87, 3363–3367. Haba, S., and Nisonoff, A. (1994). Effects of syngeneic anti‐IgE antibodies on the development of IgE memory and on the secondary IgE response. J. Immunol. 152, 51–57. Hamelmann, E., Oshiba, A., Schwarze, J., Bradley, K., Loader, J., Larsen, G. L., and Gelfand, E. W. (1997). Allergen‐specific IgE and IL‐5 are essential for the development of airway hyperresponsiveness. Am. J. Respir. Cell Mol. Biol. 16, 674–682. Hart, T. K., Blackburn, M. N., Brigham‐Burke, M., Dede, K., Al‐Mahdi, N., Zia‐Amirhosseini, P., and Cook, R. M. (2002). Preclinical efficacy and safety of pascolizumab (SB 240683): A humanized anti‐interleukin‐4 antibody with therapeutic potential in asthma. Clin. Exp. Immunol. 130, 93–100. Heaney, L. G., and Robinson, D. S. (2005). Severe asthma treatment: Need for characterising patients. Lancet 365, 974–976. Hibbert, R. G., Teriete, P., Grundy, G. J., Beavil, R. L., Reljic, R., Holers, V. M., Hannan, J. P., Sutton, B. J., Gould, H. J., and McDonnell, J. M. (2005). The structure of human CD23 and its interactions with IgE and CD21. J. Exp. Med. 202, 751–760. Holgate, S., Casale, T., Wenzel, S., Bousquet, J., Deniz, Y., and Reisner, C. (2005a). The anti‐ inflammatory effects of omalizumab confirm the central role of IgE in allergic inflammation. J. Allergy Clin. Immunol. 115, 459–465.
112
TSE WEN CHANG ET AL.
Holgate, S. T., Djukanovic, R., Casale, T., and Bousquet, J. (2005b). Anti‐immunoglobulin E treatment with omalizumab in allergic diseases: An update on anti‐inflammatory activity and clinical efficacy. Clin. Exp. Allergy 35, 408–416. Hoover, R. G., and Lynch, R. G. (1983). Isotype‐specific suppression of IgA: Suppression of IgA responses in BALB/c mice by T alpha cells. J. Immunol. 130, 521–523. Hoskins, G., McCowan, C., Neville, R. G., Thomas, G. E., Smith, B., and Silverman, S. (2000). Risk factors and costs associated with an asthma attack. Thorax 55, 19–24. Humbert, M., Beasley, R., Ayres, J., Slavin, R., Hebert, J., Bousquet, J., Beeh, K. M., Ramos, S., Canonica, G. W., Hedgecock, S., Fox, H., Blogg, M., et al. (2005). Benefits of omalizumab as add‐on therapy in patients with severe persistent asthma who are inadequately controlled despite best available therapy (GINA 2002 step 4 treatment): INNOVATE. Allergy 60, 309–316. Infuhr, D., Crameri, R., Lamers, R., and Achatz, G. (2005). Molecular and cellular targets of anti‐ IgE antibodies. Allergy 60, 977–985. Irani, A. M., and Schwartz, L. B. (1994). Human mast cell heterogeneity. Allergy Proc. 15, 303–308. Ishizaka, K., and Ishizaka, T. (1967). Identification of gamma‐E‐antibodies as a carrier of reaginic activity. J. Immunol. 99, 1187–1198. Ishizaka, T., Conrad, D. H., Schulman, E. S., Sterk, A. R., Ko, C. G., and Ishizaka, K. (1984). IgE‐ mediated triggering signals for mediator release from human mast cells and basophils. Fed. Proc. 43, 2840–2845. Isolauri, E., Huurre, A., Salminen, S., and Impivaara, O. (2004). The allergy epidemic extends beyond the past few decades. Clin. Exp. Allergy 34, 1007–1010. James, L. C., Roversi, P., and Tawfik, D. S. (2003). Antibody multispecificity mediated by conformational diversity. Science 299, 1362–1367. Janeway, C. A., Jr., Travers, P., Walport, M., and Shlomchik, M. J. (2005). ‘‘Immunobiology: The Immune System in Health and Disease.’’ Garland Science Publishing, New York. Jankovic, D., Kullberg, M. C., Dombrowicz, D., Barbieri, S., Caspar, P., Wynn, T. A., Paul, W. E., Cheever, A. W., Kinet, J. P., and Sher, A. (1997). Fc epsilonRI‐deficient mice infected with Schistosoma mansoni mount normal Th2‐type responses while displaying enhanced liver pathology. J. Immunol. 159, 1868–1875. Johansson, S. G. (1967). Raised levels of a new immunoglobulin class (IgND) in asthma. Lancet 2, 951–953. Kalesnikoff, J., Huber, M., Lam, V., Damen, J. E., Zhang, J., Siraganian, R. P., and Krystal, G. (2001). Monomeric IgE stimulates signaling pathways in mast cells that lead to cytokine production and cell survival. Immunity 14, 801–811. Kasaian, M. T., Meyer, C. H., Nault, A. K., and Bond, J. F. (1995). An increased frequency of IgE‐ producing B cell precursors contributes to the elevated levels of plasma IgE in atopic subjects. Clin. Exp. Allergy 25, 749–755. Kawakami, T., and Galli, S. J. (2002). Regulation of mast‐cell and basophil function and survival by IgE. Nat. Rev. Immunol. 2, 773–786. Kawakami, T., and Kitaura, J. (2005). Mast cell survival and activation by IgE in the absence of antigen: A consideration of the biologic mechanisms and relevance. J. Immunol. 175, 4167–4173. Keown, M. B., Ghirlando, R., Mackay, G. A., Sutton, B. J., and Gould, H. J. (1997). Basis of the 1:1 stoichiometry of the high affinity receptor Fc epsilon RI‐IgE complex. Eur. Biophys. J. 25, 471–476. Kilmon, M. A., Shelburne, A. E., Chan‐Li, Y., Holmes, K. L., and Conrad, D. H. (2004). CD23 trimers are preassociated on the cell surface even in the absence of its ligand, IgE. J. Immunol. 172, 1065–1073.
THERAPEUTIC ANTI-IgE ANTIBODIES
113
Kinet, J. P. (1999). The high‐affinity IgE receptor (Fc epsilon RI): From physiology to pathology. Annu. Rev. Immunol. 17, 931–972. King, C. L., Xianli, J., Malhotra, I., Liu, S., Mahmoud, A. A., and Oettgen, H. C. (1997). Mice with a targeted deletion of the IgE gene have increased worm burdens and reduced granulomatous inflammation following primary infection with Schistosoma mansoni. J. Immunol. 158, 294–300. King, T. P., and Spangfort, M. D. (2000). Structure and biology of stinging insect venom allergens. Int. Arch. Allergy Immunol. 123, 99–106. Kips, J. C., Tournoy, K. G., and Pauwels, R. A. (2001). New anti‐asthma therapies: Suppression of the effect of interleukin (IL)‐4 and IL‐5. Eur. Respir. J. 17, 499–506. Kitaura, J., Song, J., Tsai, M., Asai, K., Maeda‐Yamamoto, M., Mocsai, A., Kawakami, Y., Liu, F. T., Lowell, C. A., Barisas, B. G., Galli, S. J., and Kawakami, T. (2003). Evidence that IgE molecules mediate a spectrum of effects on mast cell survival and activation via aggregation of the FcepsilonRI. Proc. Natl. Acad. Sci. USA 100, 12911–12916. Kitaura, J., Kinoshita, T., Matsumoto, M., Chung, S., Kawakami, Y., Leitges, M., Wu, D., Lowell, C. A., and Kawakami, T. (2005). IgE and IgEþ Ag‐mediated mast cell migration in an autocrine/paracrine fashion. Blood 105, 3222–3229. KleinJan, A., Vinke, J. G., Severijnen, L. W., and Fokkens, W. J. (2000). Local production and detection of (specific) IgE in nasal B‐cells and plasma cells of allergic rhinitis patients. Eur. Respir. J. 15, 491–497. Kohno, M., Yamasaki, S., Tybulewicz, V. L., and Saito, T. (2005). Rapid and large amount of autocrine IL‐3 production is responsible for mast cell survival by IgE in the absence of antigen. Blood 105, 2059–2065. Kolbinger, F., Saldanha, J., Hardman, N., and Bendig, M. M. (1993). Humanization of a mouse anti‐human IgE antibody: A potential therapeutic for IgE‐mediated allergies. Protein Eng. 6, 971–980. Kopp, M. V., Mayatepek, E., Engels, E., Brauburger, J., Riedinger, F., Ihorst, G., Wahn, U., and Kuehr, J. (2003). Urinary leukotriene E4 levels in children with allergic rhinitis treated with specific immunotherapy and anti‐IgE (Omalizumab). Pediatr. Allergy Immunol. 14, 401–404. Kraft, S., Katoh, N., Novak, N., Koch, S., and Bieber, T. (2001). Unexpected functions of FcepsilonRI on antigen‐presenting cells. Int. Arch. Allergy Immunol. 124, 35–37. Krathen, R. A., and Hsu, S. (2005). Failure of omalizumab for treatment of severe adult atopic dermatitis. J. Am. Acad. Dermatol. 53, 338–340. Kubo, S., Matsuoka, K., Taya, C., Kitamura, F., Takai, T., Yonekawa, H., and Karasuyama, H. (2001). Drastic up‐regulation of Fcepsilonri on mast cells is induced by IgE binding through stabilization and accumulation of Fcepsilonri on the cell surface. J. Immunol. 167, 3427–3434. Kuehr, J., Brauburger, J., Zielen, S., Schauer, U., Kamin, W., Von Berg, A., Leupold, W., Bergmann, K. C., Rolinck‐Werninghaus, C., Grave, M., Hultsch, T., and Wahn, U. (2002). Efficacy of combination treatment with anti‐IgE plus specific immunotherapy in polysensitized children and adolescents with seasonal allergic rhinitis. J. Allergy Clin. Immunol. 109, 274–280. Kussin, P. S., and Fulkerson, W. J. (1995). The rising tide of asthma. Trends in the epidemiology of morbidity and mortality from asthma. Respir. Care Clin. North Am. 1, 163–175. Lam, V., Kalesnikoff, J., Lee, C. W., Hernandez‐Hansen, V., Wilson, B. S., Oliver, J. M., and Krystal, G. (2003). IgE alone stimulates mast cell adhesion to fibronectin via pathways similar to those used by IgEþ antigen but distinct from those used by Steel factor. Blood 102, 1405–1413. Lane, J. E., Cheyney, J. M., Lane, T. N., Kent, D. E., and Cohen, D. J. (2006). Treatment of recalcitrant atopic dermatitis with omalizumab. J. Am. Acad. Dermatol. 54, 68–72. Lanier, B. (2006). Unanswered clinical questions and speculation about the role of anti‐ immunoglobulin E in atopic and nonatopic disease. Allergy Asthma Proc. 27, S37–S42.
114
TSE WEN CHANG ET AL.
Lanier, B. Q. (2003). Newer aspects in the treatment of pediatric and adult asthma: Monoclonal anti‐IgE. Ann. Allergy Asthma Immunol. 90, 13–15. Lanier, B. Q., and Chang, T. W. (2004). Will anti‐IgE therapy compromise normal immune functions? Allergy Clin. Immunol. Int.: J. World Allergy Org. 16, 237–240. Lanier, B. Q., Corren, J., Lumry, W., Liu, J., Fowler‐Taylor, A., and Gupta, N. (2003). Omalizumab is effective in the long‐term control of severe allergic asthma. Ann. Allergy Asthma Immunol. 91, 154–159. Laske, N., Bunikowski, R., and Niggemann, B. (2003). Extraordinarily high serum IgE levels and consequences for atopic phenotypes. Ann. Allergy Asthma Immunol. 91, 202–204. Lee, J., Doggweiler‐Wiygul, R., Kim, S., Hill, B. D., and Yoo, T. J. (2006). Is interstitial cystitis an allergic disorder? A case of interstitial cystitis treated successfully with anti‐IgE. Int. J. Urol. 13, 631–634. Lemanske, R. F., Jr., Nayak, A., McAlary, M., Everhard, F., Fowler‐Taylor, A., and Gupta, N. (2002). Omalizumab improves asthma‐related quality of life in children with allergic asthma. Pediatrics 110, 55–59. Lemiere, C., Cartier, A., Dolovich, J., and Malo, J. L. (1996). Isolated late asthmatic reaction after exposure to a high‐molecular‐weight occupational agent, subtilisin. Chest 110, 823–824. Leung, D. Y. (1993). Role of IgE in atopic dermatitis. Curr. Opin. Immunol. 5, 956–962. Leung, D. Y., and Soter, N. A. (2001). Cellular and immunologic mechanisms in atopic dermatitis. J. Am. Acad. Dermatol. 44, S1–S12. Leung, D. Y., Sampson, H. A., Yunginger, J. W., Burks, A. W., Jr., Schneider, L. C., Wortel, C. H., Davis, F. M., Hyun, J. D., and Shanahan, W. R., Jr. (2003). Effect of anti‐IgE therapy in patients with peanut allergy. N. Engl. J. Med. 348, 986–993. Lewis, R. A., and Austen, K. F. (1981). Mediation of local homeostasis and inflammation by leukotrienes and other mast cell‐dependent compounds. Nature 293, 103–108. Leynadier, F., Doudou, O., Gaouar, H., Le Gros, V., Bourdeix, I., Guyomarch‐Cocco, L., and Trunet, P. (2004). Effect of omalizumab in health care workers with occupational latex allergy. J. Allergy Clin. Immunol. 113, 360–361. Leynaert, B., Bousquet, J., Neukirch, C., Liard, R., and Neukirch, F. (1999). Perennial rhinitis: An independent risk factor for asthma in nonatopic subjects: Results from the European Community Respiratory Health Survey. J. Allergy Clin. Immunol. 104, 301–304. Li, H., Nowak‐Wegrzyn, A., Charlop‐Powers, Z., Shreffler, W., Chehade, M., Thomas, S., Roda, G., Dahan, S., Sperber, K., and Berin, M. C. (2006). Transcytosis of IgE‐antigen complexes by CD23a in human intestinal epithelial cells and its role in food allergy. Gastroenterology 131, 47–58. Limb, S. L., Brown, K. C., Wood, R. A., Eggleston, P. A., Hamilton, R. G., and Adkinson, N. F., Jr. (2006). Long‐term immunologic effects of broad‐spectrum aeroallergen immunotherapy. Int. Arch. Allergy Immunol. 140, 245–251. Lin, H., Boesel, K. M., Griffith, D. T., Prussin, C., Foster, B., Romero, F. A., Townley, R., and Casale, T. B. (2004). Omalizumab rapidly decreases nasal allergic response and FcepsilonRI on basophils. J. Allergy Clin. Immunol. 113, 297–302. Litman, G. W., Cannon, J. P., and Dishaw, L. J. (2005). Reconstructing immune phylogeny: New perspectives. Nat. Rev. Immunol. 5, 866–879. Liu, F. T. (1997). Truly MASTerful cells: Mast cells command B cell IgE synthesis. J. Clin. Invest. 99, 1465–1466. Liu, J., Lester, P., Builder, S., and Shire, S. J. (1995). Characterization of complex formation by humanized anti‐IgE monoclonal antibody and monoclonal human IgE. Biochemistry 34, 10474–10482.
THERAPEUTIC ANTI-IgE ANTIBODIES
115
Lowman, M. A., Rees, P. H., Benyon, R. C., and Church, M. K. (1988). Human mast cell heterogeneity: Histamine release from mast cells dispersed from skin, lung, adenoids, tonsils, and colon in response to IgE‐dependent and nonimmunologic stimuli. J. Allergy Clin. Immunol. 81, 590–597. MacGlashan, D. (2004). Loss of receptors and IgE in vivo during treatment with anti‐IgE antibody. J. Allergy Clin. Immunol. 114, 1472–1474. MacGlashan, D. W., Jr., Bochner, B. S., Adelman, D. C., Jardieu, P. M., Togias, A., McKenzie‐White, J., Sterbinsky, S. A., Hamilton, R. G., and Lichtenstein, L. M. (1997). Down‐regulation of Fc (epsilon)RI expression on human basophils during in vivo treatment of atopic patients with anti‐IgE antibody. J. Immunol. 158, 1438–1445. MacGlashan, D., Jr., McKenzie‐White, J., Chichester, K., Bochner, B. S., Davis, F. M., Schroeder, J. T., and Lichtenstein, L. M. (1998). In vitro regulation of FcepsilonRIalpha expression on human basophils by IgE antibody. Blood 91, 1633–1643. MacGlashan, D., Jr., Lichtenstein, L. M., McKenzie‐White, J., Chichester, K., Henry, A. J., Sutton, B. J., and Gould, H. J. (1999). Upregulation of FcepsilonRI on human basophils by IgE antibody is mediated by interaction of IgE with FcepsilonRI. J. Allergy Clin. Immunol. 104, 492–498. Madden, K. B., Urban, J. F., Jr., Ziltener, H. J., Schrader, J. W., Finkelman, F. D., and Katona, I. M. (1991). Antibodies to IL‐3 and IL‐4 suppress helminth‐induced intestinal mastocytosis. J. Immunol. 147, 1387–1391. Maeyama, K., Hohman, R. J., Metzger, H., and Beaven, M. A. (1986). Quantitative relationships between aggregation of IgE receptors, generation of intracellular signals, and histamine secretion in rat basophilic leukemia (2H3) cells. Enhanced responses with heavy water. J. Biol. Chem. 261, 2583–2592. Malveaux, F. J., Conroy, M. C., Adkinson, N. F., Jr., and Lichtenstein, L. M. (1978). IgE receptors on human basophils. Relationship to serum IgE concentration. J. Clin. Invest. 62, 176–181. Manz, R. A., Hauser, A. E., Hiepe, F., and Radbruch, A. (2005). Maintenance of serum antibody levels. Annu. Rev. Immunol. 23, 367–386. Mayumi, M., Sumimoto, S., Kanazashi, S., Hata, D., Yamaoka, K., Higaki, Y., Ishigami, T., Kim, K. M., Heike, T., and Katamura, K. (1996). Negative signaling in B cells by surface immunoglobulins. J. Allergy Clin. Immunol. 98, S238–S247. Menz, G., Ying, S., Durham, S. R., Corrigan, C. J., Robinson, D. S., Hamid, Q., Pfister, R., Humbert, M., and Kay, A. B. (1998). Molecular concepts of IgE‐initiated inflammation in atopic and nonatopic asthma. Allergy 53, 15–21. Metzger, H., Goetze, A., Kanellopoulos, J., Holowka, D., and Fewtrell, C. (1982). Structure of the high‐affinity mast cell receptor for IgE. Fed. Proc. 41, 8–11. Metzger, H., Alcaraz, G., Hohman, R., Kinet, J. P., Pribluda, V., and Quarto, R. (1986). The receptor with high affinity for immunoglobulin E. Annu. Rev. Immunol. 4, 419–470. Milgrom, H. (2004). Anti‐IgE therapy in children with asthma. Minerva Pediatr. 56, 469–479. Milgrom, H., Berger, W., Nayak, A., Gupta, N., Pollard, S., McAlary, M., Taylor, A. F., and Rohane, P. (2001). Treatment of childhood asthma with anti‐immunoglobulin E antibody (omalizumab). Pediatrics 108, 36–45. Miller, J. S., and Schwartz, L. B. (1989). Human mast cell proteases and mast cell heterogeneity. Curr. Opin. Immunol. 1, 637–642. Mimura, T., Amano, S., Funatsu, H., Yamagami, S., Araie, M., Kaji, Y., Arimoto, A., Ishida, Y., Usui, T., and Okamoto, S. (2004). Correlations between allergen‐specific IgE serum levels in patients with allergic conjunctivitis in spring. Ocul. Immunol. Inflamm. 12, 45–51. Nakamura, T., Kloetzer, W. S., Brams, P., Hariharan, K., Chamat, S., Cao, X., LaBarre, M. J., Chinn, P. C., Morena, R. A., Shestowsky, W. S., Li, Y. P., Chen, A., et al. (2000). In vitro IgE
116
TSE WEN CHANG ET AL.
inhibition in B cells by anti‐CD23 monoclonal antibodies is functionally dependent on the immunoglobulin Fc domain. Int. J. Immunopharmacol. 22, 131–141. Nayak, A., Casale, T., Miller, S. D., Condemi, J., McAlary, M., Fowler‐Taylor, A., Della Cioppa, G., and Gupta, N. (2003). Tolerability of retreatment with omalizumab, a recombinant humanized monoclonal anti‐IgE antibody, during a second ragweed pollen season in patients with seasonal allergic rhinitis. Allergy Asthma Proc. 24, 323–329. Nelson, H. S. (2003). Advances in upper airway diseases and allergen immunotherapy. J. Allergy Clin. Immunol. 111, S793–S798. Niiro, H., and Clark, E. A. (2002). Regulation of B‐cell fate by antigen‐receptor signals. Nat. Rev. Immunol. 2, 945–956. Noga, O., Hanf, G., and Kunkel, G. (2003). Immunological and clinical changes in allergic asthmatics following treatment with omalizumab. Int. Arch. Allergy Immunol. 131, 46–52. Novak, N., and Bieber, T. (2003). Allergic and nonallergic forms of atopic diseases. J. Allergy Clin. Immunol. 112, 252–262. Novak, N., Bieber, T., and Leung, D. Y. (2003a). Immune mechanisms leading to atopic dermatitis. J. Allergy Clin. Immunol. 112, S128–S139. Novak, N., Kraft, S., and Bieber, T. (2003b). Unraveling the mission of FcepsilonRI on antigen‐ presenting cells. J. Allergy Clin. Immunol. 111, 38–44. Oba, Y., and Salzman, G. A. (2004). Cost‐effectiveness analysis of omalizumab in adults and adolescents with moderate‐to‐severe allergic asthma. J. Allergy Clin. Immunol. 114, 265–269. Oettgen, H. C., and Geha, R. S. (1999). IgE in asthma and atopy: Cellular and molecular connections. J. Clin. Invest. 104, 829–835. Oettgen, H. C., and Geha, R. S. (2001). IgE regulation and roles in asthma pathogenesis. J. Allergy Clin. Immunol. 107, 429–440. Ong, Y. E., Menzies‐Gow, A., Barkans, J., Benyahia, F., Ou, T. T., Ying, S., and Kay, A. B. (2005). Anti‐IgE (omalizumab) inhibits late‐phase reactions and inflammatory cells after repeat skin allergen challenge. J. Allergy Clin. Immunol. 116, 558–564. Pandey, V., Mihara, S., Fensome‐Green, A., Bolsover, S., and Cockcroft, S. (2004). Monomeric IgE stimulates NFAT translocation into the nucleus, a rise in cytosol Ca2þ, degranulation, and membrane ruffling in the cultured rat basophilic leukemia‐2H3 mast cell line. J. Immunol. 172, 4048–4058. Parks, K. W., and Casale, T. B. (2006). Anti‐immunoglobulin E monoclonal antibody administered with immunotherapy. Allergy Asthma Proc. 27, S33–S36. Pawankar, R., Okuda, M., Yssel, H., Okumura, K., and Ra, C. (1997). Nasal mast cells in perennial allergic rhinitics exhibit increased expression of the Fc epsilonRI, CD40L, IL‐4, and IL‐13, and can induce IgE synthesis in B cells. J. Clin. Invest. 99, 1492–1499. Peng, C., Davis, F. M., Sun, L. K., Liou, R. S., Kim, Y. W., and Chang, T. W. (1992). A new isoform of human membrane‐bound IgE. J. Immunol. 148, 129–136. Peng, Q., McEuen, A. R., Benyon, R. C., and Walls, A. F. (2003). The heterogeneity of mast cell tryptase from human lung and skin. Eur. J. Biochem. 270, 270–283. Poole, J. A., Meng, J., Reff, M., Spellman, M. C., and Rosenwasser, L. J. (2005). Anti‐CD23 monoclonal antibody, lumiliximab, inhibited allergen‐induced responses in antigen‐presenting cells and T cells from atopic subjects. J. Allergy Clin. Immunol. 116, 780–788. Posner, R. G., Savage, P. B., Peters, A. S., Macias, A., DelGado, J., Zwartz, G., Sklar, L. A., and Hlavacek, W. S. (2002). A quantitative approach for studying IgE‐FcepsilonRI aggregation. Mol. Immunol. 38, 1221–1228. Presta, L. G., Lahr, S. J., Shields, R. L., Porter, J. P., Gorman, C. M., Fendly, B. M., and Jardieu, P. M. (1993). Humanization of an antibody directed against IgE. J. Immunol. 151, 2623–2632. Prickman, L. E. (1951). Allergic asthma. Minn. Med. 34, 755–756.
THERAPEUTIC ANTI-IgE ANTIBODIES
117
Pritchard, D. I. (1993). Immunity to helminths: Is too much IgE parasite—rather than host‐ protective? Parasite Immunol. 15, 5–9. Prussin, C., Griffith, D. T., Boesel, K. M., Lin, H., Foster, B., and Casale, T. B. (2003). Omalizumab treatment downregulates dendritic cell FcepsilonRI expression. J. Allergy Clin. Immunol. 112, 1147–1154. Pruzansky, J. J., and Patterson, R. (1988). Limiting concentrations of human basophil‐bound IgE antibody required for histamine release. Immunology 64, 307–310. Racine‐Poon, A., Botta, L., Chang, T. W., Davis, F. M., Gygax, D., Liou, R. S., Rohane, P., Staehelin, T., van Steijn, A. M., and Frank, W. (1997). Efficacy, pharmacodynamics, and pharmacokinetics of CGP 51901, an anti‐immunoglobulin E chimeric monoclonal antibody, in patients with seasonal allergic rhinitis. Clin. Pharmacol. Ther. 62, 675–690. Razin, E., Mencia‐Huerta, J. M., Stevens, R. L., Lewis, R. A., Liu, F. T., Corey, E., and Austen, K. F. (1983). IgE‐mediated release of leukotriene C4, chondroitin sulfate E proteoglycan, beta‐ hexosaminidase, and histamine from cultured bone marrow‐derived mouse mast cells. J. Exp. Med. 157, 189–201. Reljic, R., Cosentino, G., and Gould, H. J. (1997). Function of CD23 in the response of human B cells to antigen. Eur. J. Immunol. 27, 572–575. Rolinck‐Werninghaus, C., Hamelmann, E., Keil, T., Kulig, M., Koetz, K., Gerstner, B., Kuehr, J., Zielen, S., Schauer, U., Kamin, W., Von Berg, A., Hammermann, J., et al. (2004). The co‐seasonal application of anti‐IgE after preseasonal specific immunotherapy decreases ocular and nasal symptom scores and rescue medication use in grass pollen allergic children. Allergy 59, 973–979. Rosenwasser, L. J., Busse, W. W., Lizambri, R. G., Olejnik, T. A., and Totoritis, M. C. (2003). Allergic asthma and an anti‐CD23 mAb (IDEC‐152): Results of a phase I, single‐dose, dose‐ escalating clinical trial. J. Allergy Clin. Immunol. 112, 563–570. Ross, R. N., Nelson, H. S., and Finegold, I. (2000). Effectiveness of specific immunotherapy in the treatment of hymenoptera venom hypersensitivity: A meta‐analysis. Clin. Ther. 22, 351–358. Sabra, A., Bellanti, J. A., Rais, J. M., Castro, H. J., de Inocencio, J. M., and Sabra, S. (2003). IgE and non‐IgE food allergy. Ann. Allergy Asthma Immunol. 90, 71–76. Schafer, T., and Przybilla, B. (1996). IgE antibodies to Hymenoptera venoms in the serum are common in the general population and are related to indications of atopy. Allergy 51, 372–377. Schoenwetter, W. F. (2000). Allergic rhinitis: Epidemiology and natural history. Allergy Asthma Proc. 21, 1–6. Serafin, W. E., and Austen, K. F. (1987). Mediators of immediate hypersensitivity reactions. N. Engl. J. Med. 317, 30–34. Shapiro‐Shelef, M., and Calame, K. (2005). Regulation of plasma‐cell development. Nat. Rev. Immunol. 5, 230–242. Sharkey, P., and Portnoy, J. (1996). Rush immunotherapy: Experience with a one‐day schedule. Ann. Allergy Asthma Immunol. 76, 175–180. Shehade, S. A., Layton, G. T., and Stanworth, D. R. (1988). IgG4 and IgE antibodies in atopic dermatitis and urticaria. Clin. Exp. Dermatol. 13, 393–396. Sher, A., Coffman, R. L., Hieny, S., and Cheever, A. W. (1990). Ablation of eosinophil and IgE responses with anti‐IL‐5 or anti‐IL‐4 antibodies fails to affect immunity against Schistosoma mansoni in the mouse. J. Immunol. 145, 3911–3916. Sicherer, S. H., and Leung, D. Y. (2005). Advances in allergic skin disease, anaphylaxis, and hypersensitivity reactions to foods, drugs, and insects. J. Allergy Clin. Immunol. 116, 153–163. Skolnick, H. S., Conover‐Walker, M. K., Koerner, C. B., Sampson, H. A., Burks, W., and Wood, R. A. (2001). The natural history of peanut allergy. J. Allergy Clin. Immunol. 107, 367–374.
118
TSE WEN CHANG ET AL.
Smurthwaite, L., Walker, S. N., Wilson, D. R., Birch, D. S., Merrett, T. G., Durham, S. R., and Gould, H. J. (2001). Persistent IgE synthesis in the nasal mucosa of hay fever patients. Eur. J. Immunol. 31, 3422–3431. Soler, M., Matz, J., Townley, R., Buhl, R., O’Brien, J., Fox, H., Thirlwell, J., Gupta, N., and Della Cioppa, G. (2001). The anti‐IgE antibody omalizumab reduces exacerbations and steroid requirement in allergic asthmatics. Eur. Respir. J. 18, 254–261. Somos, S., Schneider, I., and Farkas, B. (2001). Immunoglobulins in tears and sera in patients with atopic dermatitis. Allergy Asthma Proc. 22, 81–86. Stokes, J., and Casale, T. B. (2004). Rationale for new treatments aimed at IgE immunomodulation. Ann. Allergy Asthma Immunol. 93, 212–217. Storms, W., and Kaliner, M. A. (2005). Cromolyn sodium: Fitting an old friend into current asthma treatment. J. Asthma 42, 79–89. Strunk, R. C., and Bloomberg, G. R. (2006). Omalizumab for asthma. N. Engl. J. Med. 354, 2689–2695. Sun, L. K., Liou, R. S., Sun, N. C., Gossett, L. A., Sun, C., Davis, F. M., MacGlashan, D. W., Jr., and Chang, T. W. (1991). Transfectomas expressing both secreted and membrane‐bound forms of chimeric IgE with anti‐viral specificity. J. Immunol. 146, 199–205. Sussman, G. L., Beezhold, D. H., and Kurup, V. P. (2002). Allergens and natural rubber proteins. J. Allergy Clin. Immunol. 110, S33–S39. Takhar, P., Smurthwaite, L., Coker, H. A., Fear, D. J., Banfield, G. K., Carr, V. A., Durham, S. R., and Gould, H. J. (2005). Allergen drives class switching to IgE in the nasal mucosa in allergic rhinitis. J. Immunol. 174, 5024–5032. Tanaka, S., Takasu, Y., Mikura, S., Satoh, N., and Ichikawa, A. (2002). Antigen‐independent induction of histamine synthesis by immunoglobulin E in mouse bone marrow‐derived mast cells. J. Exp. Med. 196, 229–235. Tanaka, S., Mikura, S., Hashimoto, E., Sugimoto, Y., and Ichikawa, A. (2005). Ca2þ influx‐mediated histamine synthesis and IL‐6 release in mast cells activated by monomeric IgE. Eur. J. Immunol. 35, 460–468. Tighe, H., Warnatz, K., Brinson, D., Corr, M., Weigle, W. O., Baird, S. M., and Carson, D. A. (1997). Peripheral deletion of rheumatoid factor B cells after abortive activation by IgG. Proc. Natl. Acad. Sci. USA 94, 646–651. Till, S. J., Francis, J. N., Nouri‐Aria, K., and Durham, S. R. (2004). Mechanisms of immunotherapy. J. Allergy Clin. Immunol. 113, 1025–1034. Tschopp, J. M., Sistek, D., Schindler, C., Leuenberger, P., Perruchoud, A. P., Wuthrich, B., Brutsche, M., Zellweger, J. P., Karrer, W., and Brandli, O. (1998). Current allergic asthma and rhinitis: Diagnostic efficiency of three commonly used atopic markers (IgE, skin prick tests, and Phadiatop). Results from 8329 randomized adults from the SAPALDIA Study. Swiss Study on Air Pollution and Lung Diseases in Adults. Allergy 53, 608–613. Tu, Y., Salim, S., Bourgeois, J., Di Leo, V., Irvine, E. J., Marshall, J. K., and Perdue, M. H. (2005). CD23‐mediated IgE transport across human intestinal epithelium: Inhibition by blocking sites of translation or binding. Gastroenterology 129, 928–940. van Cauwenberge, P., Bachert, C., Passalacqua, G., Bousquet, J., Canonica, G. W., Durham, S. R., Fokkens, W. J., Howarth, P. H., Lund, V., Malling, H. J., Mygind, N., Passali, D., et al. (2000). Consensus statement on the treatment of allergic rhinitis. European Academy of Allergology and Clinical Immunology. Allergy 55, 116–134. Vignola, A. M., Humbert, M., Bousquet, J., Boulet, L. P., Hedgecock, S., Blogg, M., Fox, H., and Surrey, K. (2004). Efficacy and tolerability of anti‐immunoglobulin E therapy with omalizumab in patients with concomitant allergic asthma and persistent allergic rhinitis: SOLAR. Allergy 59, 709–717.
THERAPEUTIC ANTI-IgE ANTIBODIES
119
Vigo, P. G., Girgis, K. R., Pfuetze, B. L., Critchlow, M. E., Fisher, J., and Hussain, I. (2006). Efficacy of anti‐IgE therapy in patients with atopic dermatitis. J. Am. Acad. Dermatol. 55, 168–170. Walker, K. Z., Boux, H. A., Hayden, G. E., Goodnow, C. C., and Raison, R. L. (1985). A monoclonal antibody with selectivity for human kappa myeloma and lymphoma cells which has potential as a therapeutic agent. Adv. Exp. Med. Biol. 186, 833–841. Wan, T., Beavil, R. L., Fabiane, S. M., Beavil, A. J., Sohi, M. K., Keown, M., Young, R. J., Henry, A. J., Owens, R. J., Gould, H. J., and Sutton, B. J. (2002). The crystal structure of IgE Fc reveals an asymmetrically bent conformation. Nat. Immunol. 3, 681–686. Warr, G. W., Magor, K. E., and Higgins, D. A. (1995). IgY: Clues to the origins of modern antibodies. Immunol. Today 16, 392–398. Wasserman, S. I. (1989). Mast cell‐mediated inflammation in asthma. Ann. Allergy 63, 546–550. Watanabe, N., Katakura, K., Kobayashi, A., Okumura, K., and Ovary, Z. (1988). Protective immunity and eosinophilia in IgE‐deficient SJA/9 mice infected with Nippostrongylus brasiliensis and Trichinella spiralis. Proc. Natl. Acad. Sci. USA 85, 4460–4462. Watanabe, N., Ishiwata, K., Kaneko, S., Oku, Y., Kamiya, M., and Katakura, K. (1993). Immune defense and eosinophilia in congenitally IgE‐deficient SJA/9 mice infected with Angiostrongylus costaricensis. Parasitol. Res. 79, 431–434. Weimar, W., Baumgartner, D., Hendriks, G. F., Hesse, C. J., Balk, A. H., Simoons, M. L., and Bos, E. (1988). The prophylactic use of Orthoclone OKT3 in kidney and heart transplantation. Transplant. Proc. 20, 96–100. Weiss, M. E., Nyhan, D., Peng, Z. K., Horrow, J. C., Lowenstein, E., Hirshman, C., and Adkinson, N. F., Jr. (1989). Association of protamine IgE and IgG antibodies with life‐threatening reactions to intravenous protamine. N. Engl. J. Med. 320, 886–892. Weissman, D. N., and Lewis, D. M. (2002). Allergic and latex‐specific sensitization: Route, frequency, and amount of exposure that are required to initiate IgE production. J. Allergy Clin. Immunol. 110, S57–S63. Williams, C. M., and Galli, S. J. (2000). The diverse potential effector and immunoregulatory roles of mast cells in allergic disease. J. Allergy Clin. Immunol. 105, 847–859. Wilson, D. R., Merrett, T. G., Varga, E. M., Smurthwaite, L., Gould, H. J., Kemp, M., Hooper, J., Till, S. J., and Durham, S. R. (2002). Increases in allergen‐specific IgE in BAL after segmental allergen challenge in atopic asthmatics. Am. J. Respir. Crit. Care Med. 165, 22–26. Wurm, F. M. (2004). Production of recombinant protein therapeutics in cultivated mammalian cells. Nat. Biotechnol. 22, 1393–1398. Wurzburg, B. A., Tarchevskaya, S. S., and Jardetzky, T. S. (2006). Structural changes in the lectin domain of CD23, the low‐affinity IgE receptor, upon calcium binding. Structure 14, 1049–1058. Yamagata, T., and Ichinose, M. (2006). Agents against cytokine synthesis or receptors. Eur. J. Pharmacol. 533, 289–301. Zeiger, R. S., and Heller, S. (1993). Development of nasal basophilic cells and nasal eosinophils from age 4 months through 4 years in children of atopic parents. J. Allergy. Clin Immunol. 91, 723–734. Zheng, Y., Shopes, B., Holowka, D., and Baird, B. (1991). Conformations of IgE bound to its receptor Fc epsilon RI and in solution. Biochemistry 30, 9125–9132.
Immune Semaphorins: Increasing Members and Their Diverse Roles Hitoshi Kikutani,* Kazuhiro Suzuki,* and Atsushi Kumanogoh† *Department of Molecular Immunology and CREST Program of JST, Research Institute for Microbial Diseases, Osaka University, Suita, Osaka 5650871, Japan † Department of Immunopathology, Research Institute for Microbial Diseases, Osaka University, Suita, Osaka 5650871, Japan
1. 2. 3. 4. 5. 6. 7.
Abstract............................................................................................................. Introduction ....................................................................................................... Sema4D ............................................................................................................ Sema4A............................................................................................................. Sema6D and Its Receptor Plexin‐A1 ....................................................................... Sema7A............................................................................................................. Other Semaphorins.............................................................................................. Summary and Perspectives.................................................................................... References .........................................................................................................
121 121 122 127 130 135 137 138 139
Abstract The semaphorin family consists of soluble and membrane‐bound proteins originally identified as axonal guidance cues functioning during neuronal development. However, it is becoming increasingly clear that semaphorins play diverse roles in organogenesis, vascular growth, and tumor progression. In addition, emerging evidence indicates that several semaphorins, called ‘‘immune semaphorins,’’ play crucial roles also during immune responses. Extensive studies on the immune semaphorins have revealed not only parallels but also differences in the semaphorin functions between the immune and nervous systems, providing unexpected but meaningful insights into the biological activities of these molecules. This chapter focuses on our current understanding of the roles of semaphorins and their receptors in the immune system.
1. Introduction The semaphorins comprise a large family of phylogenetically conserved proteins, and more than 20 members have been identified in a variety of species from viruses to humans. Many members act as axon guidance cues during neuronal development (Pasterkamp and Kolodkin, 2003; Tessier‐Lavigne and Goodman, 1996; Yu and Kolodkin, 1999). Both soluble and membrane‐bound semaphorins have been identified, and they have been categorized into eight
121 advances in immunology, vol. 93 # 2007 Elsevier Inc. All rights reserved.
0065-2776/07 $35.00 DOI: 10.1016/S0065-2776(06)93003-X
122
H I T O S H I K I K U TA N I E T A L .
subclasses based on sequence similarity and distinctive structural features. Semaphorin subclasses I and II are found in invertebrate species, and subclasses III–VII are expressed in vertebrates (Pasterkamp and Kolodkin, 2003; Tessier‐Lavigne and Goodman, 1996; Yu and Kolodkin, 1999). Additionally, some nonneurotropic DNA viruses encode functional semaphorin molecules, which are classified into class VIII (Spriggs, 1999). Two families of semaphorin receptors have been identified including plexins and neuropilins (Comeau et al., 1998; He and Tessier‐Lavigne, 1997; Kolodkin et al., 1997; Takahashi et al., 1999; Tamagnone and Comoglio, 2000; Tamagnone et al., 1999; Winberg et al., 1998). Most membrane‐bound vertebrate semaphorins directly bind plexins, while class III secreted semaphorins require neuropilins as obligate coreceptors. However, studies have demonstrated that semaphorin receptor usage is more complex than previously thought. Sema3E signals independently of neuropilin through Plexin‐D1 (Gu et al., 2005), and glycosylphosphatidylinositol (GPI)‐linked Sema7A binds a b1 integrin receptor independently of plexins (Pasterkamp et al., 2003). Additionally, two molecules that are unrelated to plexins and neuropilins, CD72 and Tim‐2, functionally interact with class IV transmembrane semaphorins in the immune system (Kumanogoh and Kikutani, 2003; Kumanogoh et al., 2000, 2002a). Although functions for semaphorins were originally identified in the nervous system, semaphorins are now thought to fulfil diverse physiological roles unrelated to axon guidance, including organogenesis, vascularization, angiogenesis, neuronal apoptosis, and neoplastic transformation (Kitsukawa et al., 1995; Kruger et al., 2005; Sekido et al., 1996). Additionally, studies have revealed that several semaphorins are crucially involved in various phases of immune responses. In particular, two class IV semaphorins, Sema4D and Sema4A, play important roles in the immune system (Delaire et al., 2001; Kumanogoh et al., 2000, 2002a), and their physiological importance was clearly demonstrated through in vivo analyses using gene‐disrupted mice. Additionally, it is becoming clear that other semaphorins such as Sema6D (Takegahara et al., 2006) and Sema7A (Czopik et al., 2006; Holmes et al., 2002) also play immunoregulatory roles. In this chapter, we will discuss the recent advances related to the biological functions of semaphorins in the immune system. 2. Sema4D Sema4D is the first semaphorin molecule identified with a functional role in the immune system (Bougeret et al., 1992; Delaire et al., 1998). It was originally defined as CD100, a differentiation antigen expressed on human T cells recognized by a panel of monoclonal antibodies (Bougeret et al., 1992). Subsequent molecular cloning revealed that this molecule belonged to the
IMMUNE SEMAPHORINS
123
class IV transmembrane semaphorin subfamily (Furuyama et al., 1996; Hall et al., 1996). In the nervous system, Sema4D binds Plexin‐B1, a member of the plexin family, and is chemorepulsive to various neurons (Swiercz et al., 2002; Tamagnone et al., 1999). However, Sema4D binds CD72, a negative regulator of B cells, and enhances the activation of B cells and dendritic cells (DCs) in the immune system (Kumanogoh et al., 2000, 2002b). Analysis of Sema4D/ mice revealed that Sema4D plays pivotal roles not only in fine‐tuning B cell antigen receptor (BCR) signaling but also in the generation of antigen‐specific T cells (Kumanogoh et al., 2002b; Shi et al., 2000). However, no apparent defect was found in the nervous system of these mutant mice, despite the fact that Sema4D–Plexin‐B1 signaling is a well‐studied axon guidance signal (Kruger et al., 2005; Negishi et al., 2005). 2.1. Sema4D–CD72 Interactions in B Cell Signaling In the immune system, Sema4D is constitutively expressed on T cells (Bougeret et al., 1992; Delaire et al., 1998). B cells weakly express Sema4D, but its expression is significantly elevated by the treatment with inflammatory stimuli such as anti‐CD40 (Kumanogoh et al., 2000). Treatment of mouse B cells with the extracellular domain of mouse Sema4D fused to the Fc portion of IgG Sema4DFc or exogenous expression of Sema4D significantly enhances the CD40‐induced proliferation and differentiation in mouse B cells, but Sema4D does not affect mouse T cell function (Kumanogoh et al., 2000). Sema4D/ mice develop decreased T‐dependent antibody responses (Shi et al., 2000). Human Sema4DFc protein also enhances human B cell activation (Ishida et al., 2003). Cells exogenously expressing human Sema4D promote the aggregation and survival of human B cells in vitro (Hall et al., 1996). In the immune system, CD72 appears to be the major receptor for Sema4D (Kumanogoh et al., 2000), and Sema4D specifically binds CD72 with a relatively low affinity (Kd ¼ 3 10–7 M). Agonistic anti‐CD72 mAbs mimic the effect of Sema4D binding on B cells. CD72, a C‐type lectin family, contains two immunoreceptor tyrosine‐based inhibitory motifs (ITIMs) in its cytoplasmic domain that recruit the tyrosine phosphatase SHP‐1 and functions as a negative regulator of B cells (Adachi et al., 1998, 2001). Indeed, B cells from CD72/ mice are hyperresponsive to BCR stimulation (Pan et al., 1999). Several lines of evidence indicate that Sema4D turns off an inhibitory signal originating at CD72, thereby enhancing B cell activation. Both Sema4DFc and anti‐ CD72 mAb block tyrosine phosphorylation and the association of SHP‐1 with CD72 in anti‐m‐stimulated B cells (Adachi et al., 1998; Kumanogoh et al., 2000; Wu et al., 1998). Additionally, CD72 is tyrosine‐phosphorylated and associates with SHP‐1 when transiently expressed in COS7 cells. In these cells, CD72
124
H I T O S H I K I K U TA N I E T A L .
tyrosine‐phosphorylation and SHP‐1 association are blocked by coincubation with Sema4DFc (Kumanogoh et al., 2000). Furthermore, CD72 is tyrosine‐ phosphorylated and constitutively associated with SHP‐1 in B cells from Sema4D/ mice (Shi et al., 2000). Finally, the phenotype of Sema4D/ B cells (hyporesponsive) is almost the opposite of that seen in CD72/ B cells (hyperresponsive; Shi et al., 2000). The mechanism by which the Sema4D–CD72 interaction regulates BCR signaling is now becoming clear, but it remains unknown how Sema4D is involved in the regulation of CD40 and TLR4 signals. CD72 is constitutively associated with the BCR complex. Anti‐m stimulation activates downstream tyrosine kinases such as Blk, Fyn, and Lyn (Kurosaki, 2002). Among these kinases, Lyn phosphorylates the ITIMs of CD72 (Fusaki et al., 2000; Wu et al., 1998), thereby recruiting SHP‐1. SHP‐1 is thought to counteract the action of the tyrosine kinases activated following BCR stimulation. Interestingly, Sema4D induces the dissociation of CD72 from the BCR complex (Kumanogoh et al., 2005b), and the sequestration of CD72 from the BCR signalosome, which is rich in tyrosine kinases, likely facilitates the SHP‐1‐mediated dephosphoryation of the CD72 ITIMs and their subsequent dissociation. Indeed, tyrosine phosphorylation of downstream signaling molecules such as Ig‐b, Syk, Erk, and BLNK and Ca2þ mobilization were severely impaired in Sema4D/ B cells after anti‐m stimulation. These deficiencies were likely due to the constitutive inhibitory signals arising from CD72 in the absence of Sema4D (Kumanogoh et al., 2005b). Additionally, anti‐m‐stimulated Sema4D/ B cells proliferated to a lesser extent than wild‐type B cells, a result consistent with decreased BCR signaling. Furthermore, hyper‐cross‐linking of the BCR by anti‐m antibodies caused less apoptotic cell death in Sema4D/ B cells (Kumanogoh et al., 2005b), an additional sign of impaired signaling. These findings indicate that Sema4D is critically involved in tuning the strength of BCR signals via its interaction with CD72 (Fig. 1).
2.2. Sema4D–CD72 Interactions in Maintaining B Cell Homeostasis Several studies examining mice with mutated signaling molecules downstream of the BCR have clearly demonstrated that changes in the threshold of BCR triggering affect the in vivo survival and turnover of B cells (Niiro and Clark, 2002). BrdU uptake by B cells in Sema4D/ mice was considerably slower than that seen in wild‐type mice fed with BrdU (Kumanogoh et al., 2005b). Furthermore, BrdU‐labeled B cells disappeared from Sema4D/ mice more slowly than from wild‐type mice. Thus, the overall turnover of B cells in Sema4D/ mice is reduced compared with wild‐type mice.
125
IMMUNE SEMAPHORINS
Sema4D
BCR CD72
P
SHP-1 SHP-1 Enhancement of BCR signals Figure 1 Sema4D turns off the negative signaling of CD72. In the absence of Sema4D, CD72 is constitutively associated with the BCR complex, and recruits SHP‐1 to the tyrosine‐phosphorylated ITIM. SHP‐1 dephosphorylates and inactivates several signaling molecules, including Fyn and Lyn. Binding of Sema4D induces dissociation of CD72 from BCR complex, leading to the dephosphorylation of the CD72 ITIMs, dissociation of SHP‐1 from CD72 and augmentation of BCR signaling. Under homeostatic conditions, Sema4D, which is weakly expressed on resting B cells, maintains certain B cell subsets by fine‐tuning BCR signals. In this setting, Sema4D signaling may occur through B cell–B cell interactions and/or an autocrine fashion. On the other hand, in secondary lymphoid organs during humoral immune responses, where numerous interactions between B cells and antigen‐specific helper T cells occur, Sema4D abundantly expressed on T cells strongly enhances BCR signals through CD72, accomplishing full activation of B cells.
In young Sema4D/ mice, the population of CD5þ B1 cells is significantly reduced, although other B cell subsets such as conventional follicular B cells and marginal zone B cells appear to be normal (Shi et al., 2000). However, as Sema4D/ mice aged, the proportion of CD21highCD23low marginal zone B cells gradually increased (Kumanogoh et al., 2005b). The expansion of marginal zone B cells is sometimes observed in mice with defective BCR signaling (Kurosaki, 2002; Niiro and Clark, 2002), whereas the numbers of B1 cells are increased in mice lacking inhibitory receptors such as CD22 and CD72 (O’Keefe et al., 1996; Pan et al., 1999; Sato et al., 1996), suggesting that the requirements for BCR signaling differ among B cell subsets. Therefore, a higher BCR‐signaling threshold may promote the development and/or survival
126
H I T O S H I K I K U TA N I E T A L .
of marginal zone B cells but may be detrimental for the development of B1 cells in Sema4D/ mice. Interestingly, the expansion of marginal zone B cells in Sema4D/ mice was accompanied by the production of a variety of autoantibodies, including anti‐ssDNA, anti‐dsDNA, RFs, anti‐Sjo¨gren’s syndrome A, and anti‐ribonucleoprotein, although such autoantibodies were not detectable by 25 weeks of age (Kumanogoh et al., 2005b). Furthermore, marked perivascular leukocytic infiltration in several tissues, including the salivary gland, liver, and kidney, was also observed in aged Sema4D/ mice. The majority of infiltrating cells in the salivary glands were B cells with a CD21highCD23low phenotype (Kumanogoh et al., 2005b). In addition, when CD21highCD23low marginal zone or CD21lowCD23high follicular B cells purified from Sema4D/ mice were cultured in vitro, the former cells predominantly produced autoantibodies. Mice lacking both Sema4D and CD72 or only CD72 showed no evidence of autoimmune disease or expansion of marginal zone B cells, although a limited number of CD72/ mice exhibited substantial amounts of autoantibodies accompanied with a significant increase of B1 B cells over 1 year of age (Kumanogoh et al., 2005b). These observations suggest that the constitutive association of CD72 with the BCR may promote the expansion of marginal zone B cells and the development of autoimmunity in aged Sema4D/ mice. 2.3. Sema4D in T Cell‐Mediated Immunity As described above, Sema4D/ B cells are hyporesponsive to anti‐m and anti‐ CD40 stimulation. Anti‐CD40‐induced expression of costimulatory molecules and MHC class II as well as the production of cytokines are also impaired in Sema4D/ DCs (Kumanogoh et al., 2002b). Endogenous Sema4D, which is weakly expressed on B cells and DCs, appears to contribute to setting the activation threshold of DCs as well as B cells (Kumanogoh et al., 2002b, 2005b). In the immune system, however, the major Sema4D‐producing cells are T cells. Exogenous Sema4D not only restores the responsiveness of B cells and DCs of Sema4D/ mice but also further enhances the activation of wild‐ type DCs (Kumanogoh et al., 2002b; Shi et al., 2000; Watanabe et al., 2001). Therefore, antigen‐mediated interactions with T cells may lower the activation threshold of B cells and DCs by increasing the local concentrations of Sema4D. In particular, the enhanced DC function induced by Sema4D may be critical for the development of T cell‐mediated immunity. The importance of T cell‐derived Sema4D has been addressed using an in vitro system (Kumanogoh et al., 2002b). Naive CD100þ/þ TCR‐transgenic CD4þ T cells differentiate normally into cytokine‐secreting effector cells when cultured with antigens and CD100/ antigen‐presenting cells (APCs), whereas CD100/
IMMUNE SEMAPHORINS
127
TCR‐transgenic T cells fail to differentiate even in the presence of CD100þ/þ APCs. Consistent with this data, the in vivo generation of antigen‐specific T cells is also profoundly impaired in Sema4D/ mice. Thus, the enhancement of DC function by T cell‐derived Sema4D may be necessary for efficient establishment of T cell‐mediated immunity. 3. Sema4A Sema4A is the second semaphorin identified with a function in the immune system. Like Sema4D, it is also a member of the class IV transmembrane semaphorin subfamily (Kumanogoh et al., 2002a). However, unlike Sema4D, Sema4A contributes to the regulation of immune responses by directly acting on T cells (Kumanogoh et al., 2002a). Tim‐2, which belongs to the T cell, immunoglobulin, and mucin domains protein (Tim) family was identified as a receptor for Sema4A (Kumanogoh et al., 2002a). Analyses of Sema4A/ mice revealed that Sema4A plays critical roles not only in T cell priming but also in the regulation of Th1/Th2 differentiation (Kumanogoh et al., 2005a). 3.1. Distinct Roles of DC‐Derived and T Cell‐Derived Sema4A in Immune Responses Sema4A was originally cloned from mouse DCs (Kumanogoh et al., 2002a), and all mouse DC subsets express high levels of Sema4A. Although B cells express low levels of Sema4A under resting conditions, its expression is enhanced by various stimuli (Kumanogoh et al., 2002a). The expression of Sema4A on T cells is uniquely controlled (Kumanogoh et al., 2005a). Although Sema4A is barely detectable on resting T cells, stimulation of T cells with anti‐ CD3 and anti‐CD28 induces a transient Sema4A expression within 24 h, but its expression level rapidly decreases. However, when T cells are stimulated with Th1‐inducing conditions including IL‐12 and anti‐IL‐4, high levels of Sema4A expression are induced and maintained throughout the culture period. In contrast, stimulation of T cells with Th2‐inducing conditions including IL‐4 and anti‐IFN‐g induces only the transient expression of Sema4A. Furthermore, Sema4A is preferentially expressed on terminally differentiated Th1 cells or cells of Th1 clones but not on their Th2 counterparts. The expression pattern of Sema4A suggests that DC‐ and Th1 cell‐expressed Sema4A may play distinct roles in the development of immune responses. Sema4A can provide a costimulatory signal to T cells; incubation of T cells with anti‐CD3 and Sema4AFc fusion protein significantly enhances proliferation and IL‐2 production (Kumanogoh et al., 2002a). These data strongly suggest that Sema4A contributes to T cell activation through T cell–DC interactions.
128
H I T O S H I K I K U TA N I E T A L .
DCs derived from Sema4A/ mice poorly stimulate allogeneic T cells in a mixed lymphocyte culture compared with DCs from wild‐type littermates, despite the fact that Sema4A/ DCs express costimulatory molecules, such as CD80 and CD86 and MHC class II molecules, and produce cytokines normally in response to anti‐CD40 or LPS stimulation (Kumanogoh et al., 2005a). T cell‐expressed Sema4A is required for in vitro Th1 differentiation. When CD62LhighCD4þ naive T cells purified from Sema4A/ mice or wild‐type littermates are stimulated with anti‐CD3 and anti‐CD28 in the presence of IL‐12 and anti‐IL‐4, Sema4A/ T cells fail to differentiate into IFN‐g‐ producing Th1 cells. In contrast, Sema4A/ T cells differentiate normally into IL‐4‐producing Th2 cells when cultured with IL‐4 and anti‐IL‐12/anti‐IFN‐g. The selective defect in Th1 differentiation of Sema4A/ T cells is further underscored by the decreased expression of IL‐12 receptor b2 chain and T‐bet, an essential transcription factor for proper Th1 cell development and homeostasis (Szabo et al., 2000). Interestingly, normal Th1 differentiation of Sema4A/ T cells is fully restored by either the addition of Sema4AFc or coculture with wild‐type T cells (Kumanogoh et al., 2005a). Thus, it appears that Sema4A contributes to in vitro Th1 differentiation at least in part through cognate T cell–T cell interactions. Sema4A clearly functions in in vitro systems of T cell stimulation and differentiation, and a role for it in vivo has also been observed. Sema4A/ mice poorly generate antigen‐specific T cells following immunization with various antigens (Kumanogoh et al., 2005a). Notably, the generation of IFN‐g producing antigen‐specific T cells is severely impaired in Sema4A/ mice immunized with Th1‐inducing antigens such as heat‐killed Propionibacterium acnes. In contrast, when infected with Nippostrongylus brasiliensis, a Th2‐inducing intestinal nematode, Sema4A/ mice mount an enhanced Th2 immune responses compared with infected wild‐type mice. Thus, the in vivo immune responses of Sema4A/ mice reflect the defects in T cell priming and Th1 differentiation observed in vitro. Transfer experiments using antigen‐pulsed DCs have been utilized to dissect the role of DC‐derived and T cell‐derived Sema4A in each phase of in vivo immune responses (Kumanogoh et al., 2005a). The transfer of antigen‐pulsed DCs from Sema4A/ or Sema4Aþ/þ mice into Sema4A/ or Sema4Aþ/þ mice creates four possible combinations with respect to Sema4A expression— Sema4Aþ/þ DCs/Sema4Aþ/þ T cells, Sema4A/ DCs/Sema4Aþ/þ T cells, Sema4Aþ/þ DCs/Sema4A/ T cells, and Sema4A/ DCs/Sema4A/ T cells. The transfer of Sema4Aþ/þ DCs into Sema4Aþ/þ mice results in the greatest proliferation and IL‐2 production by antigen‐specific T cells and Th1‐ biased cytokine production, while these T cell responses are severely impaired in Sema4A/ mice receiving Sema4A/ DCs. However, when Sema4A/
129
IMMUNE SEMAPHORINS
DCs are transferred into Sema4Aþ/þ mice, the proliferation and IL‐2 secretion by antigen‐specific T cells are impaired, but substantial numbers of IFN‐g‐ producing T cells are generated. In contrast, a selective defect in IFN‐g production but not in proliferation and IL‐2 production by antigen‐specific T cells is observed in Sema4A/ mice receiving Sema4Aþ/þ DCs. These in vivo observations clearly define distinct roles for Sema4A expressed by these two different immune cell types—DC‐derived Sema4A is essential for T cell priming, and T cell‐derived Sema4A is needed for Th1 differentiation. The constitutive expression of high levels of Sema4A by DCs suggests a role in the early activation and expansion of antigen‐specific T cells through T cell– DC interactions (Fig. 2A). Antigen‐induced activation induces Sema4A expression on T cells, and this is maintained on Th1‐differentiating T cells.
A
B Th1 cell
T cell
TCR CD40L Tim-2
CD28
Sema4A
Autocrine
Sema4A B7
Tim-2
T cell−T cell interaction
MHC CD40
DC
Th1 cell
Figure 2 Involvement of Sema4A in T cell activation and differentiation. Sema4A is preferentially expressed on DCs and Th1 cells. Sema4A derived from DCs is crucial for T cell priming (A), while Sema4A expressed by Th1 cells is important for Th1/Th2 regulation (B). Sema4A expressed on T cells might promote Th1 differentiation through cognate cellular interactions and/or an autocrine signaling. Tim‐2 has been identified as a receptor for Sema4A in the immune system.
130
H I T O S H I K I K U TA N I E T A L .
Thus, T cell‐expressed Sema4A may enhance Th1 differentiation through T cell–T cell interactions and/or an autocrine pathway (Fig. 2B). 3.2. Receptors for Sema4A in the Immune System Tim‐2 was identified as a Sema4A‐binding protein by expression cloning using a cDNA library derived from mouse T cells (Kumanogoh et al., 2002a). The surface plasmon resonance assay revealed that the dissociation constant for Sema4A binding to Tim‐2 is 7 10–8 M. Since Sema4A binding induces tyrosine phosphorylation of the cytoplasmic tail of Tim‐2, Tim‐2 appears to transduce Sema4A signals. Other Tim family members, Tim‐1 and Tim‐3, were previously shown to be involved in the regulation of helper T cell activity (McIntire et al., 2001; Monney et al., 2002), and genetic polymorphisms in both the mouse and human Tim loci (particularly Tim‐1 genes) correlate with susceptibility to mouse airway hypersensitivity and human asthma (McIntire et al., 2001, 2003). Additionally, Tim‐3 is preferentially expressed on Th1 cells, and a role for Tim‐3 in regulating Th1 function has been suggested (Monney et al., 2002). Mice injected with the extracellular domain of Tim‐2 fused to the Fc portion of IgG (Tim‐2‐Fc) exhibit in reduced Th1 and enhanced Th2 responses, and administration of Tim‐2‐Fc suppresses the development of experimental autoimmune encephalomyelitis (EAE) in SJL mice immunized with proteolipid protein (PLP) 139–151 peptide (Chakravarti et al., 2005). Lung inflammation is exacerbated in Tim‐2‐deficient mice in a model of airway atopy, and this is accompanied by dysregulated Th2 responses (Rennert et al., 2006). The phenotypes are similar to those observed in Sema4A/ mice. However, Tcells from both Tim‐2‐Fc‐treated and Tim‐2‐deficient mice exhibit increased in vitro basal proliferation in the absence of exogenous antigen, and this is not seen in Sema4A/ mice. Thus, these findings support a role for Tim‐2 as a functional receptor for Sema4A, but they also suggest that Sema4A or Tim‐2 may have another functional binding partner in the immune system. Specifically, Tim‐2 may bind another ligand that has a constitutive inhibitory effect on T cells. Like other class IV semaphorins, Sema4A may bind members of the Plexin‐B subfamily, some of which are expressed by activated T cells (A.K. and H.K., unpublished data). Considering that Plexin‐A1 plays a critical role during the development of immune responses as described later, Sema4A may also have an effect on T cell function through interactions with plexin family members. 4. Sema6D and Its Receptor Plexin‐A1 The secreted semaphorin, Sema3A, binds a receptor complex composed of the signal transducing Plexin‐A1 and ligand‐binding Neuropilin‐1 to induce chemorepulsive signals (Pasterkamp and Kolodkin, 2003; Takahashi et al., 1999).
IMMUNE SEMAPHORINS
131
Additionally, the class VI transmembrane semaphorin, Sema6D, exerts multiple biological activities not only during embryonic development but also in the regulation of immune responses through interactions with Plexin‐A1 (Takegahara et al., 2006; Toyofuku et al., 2004a,b). 4.1. Sema6D–Plexin‐A1 Interactions in Cardiac Development Sema6D mRNA is abundantly expressed in cells of the neural crest and heart of both mouse and chick embryos (Toyofuku et al., 2004a). The in vitro binding assays clearly demonstrated that Sema6D strongly binds Plexin‐A1‐expressing cells, weakly binds Plexin‐A4‐expressing cells, but does not bind cells expressing other plexin molecules (Toyofuku et al., 2004a). Overexpression of Sema6D in chick embryos enhances the right bending of the cardiac tube and expansion of the ventricular region. In contrast, RNAi‐ mediated knockdown of either Sema6D or Plexin‐A1 impairs cardiac tube bending. Sema6D inhibits the migration of ventricular endocardial cells, but conversely, the migration of cells of the conotruncus region is enhanced (Toyofuku et al., 2004a). Additionally, knockdown of Plexin‐A1 abolishes both the inhibitory and enhancing activities of Sema6D on cells from these two distinct regions. Interestingly, Plexin‐A1 differentially associates with two receptor type tyrosine kinases; off‐track (PTK7) at the ventricle and vascular endothelial growth factor receptor type 2 (VEGFR2) at the conotruncus region. Knockdown of off‐track renders the cells of the ventricle but not of the conotruncus region unresponsive to Sema6D, while the expression of a dominant negative form of VEGFR2 abolishes the responsiveness of the cells of the conotruncus region but not of the ventricle to Sema6D (Toyofuku et al., 2004a). Thus, Sema6D exerts opposite biological activities at distinct regions through two different receptor complexes, and this appears to contribute to organized cardiac morphogenesis. 4.2. Sema6D–Plexin‐A1 Interactions in DC Function Ting and colleagues have shown that Plexin‐A1 is one of the gene products induced by CIITA transcription factor that is expressed in DCs and involved in the interaction of DCs with T cells (Wong et al., 2003). Knockdown of Plexin‐ A1 induced by the expression of short‐hairpin RNA suppresses the ability of cells of DC lines to prime T cells in vitro and in vivo. Additionally, relatively high levels of Sema6D mRNA are expressed in different lymphocyte populations including T cells, B cells, and NK cells. Sema6DFc fusion protein stimulates bone marrow‐derived DCs to produce various cytokines such as
132
H I T O S H I K I K U TA N I E T A L .
IL‐12 and to increase the expression of MHC class II molecules (Takegahara et al., 2006). Roles for the interaction of Sema6D with Plexin‐A1 in DC function have been revealed through the generation and analysis of Plexin‐A1/ mice (Takegahara et al., 2006). The nervous and cardiovascular development proceed normally in Plexin‐A1/ mice, indicating that other plexin family members might compensate for the absence of Plexin‐A1 in these tissues. However, T cell‐mediated immunity is severely impaired in Plexin‐A1/ mice. These mice are resistant to myelin oligodendrocyte protein (MOG)‐induced EAE because of the defective generation of MOG‐specific T cells. The defective T cell immunity is at least in part attributable to the impaired DC function in these mice. Plexin‐A1/ DCs poorly stimulate OT‐II TCR transgenic T cells in the presence of ovalbumin‐derived peptides or allogeneic T cells compared to wild‐type DCs. The ability of Plexin‐A1/ DCs to bind and respond to Sema6D is also severely impaired. These observations suggest that Sema6D on T cells may stimulate DCs through Plexin‐A1 during T cell–DC interactions, and this interaction may be required for the efficient generation of antigen‐ specific T cells. 4.3. Sema6D–Plexin‐A1 Interactions in Osteoclastogenesis Plexin‐A1/ mice develop striking osteopetrosis. Osteopetrosis can be caused by the overactivation of osteoblasts and/or defective function of osteoclasts (Theill et al., 2002). Although osteoblast function in Plexin‐A1/ mice is normal, osteoclast differentiation is severely impaired in these mice. The bones of Plexin‐A1/ mice have decreased numbers of osteoclasts and reduced osteoclast surface ratios, and these mice also exhibit decreased bone resorption markers such as deoxypyridinoline and collagen type I fragments. In vitro osteoclastogenesis from Plexin‐A1/ bone marrow is reduced compared to wild‐type bone marrow. Furthermore, Sema6DFc enhances the in vitro induction of osteoclasts from bone marrow cells in the presence of M‐CSF and RANKL (Takegahara et al., 2006). 4.4. Plexin‐A1 Forms a Receptor Complex with TREM‐2 and DAP12 in DCs and Osteoclasts During chick cardiac morphogenesis, Plexin‐A1 differentially associates with either off‐track or VEGFR2 and exerts two distinct biological activities (Toyofuku et al., 2004a). However, neither off‐track nor VEGFR2 is expressed in DCs and osteoclasts. In these cells, Plexin‐A1 associates with the triggering receptor expressed on myeloid cell‐2 (TREM‐2)–DAP12 complex instead of
IMMUNE SEMAPHORINS
133
off‐track or VEGFR2 (Takegahara et al., 2006). DAP12 contains an immunoreceptor tyrosine‐based activation motif (ITAM) in its cytoplasmic region and recruits Src‐like tyrosine kinases such as ZAP‐70 and Syk. DAP12 forms a complex with activating NK receptors including Ly49D, CD94/NKG2C, and KIR2DS and acts as a signaling adaptor molecule for these receptors (Lanier and Bakker, 2000). DAP12 also forms a complex with TREM‐1 or TREM‐2 although the functions and ligands of TREM molecules remain unknown (Colonna, 2003). Interestingly, the phenotypes of DAP12/ mice are somewhat similar to those of Plexin‐A1/ mice. DAP12/ mice not only have a defect in T cell priming but also develop osteopetrosis that is caused by defective osteoclastogenesis (Bakker et al., 2000; Kaifu et al., 2003). Additionally, the genetic mutations of DAP12 as well as the TREM‐2 result in defective osteoclast differentiation (Paloneva et al., 2000, 2002, 2003). Coimmunoprecipitation analysis revealed that Plexin‐A1 associates directly with TREM‐2 through the T cell, immunoglobulin‐like (TIG) domain of its extracellular region (Takegahara et al., 2006). The association of DAP12 with its counterparts such as TREMs and activating NK receptors is dependent on the interaction between a negatively charged residue in the transmembrane domain of DAP12 and a positively charged residue in the transmembrane domain of its counterparts. However, Plexin‐A1 does not contain such charged amino acid residues in its transmembrane domain. When cells transfected with Plexin‐A1, TREM‐2, and DAP12 were stimulated with Sema6D, tyrosine phosphorylation of DAP12 was observed. Sema6D‐induced IL‐12 production is much lower in DCs treated with TREM‐2‐specific siRNA, and DAP12/ DCs have a similar phenotype (Takegahara et al., 2006). Thus, DAP12 appears to associate with Plexin‐A1 indirectly through TREM‐2 and to deliver costimulatory signals to DCs. Given the impaired osteoclast function caused by the defect of the DAP12 or TREM‐2 gene, these adaptor molecules might mediate Plexin‐A1 signaling also in osteoclasts (Fig. 3). The knockdown of TREM‐2 or the targeted mutation of the DAP12 gene substantially reduces but does not completely abolish Sema6D‐induced IL‐12 production in DCs (Takegahara et al., 2006). Thus, some other molecules in addition to DAP12 may mediate Sema6D signaling. Many semaphorins modulate the activities of Rho‐like small GTPases to induce growth cone collapse or axon turning (Kruger et al., 2005; Pasterkamp and Kolodkin, 2003). For example, Sema3A activates Rac GTPase in dorsal root ganglion (DRG) neurons through the neuropilin‐1–Plexin‐A1 complex. Interestingly, Sema6D also induces Rac GTPase activation in DCs (Takegahara et al., 2006), and this is not affected by DAP12 deficiency. Therefore, there may be at least two signaling pathways: one involves DAP12 and Src‐like kinases and the other Rac GTPase (Fig. 3). Although it is unclear whether there is a cross talk between
134
H I T O S H I K I K U TA N I E T A L .
Sema6D
Plexin-A1 TREM-2 DAP12 ITAM P
P
Src tyrosine kinases Rac
Rac
GTP
GDP
Actin dynamics? DC activation osteoclastogenesis Figure 3 Sema6D acts on DCs and osteoclasts through the Plexin‐A1–TREM‐2–DAP12 complex. In DCs and osteoclasts, Plexin‐A1 associates with TREM‐2, linking signals to the ITAM‐containing adaptor protein DAP12. The binding of Sema6D to Plexin‐A1 induces phosphorylation of DAP12, leading to the recruitment of Src family tyrosine kinases. The Sema6D signal mediated by this receptor complex results in the activation of DCs and osteoclastogenesis. Sema6D also induces Rac GTPase activation in DCs, suggesting that the interaction of Sema6D with Plexin‐A1 may be involved in cytoskeletal rearrangements and DC motility.
these two signaling pathways, the Rac GTPase pathway suggests that the Sema6D–Plexin‐A1 interaction may also regulate DC motility. Mature DCs engulf T cells after establishing initial contact between their dendrites and T cells. Interestingly, DCs that are deficient in both Rac1 and Rac2 fail to migrate toward and engulf T cells, and they also poorly prime naive T cells (Benvenuti et al., 2004). These data suggest that Rac GTPases are essential for the motility of DCs during their initial encounters with T cells. The extension of dendrites and cell movement involve the polymerization of actin cytoskeleton and the formation of focal adhesions at the leading edge. Rac GTPases enhance actin polymerization together with Cdc42 (Fukata et al., 2003; Raftopoulou and Hall, 2004), thus suggesting an attractive scenario wherein Sema6D‐induced Rac activation may be involved in dendrite extension and displacement of DCs during their interactions with T cells. However, a
IMMUNE SEMAPHORINS
135
role for Rac GTPases in semaphorin signaling is still controversial. Sema3A and Sema6D induce Rac activation in DRG neurons and ventricular endocardiac cells (Pasterkamp and Kolodkin, 2003; Toyofuku et al., 2004a), leading to growth cone collapse, repulsion of DRG neurons and inhibition of cardiac cell migration, respectively. Additionally, Sema3A‐induced Rac activation appears necessary to trigger signals downstream of Plexin‐A1 and suppress cell adhesion and depolymerization of actin cytoskeleton in DRG neurons (Toyofuku et al., 2005). Further studies are needed to more clearly determine the role of Sema6D‐ induced Rac activation in DC function. 5. Sema7A The GPI‐anchored semaphorin Sema7A, also known as CD108, was identified in a search for vertebrate homologues of AHVsema encoded by alcelaphine herpesvirus (Lange et al., 1998; Xu et al., 1998). Sema7A transcripts are detectable in the nervous system during embryonic development, as well as in various adult tissues, including brain, spinal cord, lung, testis, spleen, and thymus (Mine et al., 2000; Xu et al., 1998; Yamada et al., 1999). In hematopoietic cells, Sema7A is expressed in erythrocytes and is also known as the John‐Milton‐Hagen factor defining a human blood group (Bobolis et al., 1992). Its expression is also observed on activated peripheral blood lymphocytes (Yamada et al., 1999) and thymocytes doubly positive for CD4 and CD8 (Mine et al., 2000). An earlier in vitro‐binding study identified Plexin‐C1 as a receptor for Sema7A (Tamagnone et al., 1999). Notably, however, Sema7A contains an arginine‐glycine‐aspartate (RGD) sequence, a well‐conserved integrin‐binding motif (Hynes, 2002). Indeed, a neurological study demonstrated that Sema7A promotes axon outgrowth through b1 integrin receptors, but not Plexin‐C1, and contributes to the lateral olfactory tract formation (Pasterkamp et al., 2003). 5.1. Sema7A as a Monocyte Stimulator An immune function for Sema7A was first described in monocytes (Holmes et al., 2002). Recombinant soluble Sema7A protein stimulates human peripheral blood monocytes to induce superoxide release and proinflammatory cytokine production, including IL‐1b, IL‐6, TNF‐a, and IL‐8. The recombinant protein also acts as a chemoattractant for monocytes with much more potency than canonical chemokines. Although the mechanism underlying these activities of Sema7A was unclear, we recently found that Sema7A binds and activates human monocytes and mouse macrophages through an integrin receptor (K. S. and H. K., unpublished data). This suggests that Sema7A
136
H I T O S H I K I K U TA N I E T A L .
A
B GPI-linkage Sema7A
a
RGD motif
b
TCR
Sema7A
Integrin Monocyte
Cytokine production chemotaxis
CD3
T cell
Downregulation of TCR signals
Figure 4 Sema7A activates monocytes but negatively regulates T cells. (A) Sema7A stimulates monocytes to produce proinflammatory cytokines and undergo chemotaxis. In line with the growth‐promoting effect on neuronal axons, monocyte activation by Sema7A is mediated probably by an integrin receptor. (B) In T cells, Sema7A is supposed to associate the TCR complex on the cell surface and downregulate signals emanating from the TCR. The opposite regulatory roles of Sema7A in immune cells indicate the need for further studies of this protein.
may utilize the identical receptor and signal transduction machinery in both the nervous and immune systems (Fig. 4A). 5.2. Sema7A as a Negative Regulator for T Cells Medzhitov and colleagues reported that Sema7A negatively regulates T cell‐ mediated immune responses in a T cell autonomous manner (Czopik et al., 2006). They showed that Sema7A/ T cells were hyperproliferative both in response to antigenic stimuli and under homeostatic conditions. Consistent with this, Sema7A/ mice experienced highly aggressive course of MOG‐ induced EAE compared with wild‐type animals. However, the mechanism by which Sema7A deficiency leads to T cell hyperactivity remains unclear. Although TCR internalization following anti‐CD3 antibody cross‐linking was defective in Sema7A/ T cells, only a slight enhancement in TCR‐mediated signaling was seen in these cells. Since GPI‐anchored proteins reside in specialized signaling modules, lipid rafts, where immune receptors accumulate, it has been assumed that Sema7A interacts in cis with TCR complexes in
IMMUNE SEMAPHORINS
137
the lipid rafts and downmodulates TCR‐mediated T cell responses by undefined mechanisms (Fig. 4B). The reported phenotype of Sema7A/ mice appears inconsistent with the ability of Sema7A to potently stimulate monocytes/macrophages, major effector cells in T cell mediated immunity. Indeed, in our experiments, Sema7A/ mice are impaired in their ability to develop not only EAE but also contact hypersensitivity (K. S. and H. K., unpublished data). Thus, further studies are needed to clarify the role of Sema7A in immune responses. 6. Other Semaphorins 6.1. Viral Semaphorins Viruses encode proteins within their own genome that facilitate infectious processes or support viral transmission. Interestingly, not only the aforementioned alcelaphine herpesvirus but also numerous poxviruses encode semaphorins (Ensser and Fleckenstein, 1995; Kolodkin et al., 1993). Vaccinia virus semaphorin A39R binds Plexin‐C1, which is also a receptor for AHVsema, and induces robust responses in human monocytes, including cell aggregation, proinflammatory cytokine production, and upregulation of the monocyte cell surface marker CD54 (ICAM‐1; Comeau et al., 1998). Additionally, studies have demonstrated that A39R suppresses integrin‐mediated adhesion and migration (Walzer et al., 2005a) and attenuates the phagocytotic capacity of DCs (Walzer et al., 2005b). These observations suggest that viral semaphorins might play dual roles in the host. They can enhance inflammation and deteriorate the disease by activating the host immune system, but in contrast, they can be a means for viruses to evade immune surveillance by suppressing immune cell functions. 6.2. Class III Semaphorins Sema3A is the human homologue of collapsin‐1, the first identified vertebrate semaphorin (Kolodkin et al., 1993). Extensive studies in the nervous system have established a role for Sema3A as an axonal guidance factor during development. Interestingly, several lines of evidence suggest that Sema3A also affects immune cell functions. Consistent with its chemorepulsive activity on neurons, Delaire (2001) reported that Sema3A inhibited the spontaneous migration of monocytes in a transwell assay. Studies have also demonstrated that Sema3A is secreted from activated T cells, DCs (Lepelletier et al., 2006) and various types of tumor cells (Catalano et al., 2006). Additionally, treatment of T cells with recombinant or tumor cell‐derived Sema3A inhibited
138
H I T O S H I K I K U TA N I E T A L .
TCR‐mediated proliferation and cytokine production by downregulating the MAPK signaling cascades (Catalano et al., 2006; Lepelletier et al., 2006). These observations suggest a possibility that Sema3A may serve as a negative regulator for T cells in physiological and pathological immune responses. Although the inhibition of T cell function is mediated by neuropilin‐1, its coreceptor on neuronal cells, Plexin‐A1, is not expressed by T cells (Catalano et al., 2006). Thus, Sema3A might act on T cells through other members of the Plexin‐A subfamily. 7. Summary and Perspectives Accumulating evidence has established the semaphorin family as a novel class of immunoregulatory molecules. Although detailed investigations have been performed on only a limited number of the family members, they are clearly involved in various phases of the immune response through several distinct mechanisms. Each of two class IV semaphorins, Sema4D and Sema4A, makes a respective contribution to homeostatic maintenance of B cell subsets and differentiation of effector T cells. Sema6D as well as both of the class IV semaphorins participate in cognate interactions between T cells and DCs, enabling optimal T cell priming against antigens. In addition, considering the potent stimulatory capacity on monocytes, Sema7A might play a role in the effector phases of immune responses. Moreover, several family members are crucially involved in the development or progress of animal models of autoimmune and inflammatory diseases. For example, antibody blockade or genetic deletion of Sema4D (Kumanogoh et al., 2002b), Sema4A (Kumanogoh et al., 2002a), or Sema6D (Takegahara et al., 2006) ameliorates the clinical course of EAE. Conversely, Sema4D‐deficient mice develop autoimmune diseases along with elevated levels of various types of autoantibodies (Kumanogoh et al., 2005b). Thus, the manipulation of the semaphorin functions could provide novel avenues for therapeutic strategies for the treatment of these immune disorders. Early studies on class IV semaphorins, Sema4D and Sema4A, have revealed that they exert costimulation‐like activities during immune responses through receptor systems different from those in the nervous system (Kumanogoh et al., 2000, 2002a). However, as mentioned above, a study has demonstrated that Sema6D functions in the immune system through Plexin‐A1 (Takegahara et al., 2006), which is a prototype of semaphorin receptors identified in the nervous system, suggesting that certain semaphorins may exert immunological activities through the mechanisms similar to those seen in the nervous system. Indeed, semaphorins have been shown to regulate migration of immune cells (Delaire et al., 2001; Holmes et al., 2002). Therefore, the mechanisms by which
IMMUNE SEMAPHORINS
139
semaphorins are involved in immune regulation will be more complex than previously expected. Further studies will be required to outline the roles of semaphorin molecules in the immune system. Finally, increased understanding of the ‘‘immune semaphorins’’ could provide valuable insights into the potential function of semaphorins in the other systems as well as facilitate the creation of a comprehensive model detailing the wide array of physiological processes regulated by this interesting family of proteins. Acknowledgments We thank K. Kubota for excellent secretarial assistance. We are also grateful to N. Takegahara and M. Mizui for the creation of artworks. This study was supported by the following funding agencies: The Ministry of Education, Culture, Sports, Science, and Technology, Japan and The Core Research for Evolutional Science and Technology (CREST) program of the Japanese Science and Technology Agency (JST) to A.K. and H.K, and Research Fellowships of the Japan Society for the Promotion of Science for Young Scientists to K.S.
References Adachi, T., Flaswinkel, H., Yakura, H., Reth, M., and Tsubata, T. (1998). The B cell surface protein CD72 recruits the tyrosine phosphatase SHP‐1 upon tyrosine phosphorylation. J. Immunol. 160, 4662–4665. Adachi, T., Wienands, J., Wakabayashi, C., Yakura, H., Reth, M., and Tsubata, T. (2001). SHP‐1 requires inhibitory co‐receptors to down‐modulate B cell antigen receptor‐mediated phosphorylation of cellular substrates. J. Biol. Chem. 276, 26648–26655. Bakker, A. B., Hoek, R. M., Cerwenka, A., Blom, B., Lucian, L., McNeil, T., Murray, R., Phillips, L. H., Sedgwick, J. D., and Lanier, L. L. (2000). DAP12–deficient mice fail to develop autoimmunity due to impaired antigen priming. Immunity 13, 345–353. Benvenuti, F., Hugues, S., Walmsley, M., Ruf, S., Fetler, L., Popoff, M., Tybulewicz, V. L., and Amigorena, S. (2004). Requirement of Rac1 and Rac2 expression by mature dendritic cells for T cell priming. Science 305, 1150–1153. Bobolis, K. A., Moulds, J. J., and Telen, M. J. (1992). Isolation of the JMH antigen on a novel phosphatidylinositol‐linked human membrane protein. Blood 79, 1574–1581. Bougeret, C., Mansur, I. G., Dastot, H., Schmid, M., Mahouy, G., Bensussan, A., and Boumsell, L. (1992). Increased surface expression of a newly identified 150‐kDa dimer early after human T lymphocyte activation. J. Immunol. 148, 318–323. Catalano, A., Caprari, P., Moretti, S., Faronato, M., Tamagnone, L., and Procopio, A. (2006). Semaphorin‐3A is expressed by tumor cells and alters T‐cell signal transduction and function. Blood 107, 3321–3329. Chakravarti, S., Sabatos, C. A., Xiao, S., Illes, Z., Cha, E. K., Sobel, R. A., Zheng, X. X., Strom, T. B., and Kuchroo, V. K. (2005). Tim‐2 regulates T helper type 2 responses and autoimmunity. J. Exp. Med. 202, 437–444. Colonna, M. (2003). TREMs in the immune system and beyond. Nat. Rev. Immunol. 3, 445–453. Comeau, M. R., Johnson, R., DuBose, R. F., Petersen, M., Gearing, P., VandenBos, T., Park, L., Farrah, T., Buller, R. M., Cohen, J. I., Strockbine, L. D., Rauch, C., et al. (1998). A poxvirus‐encoded
140
H I T O S H I K I K U TA N I E T A L .
semaphorin induces cytokine production from monocytes and binds to a novel cellular semaphorin receptor, VESPR. Immunity 8, 473–482. Czopik, A. K., Bynoe, M. S., Palm, N., Raine, C. S., and Medzhitov, R. (2006). Semaphorin 7A is a negative regulator of T cell responses. Immunity 24, 591–600. Delaire, S., Elhabazi, A., Bensussan, A., and Boumsell, L. (1998). CD100 is a leukocyte semaphorin. Cell. Mol. Life Sci. 54, 1265–1276. Delaire, S., Billard, C., Tordjman, R., Chedotal, A., Elhabazi, A., Bensussan, A., and Boumsell, L. (2001). Biological activity of soluble CD100. II. Soluble CD100, similarly to H‐SemaIII, inhibits immune cell migration. J. Immunol. 166, 4348–4354. Ensser, A., and Fleckenstein, B. (1995). Alcelaphine herpesvirus type 1 has a semaphorin‐like gene. J. Gen. Virol. 76, 1063–1067. Fukata, M., Nakagawa, M., and Kaibuchi, K. (2003). Roles of Rho‐family GTPases in cell polarisation and directional migration. Curr. Opin. Cell Biol. 15, 590–597. Furuyama, T., Inagaki, S., Kosugi, A., Noda, S., Saitoh, S., Ogata, M., Iwahashi, Y., Miyazaki, N., Hamaoka, T., and Tohyama, M. (1996). Identification of a novel transmembrane semaphorin expressed on lymphocytes. J. Biol. Chem. 271, 33376–33381. Fusaki, N., Tomita, S., Wu, Y., Okamoto, N., Goitsuka, R., Kitamura, D., and Hozumi, N. (2000). BLNK is associated with the CD72/SHP‐1/Grb2 complex in the WEHI231 cell line after membrane IgM cross‐linking. Eur. J. Immunol. 30, 1326–1330. Gu, C., Yoshida, Y., Livet, J., Reimert, D. V., Mann, F., Merte, J., Henderson, C. E., Jessell, T. M., Kolodkin, A. L., and Ginty, D. D. (2005). Semaphorin 3E and plexin‐D1 control vascular pattern independently of neuropilins. Science 307, 265–268. Hall, K. T., Boumsell, L., Schultze, J. L., Boussiotis, V. A., Dorfman, D. M., Cardoso, A. A., Bensussan, A., Nadler, L. M., and Freeman, G. J. (1996). Human CD100, a novel leukocyte semaphorin that promotes B‐cell aggregation and differentiation. Proc. Natl. Acad. Sci. USA 93, 11780–11785. He, Z., and Tessier‐Lavigne, M. (1997). Neuropilin is a receptor for the axonal chemorepellent Semaphorin III. Cell 90, 739–751. Holmes, S., Downs, A., Fosberry, A., Hayes, P., Michalovich, D., Murdoch, P., Moores, K., Fox, J., Deen, K., Pettman, G., Wattam, T., and Lewis, C. (2002). Sema7A is a potent monocyte stimulator. Scand. J. Immunol. 56, 270–275. Hynes, R. O. (2002). Integrins: Bidirectional, allosteric signaling machines. Cell 110, 673–687. Ishida, I., Kumanogoh, A., Suzuki, K., Akahani, S., Noda, K., and Kikutani, H. (2003). Involvement of CD100, a lymphocyte semaphorin, in the activation of the human immune system via CD72: Implications for the regulation of immune and inflammatory responses. Int. Immunol. 15, 1027–1034. Kaifu, T., Nakahara, J., Inui, M., Mishima, K., Momiyama, T., Kaji, M., Sugahara, A., Koito, H., Ujike‐Asai, A., Nakamura, A., Kanazawa, K., Tan‐Takeuchi, K., et al. (2003). Osteopetrosis and thalamic hypomyelinosis with synaptic degeneration in DAP12‐deficient mice. J. Clin. Invest. 111, 323–332. Kitsukawa, T., Shimono, A., Kawakami, A., Kondoh, H., and Fujisawa, H. (1995). Overexpression of a membrane protein, neuropilin, in chimeric mice causes anomalies in the cardiovascular system, nervous system and limbs. Development 121, 4309–4318. Kolodkin, A. L., Matthes, D. J., and Goodman, C. S. (1993). The semaphorin genes encode a family of transmembrane and secreted growth cone guidance molecules. Cell 75, 1389–1399. Kolodkin, A. L., Levengood, D. V., Rowe, E. G., Tai, Y. T., Giger, R. J., and Ginty, D. D. (1997). Neuropilin is a semaphorin III receptor. Cell 90, 753–762. Kruger, R. P., Aurandt, J., and Guan, K. L. (2005). Semaphorins command cells to move. Nat. Rev. Mol. Cell. Biol. 6, 789–800.
IMMUNE SEMAPHORINS
141
Kumanogoh, A., and Kikutani, H. (2003). Immune semaphorins: A new area of semaphorin research. J. Cell Sci. 116, 3463–3470. Kumanogoh, A., Watanabe, C., Lee, I., Wang, X., Shi, W., Araki, H., Hirata, H., Iwahori, K., Uchida, J., Yasui, T., Matsumoto, M., Yoshida, K., et al. (2000). Identification of CD72 as a lymphocyte receptor for the class IV semaphorin CD100: A novel mechanism for regulating B cell signaling. Immunity 13, 621–631. Kumanogoh, A., Marukawa, S., Suzuki, K., Takegahara, N., Watanabe, C., Ch’ng, E., Ishida, I., Fujimura, H., Sakoda, S., Yoshida, K., and Kikutani, H. (2002a). Class IV semaphorin Sema4A enhances T‐cell activation and interacts with Tim‐2. Nature 419, 629–633. Kumanogoh, A., Suzuki, K., Ch’ng, E., Watanabe, C., Marukawa, S., Takegahara, N., Ishida, I., Sato, T., Habu, S., Yoshida, K., Shi, W., and Kikutani, H. (2002b). Requirement for the lymphocyte semaphorin, CD100, in the induction of antigen‐specific T cells and the maturation of dendritic cells. J. Immunol. 169, 1175–1181. Kumanogoh, A., Shikina, T., Suzuki, K., Uematsu, S., Yukawa, K., Kashiwamura, S., Tsutsui, H., Yamamoto, M., Takamatsu, H., Ko‐Mitamura, E. P., Takegahara, N., Marukawa, S., et al. (2005a). Nonredundant roles of Sema4A in the immune system: Defective T cell priming and Th1/Th2 regulation in Sema4A‐deficient mice. Immunity 22, 305–316. Kumanogoh, A., Shikina, T., Watanabe, C., Takegahara, N., Suzuki, K., Yamamoto, M., Takamatsu, H., Prasad, D. V., Mizui, M., Toyofuku, T., Tamura, M., Watanabe, D., et al. (2005b). Requirement for CD100–CD72 interactions in fine‐tuning of B‐cell antigen receptor signaling and homeostatic maintenance of the B‐cell compartment. Int. Immunol. 17, 1277–1282. Kurosaki, T. (2002). Regulation of B cell fates by BCR signaling components. Curr. Opin. Immunol. 14, 341–347. Lange, C., Liehr, T., Goen, M., Gebhart, E., Fleckenstein, B., and Ensser, A. (1998). New eukaryotic semaphorins with close homology to semaphorins of DNA viruses. Genomics 51, 340–350. Lanier, L. L., and Bakker, A. B. (2000). The ITAM‐bearing transmembrane adaptor DAP12 in lymphoid and myeloid cell function. Immunol. Today 21, 611–614. Lepelletier, Y., Moura, I. C., Hadj‐Slimane, R., Renand, A., Fiorentino, S., Baude, C., Shirvan, A., Barzilai, A., and Hermine, O. (2006). Immunosuppressive role of semaphorin‐3A on T cell proliferation is mediated by inhibition of actin cytoskeleton reorganization. Eur. J. Immunol. 36, 1782–1793. McIntire, J. J., Umetsu, S. E., Akbari, O., Potter, M., Kuchroo, V. K., Barsh, G. S., Freeman, G. J., Umetsu, D. T., and DeKruyff, R. H. (2001). Identification of Tapr (an airway hyperreactivity regulatory locus) and the linked Tim gene family. Nat. Immunol. 2, 1109–1116. McIntire, J. J., Umetsu, S. E., Macaubas, C., Hoyte, E. G., Cinnioglu, C., Cavalli‐Sforza, L. L., Barsh, G. S., Hallmayer, J. F., Underhill, P. A., Risch, N. J., Freeman, G. J., et al. (2003). Immunology: Hepatitis A virus link to atopic disease. Nature 425, 576. Mine, T., Harada, K., Matsumoto, T., Yamana, H., Shirouzu, K., Itoh, K., and Yamada, A. (2000). CDw108 expression during T‐cell development. Tissue Antigens 55, 429–436. Monney, L., Sabatos, C. A., Gaglia, J. L., Ryu, A., Waldner, H., Chernova, T., Manning, S., Greenfield, E. A., Coyle, A. J., Sobel, R. A., Freeman, G. J., and Kuchroo, V. K. (2002). Th1– specific cell surface protein Tim‐3 regulates macrophage activation and severity of an autoimmune disease. Nature 415, 536–541. Negishi, M., Oinuma, I., and Katoh, H. (2005). R‐ras as a key player for signaling pathway of plexins. Mol. Neurobiol. 32, 217–222. Niiro, H., and Clark, E. A. (2002). Regulation of B‐cell fate by antigen‐receptor signals. Nat. Rev. Immunol. 2, 945–956. O’Keefe, T. L., Williams, G. T., Davies, S. L., and Neuberger, M. S. (1996). Hyperresponsive B cells in CD22–deficient mice. Science 274, 798–801.
142
H I T O S H I K I K U TA N I E T A L .
Paloneva, J., Kestila, M., Wu, J., Salminen, A., Bohling, T., Ruotsalainen, V., Hakola, P., Bakker, A. B., Phillips, J. H., Pekkarinen, P., Lanier, L. L., Timonen, T., et al. (2000). Loss‐of‐function mutations in TYROBP (DAP12) result in a presenile dementia with bone cysts. Nat. Genet. 25, 357–361. Paloneva, J., Manninen, T., Christman, G., Hovanes, K., Mandelin, J., Adolfsson, R., Bianchin, M., Bird, T., Miranda, R., Salmaggi, A., Tranebjaerg, L., Konttinen, Y., et al. (2002). Mutations in two genes encoding different subunits of a receptor signaling complex result in an identical disease phenotype. Am. J. Hum. Genet. 71, 656–662. Paloneva, J., Mandelin, J., Kiialainen, A., Bohling, T., Prudlo, J., Hakola, P., Haltia, M., Konttinen, Y. T., and Peltonen, L. (2003). DAP12/TREM2 deficiency results in impaired osteoclast differentiation and osteoporotic features. J. Exp. Med. 198, 669–675. Pan, C., Baumgarth, N., and Parnes, J. R. (1999). CD72–deficient mice reveal nonredundant roles of CD72 in B cell development and activation. Immunity 11, 495–506. Pasterkamp, R. J., and Kolodkin, A. L. (2003). Semaphorin junction: Making tracks toward neural connectivity. Curr. Opin. Neurobiol. 13, 79–89. Pasterkamp, R. J., Peschon, J. J., Spriggs, M. K., and Kolodkin, A. L. (2003). Semaphorin 7A promotes axon outgrowth through integrins and MAPKs. Nature 424, 398–405. Raftopoulou, M., and Hall, A. (2004). Cell migration: Rho GTPases lead the way. Dev. Biol. 265, 23–32. Rennert, P. D., Ichimura, T., Sizing, I. D., Bailly, V., Li, Z., Rennard, R., McCoon, P., Pablo, L., Miklasz, S., Tarilonte, L., and Bonventre, J. V. (2006). T cell, Ig domain, mucin domain‐2 gene‐ deficient mice reveal a novel mechanism for the regulation of TH2 immune responses and airway inflammation. J. Immunol. 177, 4311–4321. Sato, S., Miller, A. S., Inaoki, M., Bock, C. B., Jansen, P. J., Tang, M. L., and Tedder, T. F. (1996). CD22 is both a positive and negative regulator of B lymphocyte antigen receptor signal transduction: Altered signaling in CD22–deficient mice. Immunity 5, 551–562. Sekido, Y., Bader, S., Latif, F., Chen, J. Y., Duh, F. M., Wei, M. H., Albanesi, J. P., Lee, C. C., Lerman, M. I., and Minna, J. D. (1996). Human semaphorins A(V) and IV reside in the 3p21.3 small cell lung cancer deletion region and demonstrate distinct expression patterns. Proc. Natl. Acad. Sci. USA 93, 4120–4125. Shi, W., Kumanogoh, A., Watanabe, C., Uchida, J., Wang, X., Yasui, T., Yukawa, K., Ikawa, M., Okabe, M., Parnes, J. R., Yoshida, K., and Kikutani, H. (2000). The class IV semaphorin CD100 plays nonredundant roles in the immune system: Defective B and T cell activation in CD100– deficient mice. Immunity 13, 633–642. Spriggs, M. K. (1999). Shared resources between the neural and immune systems: Semaphorins join the ranks. Curr. Opin. Immunol. 11, 387–391. Swiercz, J. M., Kuner, R., Behrens, J., and Offermanns, S. (2002). Plexin‐B1 directly interacts with PDZ‐RhoGEF/LARG to regulate RhoA and growth cone morphology. Neuron 35, 51–63. Szabo, S. J., Kim, S. T., Costa, G. L., Zhang, X., Fathman, C. G., and Glimcher, L. H. (2000). A novel transcription factor, T‐bet, directs Th1 lineage commitment. Cell 100, 655–669. Takahashi, T., Fournier, A., Nakamura, F., Wang, L. H., Murakami, Y., Kalb, R. G., Fujisawa, H., and Strittmatter, S. M. (1999). Plexin‐neuropilin‐1 complexes form functional semaphorin‐3A receptors. Cell 99, 59–69. Takegahara, N., Takamatsu, H., Toyofuku, T., Tsujimura, T., Okuno, T., Yukawa, K., Mizui, M., Yamamoto, M., Prasad, D. V., Suzuki, K., Ishii, M., Terai, K., et al. (2006). Plexin‐A1 and its interaction with DAP12 in immune responses and bone homeostasis. Nat. Cell Biol. 8, 615–622. Tamagnone, L., and Comoglio, P. M. (2000). Signalling by semaphorin receptors: Cell guidance and beyond. Trends Cell Biol. 10, 377–383.
IMMUNE SEMAPHORINS
143
Tamagnone, L., Artigiani, S., Chen, H., He, Z., Ming, G. I., Song, H., Chedotal, A., Winberg, M. L., Goodman, C. S., Poo, M., Tessier‐Lavigne, M., and Comoglio, P. M. (1999). Plexins are a large family of receptors for transmembrane, secreted, and GPI‐anchored semaphorins in vertebrates. Cell 99, 71–80. Tessier‐Lavigne, M., and Goodman, S. C. (1996). The molecular biology of axon guidance. Science 274, 1123–1133. Theill, L. E., Boyle, W. J., and Penninger, J. M. (2002). RANK‐L and RANK: T cells, bone loss, and mammalian evolution. Annu. Rev. Immunol. 20, 795–823. Toyofuku, T., Zhang, H., Kumanogoh, A., Takegahara, N., Suto, F., Kamei, J., Aoki, K., Yabuki, M., Hori, M., Fujisawa, H., and Kikutani, H. (2004a). Dual roles of Sema6D in cardiac morphogenesis through region‐specific association of its receptor, Plexin‐A1, with off‐track and vascular endothelial growth factor receptor type 2. Genes Dev. 18, 435–447. Toyofuku, T., Zhang, H., Kumanogoh, A., Takegahara, N., Yabuki, M., Harada, K., Hori, M., and Kikutani, H. (2004b). Guidance of myocardial patterning in cardiac development by Sema6D reverse signalling. Nat. Cell Biol. 6, 1204–1211. Toyofuku, T., Yoshida, J., Sugimoto, T., Zhang, H., Kumanogoh, A., Hori, M., and Kikutani, H. (2005). FARP2 triggers signals for Sema3A‐mediated axonal repulsion. Nat. Neurosci. 8, 1712–1719. Walzer, T., Galibert, L., Comeau, M. R., and De Smedt, T. (2005a). Plexin C1 engagement on mouse dendritic cells by viral semaphorin A39R induces actin cytoskeleton rearrangement and inhibits integrin‐mediated adhesion and chemokine‐induced migration. J. Immunol. 174, 51–59. Walzer, T., Galibert, L., and De Smedt, T. (2005b). Poxvirus semaphorin A39R inhibits phagocytosis by dendritic cells and neutrophils. Eur. J. Immunol. 35, 391–398. Watanabe, C., Kumanogoh, A., Shi, W., Suzuki, K., Yamada, S., Okabe, M., Yoshida, K., and Kikutani, H. (2001). Enhanced immune responses in transgenic mice expressing a truncated form of the lymphocyte semaphorin CD100. J. Immunol. 167, 4321–4328. Winberg, M. L., Noordermeer, J. N., Tamagnone, L., Comoglio, P. M., Spriggs, M. K., Tessier‐ Lavigne, M., and Goodman, C. S. (1998). Plexin A is a neuronal semaphorin receptor that controls axon guidance. Cell 95, 903–916. Wong, A. W., Brickey, W. J., Taxman, D. J., van Deventer, H. W., Reed, W., Gao, J. X., Zheng, P., Liu, Y., Li, P., Blum, J. S., McKinnon, K. P., and Ting, J. P. (2003). CIITA‐regulated plexin‐A1 affects T‐cell‐dendritic cell interactions. Nat. Immunol. 4, 891–898. Wu, Y., Nadler, M. J., Brennan, L. A., Gish, G. D., Timms, J. F., Fusaki, N., Jongstra‐Bilen, J., Tada, N., Pawson, T., Wither, J., Neel, B. G., and Hozumi, N. (1998). The B‐cell transmembrane protein CD72 binds to and is an in vivo substrate of the protein tyrosine phosphatase SHP‐1. Curr. Biol. 8, 1009–1017. Xu, X., Ng, S., Wu, Z. L., Nguyen, D., Homburger, S., Seidel‐Dugan, C., Ebens, A., and Luo, Y. (1998). Human semaphorin K1 is glycosylphosphatidylinositol‐linked and defines a new subfamily of viral‐related semaphorins. J. Biol. Chem. 273, 22428–22434. Yamada, A., Kubo, K., Takeshita, T., Harashima, N., Kawano, K., Mine, T., Sagawa, K., Sugamura, K., and Itoh, K. (1999). Molecular cloning of a glycosylphosphatidylinositol‐anchored molecule CDw108. J. Immunol. 162, 4094–4100. Yu, H. H., and Kolodkin, A. L. (1999). Semaphorin signaling: A little less per‐plexin. Neuron 22, 11–14.
Tec Kinases in T Cell and Mast Cell Signaling Martin Felices, Markus Falk, Yoko Kosaka, and Leslie J. Berg Department of Pathology, University of Massachusetts Medical School, Massachusetts
1. 2. 3. 4. 5. 6. 7.
Abstract............................................................................................................. Introduction ....................................................................................................... Subcellular Localization of Tec Kinases ................................................................... Tec Kinases in Signaling Pathways .......................................................................... Regulation of Tec Kinase Activation........................................................................ Distinct Versus Redundant Functions of Tec Kinases ................................................. Tec Kinases in Mast Cell Signaling ......................................................................... Conclusions........................................................................................................ References .........................................................................................................
145 145 147 151 160 163 166 172 172
Abstract The Tec family of tyrosine kinases consists of five members (Itk, Rlk, Tec, Btk, and Bmx) that are expressed predominantly in hematopoietic cells. The exceptions, Tec and Bmx, are also found in endothelial cells. Tec kinases constitute the second largest family of cytoplasmic protein tyrosine kinases. While B cells express Btk and Tec, and T cells express Itk, Rlk, and Tec, all four of these kinases (Btk, Itk, Rlk, and Tec) can be detected in mast cells. This chapter will focus on the biochemical and cell biological data that have been accumulated regarding Itk, Rlk, Btk, and Tec. In particular, distinctions between the different Tec kinase family members will be highlighted, with a goal of providing insight into the unique functions of each kinase. The known functions of Tec kinases in T cell and mast cell signaling will then be described, with a particular focus on T cell receptor and mast cell FceRI signaling pathways. 1. Introduction 1.1. Overview of Tec Kinases Five Tec kinase family members have been described in mammalian cells. These kinases are highly expressed in hematopoietic cells, including B cells (Mano et al., 1993; Rawlings et al., 1993; Tsukada et al., 1993; Vetrie et al., 1993), T cells (Haire et al., 1994; Heyeck and Berg, 1993; Hu et al., 1995; Mano et al., 1993; Siliciano et al., 1992; Yamada et al., 1993), and mast cells (Kawakami et al., 1994, 1995; Sommers et al., 1995). The Tec kinase family members share a number of structural features. Each has a C‐terminal kinase domain, followed by an Src homology (SH)2 domain, and an SH3 domain, much like Src family protein tyrosine kinases (PTKs) (Smith et al., 2001).
145 advances in immunology, vol. 93 # 2007 Elsevier Inc. All rights reserved.
0065-2776/07 $35.00 DOI: 10.1016/S0065-2776(06)93004-1
146
MARTIN FELICES ET AL.
However, unlike the Src kinases, Tec family kinases, with the exception of Bmx, possess a proline‐rich region (PRR) at the N‐terminal side of the SH3 domain; interestingly, Btk and Tec have two of these regions, whereas Itk and Rlk have only one. At the N‐terminal side of the PRR, in Itk, Btk, and Tec, there is a Zn2þ‐ binding region known as the Btk homology (BH) motif. The combination of the BH and the PRR has been labeled the Tec homology (TH) domain. Finally, at the N‐terminal end, all Tec family kinases, with the exception of Rlk, possess a pleckstrin homology (PH) domain; in Rlk, the N‐terminal region contains a cysteine‐string motif (Berg et al., 2005). These structural differences, specifically the difference in PRRs and N‐terminal domains, may contribute to the distinct functions of each Tec kinase. 1.2. Regulation of Tec Kinase Expression Levels As a group, the Tec family kinases are predominantly expressed in hematopoietic cells; however, each individual Tec kinase has a distinct cell type‐specific pattern of expression. In addition, each cell type has a hierarchy of expression levels and functions for the Tec kinases expressed in that cell. Of the three Tec kinases expressed in T cells, Itk, Rlk, and Tec, Itk appears to have the predominant role in T cell receptor (TCR) signaling. Itk is expressed in thymocytes and mature T cells, and is found at maximal levels in the mature adult thymus (Gibson et al., 1993; Heyeck and Berg, 1993; Siliciano et al., 1992; Tanaka et al., 1993; Yamada et al., 1993). Similar to Itk, Rlk is expressed in thymocytes and mature resting T cells; however, Rlk mRNA levels are 3‐ to 10‐fold lower than the levels of Itk mRNA in resting T cells (Colgan et al., 2004; Hu et al., 1995; Miller et al., 2004; Sommers et al., 1995). Furthermore, unlike Itk, Rlk is dramatically downregulated at both the mRNA and protein levels on TCR stimulation (Hu et al., 1995; Sommers et al., 1995). The third Tec kinase expressed in T cells, Tec, is expressed at much lower levels in resting T cells, with mRNA levels 100‐fold lower than that of Itk (Berg et al., 2005). Interestingly, Tec is upregulated in T cells 2–3 days following their stimulation, suggesting a more important role for Tec in T cell effector function and restimulation, rather than in T cell development or initial activation (Tomlinson et al., 2004b). Tec kinase levels are also individually regulated during T helper cell differentiation. When naive CD4þ T cells differentiate into T helper (Th) cells, Itk levels increase approximately two‐ to threefold in Th2 cells versus Th1 cells, consistent with the known role of Itk in Th2 responses (Colgan et al., 2004; Miller et al., 2004). Similar to Itk, Tec is expressed at twofold higher levels in Th2 cells than in Th1 cells; however, in this latter case, the functional significance of this differential expression is not known, as Tec‐deficient mice have
Te c
KINASES IN T CELL AND MAST CELL SIGNALING
147
no reported T cell signaling defects (Tomlinson et al., 2004b). In contrast to Itk and Tec, Rlk is downregulated following naive CD4þ T cell activation, and is reexpressed in Th1 cells, but not Th2 cells; these data have suggested a specific role for Rlk in Th1 responses (Hu et al., 1995; Kashiwakura et al., 1999; Miller et al., 2004). For an in‐depth review of Tec kinases and their roles in T helper cell differentiation, please refer to articles by Schwartzberg et al. (2005) and Kosaka et al. (2006). 2. Subcellular Localization of Tec Kinases 2.1. Regulation of Membrane Recruitment Each Tec family kinase shows a distinct pattern of subcellular localization (Fig. 1). At steady state levels Itk and Tec are found in the cytoplasm; following activation of phosphalidylinositol (PI)‐3‐kinase (PI3K) and the generation of PI(3,4,5)P3 (PIP3) at the plasma membrane, Itk and Tec are recruited to the membrane via their PH domains (Ching et al., 1999; Shan et al., 2000; Yang et al., 2001). In contrast, Rlk, which lacks a PH domain, is constitutively associated with the plasma membrane via its palmitoylated cysteine‐string motif. Thus, while Itk and Tec both require PI3K activity for plasma membrane association, Rlk lipid raft association is PI3K‐independent (Chamorro et al., 2001). Following TCR stimulation and the activation of PI3K, Itk recruitment to the membrane requires its PH domain and is independent of other domain interactions (Bunnell et al., 2000; Ching et al., 1999). Deletion of the Itk PH domain abolishes TCR activation‐induced colocalization of Itk with the TCR complex at the plasma membrane and also prevents the subsequent tyrosine phosphorylation and activation of Itk. Substitution of the PH domain of Itk with a membrane localization (e.g., myristylation) sequence from Lck restores Itk membrane localization, but does not allow TCR signal‐induced tyrosine phosphorylation of Itk, indicating a more complex role for the PH domain than simple plasma membrane association (Ching et al., 1999). Possible roles for the PH domain include recruitment to the immediate vicinity of the activated receptor, or a more structural role in Itk activation. The regulation of Tec recruitment to the plasma membrane following TCR stimulation has some distinct features compared to Itk. Like Itk, Tec can be recruited to the membrane through the interaction of its PH domain with PIP3. However, the interaction of the Tec PH domain with PIP3 must be different from that of the other Tec kinases, as illustrated by the behavior of PH domain substitution mutants. For instance, substitution of the glutamic acid residue at position 41 with lysine in the Btk PH domain has been shown
148
MARTIN FELICES ET AL.
Figure 1 Membrane localization of Tec family kinases. (A) The larger isoform of Rlk (RLK‐L) is constitutively localized to the plasma membrane through palmitoylation of the cysteine string motif at the amino terminus (1). On T cell receptor (TCR) engagement (2), Rlk proteins in the vicinity of the TCR are activated by Fyn through phosphorylation of the Rlk kinase domain. (B) Prior to B cell receptor (BCR) engagement, Btk is cytosolic. Following BCR stimulation (1), Lyn activates PI3K (2), leading to the production of PIP3 (3). Btk is then recruited to the plasma membrane through interaction of its PH domain with PIP3 (4). Lyn phosphorylates and activates Btk (5). (C) Prior to TCR engagement, Itk is cytosolic. Following TCR stimulation (1), Lck activates PI3K (2), leading to the production of PIP3 (3). Itk is recruited to the plasma membrane through interaction of its PH domain with PIP3 (4). Lck then phosphorylates and activates Itk (5). (D) Following TCR engagement (1), Lck activates PI3K (2), leading to the production of PIP3 (3). Tec is then recruited into vesicles at the plasma membrane that contain signaling components such as Lck and PLC‐g (4). Tec is then recruited to PIP3 through its PH domain (5) where it can be activated (presumably by Lck in T cells and Lyn in B cells) (6).
to increase Btk binding to PIP3; in contrast, the comparable mutation in the PH domain of Tec (E42K) reduces Tec binding to PIP3 (Yang et al., 2001). In addition, while the Tec PH domain is required for tyrosine phosphorylation of Tec, membrane recruitment could also be mediated by the Tec SH2 domain (Yang et al., 2001). Finally, one study found that the PH domain of Tec is dispensable for Tec accumulation at the plasma membrane and instead identified the SH3 domain as essential for accumulation of Tec at the
Te c
KINASES IN T CELL AND MAST CELL SIGNALING
149
immunological synapse (Garcon et al., 2004a). Interestingly, these authors also found that a functional Tec PH domain is required for proper activation of Tec following TCR stimulation, but suggest that membrane accumulation of Tec is not PI3K‐dependent. An interesting report indicates that in B cells, Btk can promote its own sustained activation by a positive feedback loop (Saito et al., 2003). Btk binds to PI5‐kinase, transporting it to the membrane following activation; at the membrane, PI5K converts PI(4)P into PI(4,5)P2, thereby providing a renewable source of substrate for PI3K, and prolonging the activation signal. Since membrane localization is a prerequisite for Tec kinase function in antigen receptor signaling pathways, these signals can be terminated by inhibition of membrane recruitment. For Itk, recruitment to the plasma membrane is negatively regulated by the lipid phosphatase, phosphatase and tensin homologue deleted on chromosome 10 (PTEN), which removes phosphates from the D3 position of phosphoinositides, and thereby reduces the levels of PIP3 at the membrane (Shan et al., 2000). In PTEN‐deficient cells, such as the Jurkat T cell tumor line, Itk is constitutively localized to the plasma membrane and hyperresponsive to TCR stimulation (Shan et al., 2000). This mechanism for negative regulation sets Itk apart from Rlk, which has no dependence on phosphoinositides for membrane localization. Membrane localization of Tec, in contrast, is regulated by the src homology 2‐containing inositol‐5‐phosphatase (SHIP) family of inositol phosphatases (Tomlinson et al., 2004a). The proposed mechanism for this regulation is similar to that of PTEN, involving dephosphorylation of PIP3 leading to decreased PH domain‐mediated recruitment of Tec to the plasma membrane. However, unlike the indirect regulation of Itk by PTEN, Tec also seems to directly interact with SHIP1 and SHIP2, an interaction that is dependent on the Tec SH3 domain (Tomlinson et al., 2004a). On the basis of this observation, it is possible that in conditions of PI3K‐independent recruitment of Tec to the membrane, interaction of SHIP with the Tec SH3 domain might be sufficient to preclude Tec membrane localization. One final feature that sets Tec apart from other family members is its unique subcellular localization on TCR‐induced activation. Whereas Itk appears diffusely localized at the immunological synapse, Tec has a more punctuate localization pattern at the T cell–APC interface, indicative of its presence in vesicular structures (Tomlinson et al., 2004b). Formation and maintenance of these Tec‐containing vesicles require TCR signaling through Src‐family kinases and PI3K (Kane and Watkins, 2005). These vesicles also contain the early endosomal antigen 1 (EEA1) marker as well as signaling components such as Lck and the Tec substrate PLC‐g1. In theory, this packaging of signaling components facilitates signaling through Tec. No such assembly of signaling components has been described for any of the other Tec family kinases.
150
MARTIN FELICES ET AL.
2.2. Nuclear Localization and Functions of Tec Kinases Several reports have also indicated that Tec kinases may have an important role in the nucleus (Fig. 2). In this regard, the data for Rlk is the most compelling. Two isoforms of Rlk, which arise from alternative sites of translation initiation on the same mRNA have been described (Debnath et al., 1999). The larger 58‐kDa isoform is cytoplasmic and localizes to lipid rafts through the cysteine‐string motif on palmitoylation. The shorter 52‐kDa isoform lacks the cysteine‐string motif and localizes to the nucleus when expressed in the absence of the larger form. Consistent with these data, a mutation that abolishes palmitoylation in the cysteine‐string motif of the larger isoform allows this protein to migrate to the nucleus (Debnath et al., 1999). However, in spite of the fact that both isoforms contain a nuclear localization sequence (residues 57–71), both proteins are found only in the cytoplasm when coexpressed, suggesting a direct physical interaction between the two isoforms. While the data demonstrating the ability of Rlk to traffic to the nucleus are compelling, little is known about the function of nuclear Rlk. One report indicated that Rlk could bind to the IFN‐g promoter region. Combined with its up‐regulation in Th1 cells, these findings suggest an important function for Rlk in Th1 cell development and signaling (Kashiwakura et al., 1999).
Figure 2 Proposed mechanisms of Tec family kinase nuclear localization. (A) On TCR engagement (1), the short form of Rlk (RLK‐S), usually found in a complex with the long form (RLK‐L), migrates to the nucleus (2). Once in the nucleus RLK‐S binds to the promoter region of the IFN‐g gene (3). (B) On TCR engagement (1), the SH3 region of Itk interacts with the PRR region of the nuclear transporter Karyopherin alpha (Rch1a) (2). The Itk–Rch1a complex translocates into the nucleus (3). In the nucleus, Itk may bind T‐bet, a master regulator of IFN‐g transcription (4). (C) On BCR engagement, Btk phosphorylates the transcription factor TFII‐I (1). TFII‐I translocates into the nucleus (2) and activates transcription (3). Btk also translocates to the nucleus (4). Export of Btk out of the nucleus is regulated by Btk binding to the export protein exportin‐1 (Expt‐1) (5).
Te c
KINASES IN T CELL AND MAST CELL SIGNALING
151
Some data also indicate that Itk may traffic to the nucleus. In CD3‐stimulated Jurkat T cells, a small proportion of the total Itk protein was found in the nucleus. In this case, the nuclear localization was mediated by karyopherin alpha (Rch1a), a nuclear transporter binding to the Itk SH3 domain via its PRR (Perez‐Villar et al., 2001). This finding is somewhat surprising, as Rch1a is generally required for the nuclear import of proteins containing a basic‐ type (classical) nuclear localization signal, which is lacking in Itk. Nonetheless, expression of a PRR mutant of Rch1a in Jurkat cells prevented nuclear translocation of Itk as well as mitogen‐induced IL‐2 production by these T cells. These data suggest that the nuclear fraction of Itk may play a role during T cell activation (Perez‐Villar et al., 2001). Consistent with this notion, one report indicates that Itk might directly interact with and phosphorylate T‐bet, a constitutively nuclear transcription factor that regulates IFN‐g transcription (Hwang et al., 2005). The ability to shuttle between the cytoplasm and the nucleus has also been demonstrated for Btk (Mohamed et al., 2000). Deletion of the Btk SH3 domain led to Btk localization predominantly in the nucleus. Furthermore, inhibiting a nuclear export protein, exportin‐1, also resulted in nuclear accumulation of Btk. However, potential nuclear targets of Btk and the exact mechanism of Btk shuttling remain to be determined. Additional data suggest a close link between Btk and the regulation of gene transcription. In this context, it is worth noting that Btk has been implicated in NF‐kB activation in B cells, indirectly linking Btk to nuclear signaling (Petro et al., 2000). In addition, TFII‐I, a versatile transcription initiation factor, has been shown to be tyrosine phosphorylated by Btk shortly after B cell receptor (BCR) stimulation. Consistent with this, overexpression of wild‐type Btk induced TFII‐I‐dependent transcriptional activation in COS7 cells (Novina et al., 1999). TFII‐I was also found to associate with the Btk PH and kinase domains. These data suggest that Btk phosphorylation of BAP/TFII‐I provides a link between BCR engagement and the modulation of gene expression (Egloff and Desiderio, 2001). In addition, the chromatin‐ remodeling protein, Bam11, has been shown to bind to the Btk PH domain and to inhibit Btk kinase activity (Kikuchi et al., 2000). These data suggest a model in which Btk activates BAM11 and the SWI/SNF transcriptional complex via TFII‐I activation in B cells (Hirano et al., 2004). 3. Tec Kinases in Signaling Pathways 3.1. Antigen Receptor Signaling Pathways Although some of the details vary, the antigen receptor signaling pathways in T cells, B cells, and mast cells share a similar overall scheme. Briefly, following receptor engagement, a Src family tyrosine kinase is activated and phosphorylates
152
MARTIN FELICES ET AL.
receptor subunits, leading to the recruitment and activation of an Syk family kinase (Dal Porto et al., 2004; Gilfillan and Tkaczyk, 2006; Kane et al., 2000; Samelson, 2002). Activated Tec family kinases are then recruited to the receptor signaling complexes through interactions with adapter proteins of the SLP‐76 (SH2‐domain‐containing leukocyte protein of 76 kDa) and LAT (linker for activation of T cells) families (Bunnell et al., 2000; Ching et al., 2000; Shan and Wange, 1999; Su et al., 1999). Once at the membrane, Tec family kinases are activated through phosphorylation by Src family kinases, and in turn, phosphorylate and activate PLC‐g (Fluckiger et al., 1998; Liu et al., 1998; Schaeffer et al., 1999; Takata and Kurosaki, 1996). PLC‐g catalyzes catabolism of PI(4,5)P2 into inositol‐1,4,5‐triphosphate (IP3) and diacylglycerol (DAG) (Rhee, 2001). IP3 is required for intracellular Ca2þ release, which triggers sustained calcium influx that activates downstream effectors like the NFAT transcription factors (Crabtree and Olson, 2002; Lewis and Cahalan, 1995). DAG activates members of the PKC (protein kinase C) family, as well as RASGRP (RAS guanyl‐releasing protein), leading to the activation of JNK (JUN amino‐terminal kinase) and ERK1/ERK2 (extracellular‐signal‐regulated kinase) and thereby regulating the transcription factor, AP‐1 (Newton, 2004; Samelson, 2002). This model is supported by data from Tec kinase‐deficient lymphocytes and mast cells, which show defects in antigen receptor mediated PLC‐g phosphorylation, IP3 production, Ca2þ influx, ERK and JNK activation, and the downstream activation of transcription factors, NFAT and AP1 (Dal Porto et al., 2004; Fowell et al., 1999; Gilfillan and Tkaczyk, 2006; Liu et al., 1998; Miller and Berg, 2002; Schaeffer et al., 1999, 2001). A more detailed discussion of Tec kinase signaling in mast cells can be found below. The most prominent known substrate of Tec kinases is PLC‐g, which is phosphorylated following antigen receptor stimulation. Tec kinases are brought into proximity with PLC‐g via interactions with adapter molecules. Specifically, some Tec kinases have been shown to associate with adapters, SLP‐76 and SLP‐65, and the membrane‐bound linker molecule, LAT. In T cells, the adapters LAT and SLP‐76 couple Itk to PLC‐g1 via interactions mediated by the Itk SH2 and SH3 domains (Bunnell et al., 2000; Chan et al., 1999; Ching et al., 2000; Su et al., 1999). In B cells, where Itk is not expressed, Btk is coupled to PLC‐g2 by the BLNK/SLP‐65 adapter complex (Su et al., 1999). The function of Tec kinases in antigen receptor signaling pathways is also dependent on protein–protein interactions mediated by the nonenzymatic domains of the kinases. Studies addressing the binding partners of Tec kinases were initiated more than 10 years ago, with the finding that the Src family tyrosine kinases, Lyn, Fyn, and Hck, could bind to the Btk TH domain (Cheng et al., 1994). At that time, these data provided the first evidence linking Btk, and potentially other Tec kinases, to established signaling pathways in B lymphocytes and other leukocytes. Subsequently, similar associations of Src
Te c
KINASES IN T CELL AND MAST CELL SIGNALING
153
Figure 3 Tec kinase interacting proteins. Protein domains of the five Tec kinase family members are indicated, along with the known interaction partners for each domain. References are as follows: Abassi et al. (2003), Aoki et al. (2004), August et al. (1997), Bagheri‐Yarmand et al. (2001), Bence et al. (1997), Brazin et al. (2002), Bunnell et al. (1996, 2000), Chamorro et al. (2001), Chen et al. (2001), Cheng et al. (1994), Cory et al. (1995), Fluckiger et al. (1998), Guinamard et al. (1997), Jiang et al. (1998), Johannes et al. (1999), Jui et al. (2000), Kawakami et al. (2000a), Kikuchi et al. (2000), Kojima et al. (1997), Liu et al. (2001), Lowry and Huang (2002), Lu et al. (1998), Machide et al. (1995), Mano et al. (1996), Mao et al. (1998), Morrogh et al. (1999), Novina et al. (1999), Ohya et al. (1999), Perez‐Villar and Kanner (1999), Perez‐Villar et al. (2001), Raab et al. (1995), Saito et al. (2003), Schneider et al. (2000), Su et al. (1999), Tomlinson et al. (2004b), Tsai et al. (2000), van Dijk et al. (2000), Vargas et al. (2002), Vassilev et al. (1999), Xie et al. (2006), Yamadori et al. (1999), Yang and Olive (1999), and Yao et al. (1999).
kinases with Tec, Itk, and Rlk have been confirmed (Bunnell et al., 1996; Mano et al., 1996). The following sections will highlight what has been learned since these initial studies about the interactions of Tec kinases with other immune cell signaling proteins (Fig. 3).
154
MARTIN FELICES ET AL.
3.2. Interactions with Negative Regulators of Signaling Since the activation of tyrosine kinases leads to dramatic changes in cell physiology, patterns of gene expression, and proliferative state, it is critical that these signals be terminated at later times following antigen receptor stimulation. One route to termination of signaling is via the interaction of kinases with negative regulatory molecules. As mentioned above, one such mechanism involves activation of the SH2‐containing inositol phosphatases, (SHIP)‐1 and ‐2. The main function of SHIP proteins, like that of PTEN, is to counteract PI3K activity, thereby diminishing recruitment of signaling molecules that are dependent on PH domain‐mediated interactions with PIP3. Consistent with this indirect mode of regulation, SHIP‐1 and ‐2 have been found to directly interact with, and functionally inhibit, Tec in vitro (Tomlinson et al., 2004a). Two regions in SHIP‐1 have been shown to mediate interactions with the Tec SH3 domain, suggesting the possibility that two Tec molecules can bind simultaneously to SHIP‐1. Tec‐induced NFAT activation is potently inhibited by SHIP‐1 and ‐2, and requires intact SHIP phosphatase activity. Overall, this pathway is thought to operate by diminishing Tec membrane localization (Tomlinson et al., 2004a). Another mechanism by which SHIP downregulates signaling is via interactions with Dok proteins, negative regulatory adapter molecules that reduce Erk activation. Specifically, the NPyX motif within the C‐terminus of SHIP‐1 interacts with the phosphotyrosine‐binding domains of Dok‐1, ‐2, and ‐3 (Robson et al., 2004; Tamir et al., 2000). In addition, the SH2 domain of Tec interacts with phosphotyrosine motifs in Dok‐1 and Dok‐2 (Gerard et al., 2004; Yoshida et al., 2000), while the PRR of Tec also binds to Dok‐1 (Tomlinson et al., 2004a). On the basis of these data, a Tec/SHIP/Dok complex has been proposed and is thought to inhibit Tec kinase activity. Consistent with this notion, a stable complex between Tec and Dok‐1, together with the Lyn tyrosine kinase, has been observed. Further, Tec and Lyn can each phosphorylate Dok‐1 (Liang et al., 2002; Tomlinson et al., 2004a; van Dijk et al., 2000). Phosphorylated Dok‐1 has also been shown to bind to the SH2 domains of several signaling molecules activated by stem cell factor (SCF), suggesting that Dok‐1, and therefore indirectly Tec, may function to modulate signaling through c‐kit (van Dijk et al., 2000). Interactions similar to those of Tec with the SHIP/Dok pathway have not been observed to date for the other Tec family kinases. Additional proteins have been identified as binding partners for Tec family kinases that result in inhibition of their activity. For example, the tyrosine phosphatase, PTP20, is tyrosine‐phosphorylated by Tec and coimmunoprecipitates with Tec from a B cell line (Aoki et al., 2004). A role for PTP20 in the
Te c
KINASES IN T CELL AND MAST CELL SIGNALING
155
negative regulation of Tec is further supported by the observation that PTP20 can inhibit Tec signaling following BCR stimulation in the Ramos B cell line. Several negative regulators of Btk have also been described. Hirano et al. (2004) reported a Btk‐associated molecule, BAM11 that binds to the PH domain of Btk and prevents Btk recruitment to the membrane. In addition, a small 203aa protein, inhibitor of Btk (IBtk), was found in a yeast two‐hybrid screen as a binding partner for the Btk PH domain. IBtk inhibits Btk kinase activity and interferes with BCR‐mediated calcium mobilization and NF‐kB activation (Liu et al., 2001). In another study, Yamadori et al. (1999) detected an SH3‐domain binding protein that preferentially associates with Btk, called Sab. Overexpression of Sab in B cells reduces BCR‐induced Btk tyrosine phosphorylation, calcium mobilization, and PIP3 generation, clearly suggesting a role for Sab as a negative regulator of Btk‐mediated BCR signaling. PKC has also been proposed as a negative regulator of Tec kinase activity. Two reports document an association between Btk and PKC, mediated by the Btk PH and TH domains. Johannes et al. (1999) first described an interaction between PKCm and the PH–TH region of Btk. Although PKCm is ubiquitously expressed, high levels are found in the thymus and in hematopoietic cells. In a second report, Kawakami et al. (2000a) demonstrate binding between Btk and PKCb1 in mast cells following FceRI stimulation. This latter interaction was shown to downregulate Btk kinase activity, resulting in a negative feedback loop. Interestingly, in contrast to Btk, Itk binds to a broad spectrum of PKC isoforms in FceRI‐stimulated mast cells, including PKC‐a, ‐bI, ‐bII, ‐e, ‐z, and ‐y (Kawakami et al., 1995). A unique mode of negative regulation has been proposed for Itk based on observations of a cis–trans proline isomerization that occurs in the Itk SH2 domain, but not in the SH2 domains of the other Tec kinases (Brazin et al., 2002; Mallis et al., 2002). This proline isomerization produces two different conformations of the Itk SH2 domain. The trans SH2 conformer is involved in phospholigand binding and is therefore implicated in activation of Itk (Breheny et al., 2003). The cis SH2 conformer is involved in phosphotyrosine‐ independent binding to the SH3 domain of another molecule of Itk, thus forming a homodimer that is likely to interfere with Itk activation (Brazin et al., 2000; Breheny et al., 2003). The peptidyl‐prolyl isomerase, cyclophilin A, which catalyses cis–trans proline isomerization, has been to shown to bind to Itk and inhibit Itk kinase activity (Brazin et al., 2002). Treatment with cyclosporin A, which inhibits cyclophilin A, increases Itk activation and phosphorylation of Itk substrates. Consistent with these findings, T cells from cyclophilin A‐deficient mice are hypersensitive to TCR stimulation due to increased Itk activity (Colgan et al., 2004).
156
MARTIN FELICES ET AL.
3.3. Interactions with the Cytoskeletal Components One major outcome of antigen receptor signaling is the reorganization of the actin cytoskeleton. This structural reorganization is essential for the recruitment of signaling molecules to the immunological synapse, where activation pathways are initiated. Intriguingly, the first observation linking Tec kinases with the actin cytoskeleton came from studies in insects. Tec29, the Tec family kinase found in Drosophila melanogaster, is an essential protein required during embryonic development. In Drosophila, Tec29 is required for the actin‐ dependent growth of ring canals, the intracellular bridges between nurse cells and the oocyte (Guarnieri et al., 1998; Roulier et al., 1998). More recently, support for Tec kinases as modulators of the cytoskeleton in mammalian cells has emerged, with implications for signaling, migration, and cell adhesion. Much of the data in this area focuses on Bmx, which is highly expressed in cells with a strong migratory potential, including endothelial cells and metastatic carcinoma cell lines. Studies of Bmx have shown that this Tec kinase member is activated by extracellular matrix proteins (Chen et al., 2001). Bmx activation is dependent on focal adhesion kinase (FAK), which functions as a key mediator in integrin signaling and is thought to mediate cell migration by recruitment and phosphorylation of the docking protein, p130Cas (Cas). FAK controls cellular responses to the extracellular matrix and binds via its FERM domain to the PH domain of Bmx (Chen et al., 2001). This interaction activates Bmx, thereby linking Bmx to integrin signaling and cell adhesion. Another report gives mechanistic insight into this process by providing evidence that Bmx interacts with Cas at membrane ruffles—sites of active actin remodeling in motile cells (Abassi et al., 2003). Specifically, Cas binds to the SH2 domain of Bmx. Furthermore, Bmx phosphorylates Cas and induces binding to another docking protein, Crk. The Cas–Crk complex connects several extracellular stimuli to the regulation of the actin cytoskeleton and cell motility. Among Tec family kinases, a role in actin modulation is not restricted to Bmx. Several lines of evidence indicate a role for Itk in regulating actin polymerization, largely based on data showing impaired TCR‐mediated actin reorganization in T cells from Itk‐deficient mice (Labno et al., 2003; Woods et al., 2001). This defect has been linked to reduced activation of Cdc42 and WASP in the absence of Itk and Rlk. Consistent with these findings, WASP binds to the SH3 domains of Itk and Btk, directly linking these Tec kinases to cytoskeletal rearrangements (Bunnell et al., 1996). Additional evidence for Tec kinase interactions with the cytoskeleton comes from studies on the rat basophilic cell line, RBL‐2H3. In these cells, a fraction of Btk colocalizes with actin fibers following stimulation through FceRI. This interaction is mediated by the PH domain of Btk (Yao et al., 1999). Interestingly Btk is also found at high
Te c
KINASES IN T CELL AND MAST CELL SIGNALING
157
levels in platelets, where 30% of total Btk is associated with actin filaments after stimulation of the thrombin receptor (Mukhopadhyay et al., 2001). Further links between Tec family kinases and the actin cytoskeleton are suggested by interactions with Vav, a guanine nucleotide exchange factor for the Rho family GTPases, Rac and Cdc42. These GTPases are important in actin remodeling during polarization and migration processes in leukocytes (Turner and Billadeau, 2002). Loss of Itk expression in Jurkat tumor cells as well as primary T cells reduced TCR‐mediated actin polarization, correlating with impaired recruitment of Vav to the activated receptor. Both the Itk SH2 and SH3 domains bind to Vav (Bunnell et al., 2000; Dombroski et al., 2005; Kline et al., 2001) and similar interactions have been reported for Vav and the Btk SH3 domain (Guinamard et al., 1997). Although the precise functional outcome of these interactions is not understood, these data provide a biochemical link between Tec kinases and cytoskeletal remodeling.
3.4. Btk and Toll‐Like Receptor Signaling Several lines of evidence suggest a role for Btk in Toll‐like receptor (TLR) signaling pathways. TLRs 4, 6, 8, and 9 have been shown to bind to Btk (Jefferies et al., 2003). In addition, Btk is activated following lipopolysaccharide (LPS) stimulation of peripheral blood mononuclear cells, and is required for LPS‐induced TNFa production (Horwood et al., 2006). Consistent with these findings, peripheral blood mononuclear cells from patients with X‐linked agammaglobulinemia (a deficiency in Btk) produce less TNFa and IL‐1b following TLR4 or TLR2 stimulation than cells from healthy controls. Grey et al. (2006) also showed that Btk phosphorylates the MyD88 adapter‐like protein, Mal, in stimulated monocytes, further supporting the involvement of Btk in TLR signaling pathways. Finally, coimmunoprecipitation experiments demonstrated an interaction of Btk with MyD88 itself, and with interleukin‐1 receptor‐associated kinase (IRAK)‐1, key molecules in TLR4 signal transduction (Jefferies et al., 2003). Together these findings provide strong support for Btk as a mediator of LPS‐induced NF‐kB activation.
3.5. Associations with Additional Signaling Proteins 3.5.1. CD28 and CD2 Itk can also be activated and recruited to the plasma membrane following stimulation of CD2 or CD28 (August et al., 1994; King et al., 1996, 1998; Marengere et al., 1997; Tanaka et al., 1997). In the case of CD28 cross‐linking,
158
MARTIN FELICES ET AL.
membrane recruitment requires the Itk SH3 domain (Ching et al., 1999; Marengere et al., 1997). A similar result has also been reported for Tec, where targeting of Tec to activated CD28 is dependent on an intact Tec SH3 domain (Garcon et al., 2004b). 3.5.2. Heterotrimeric G‐Proteins In parallel to the well‐documented membrane recruitment of Btk via PH domain‐mediated PIP3 binding, an additional mechanism of Btk membrane localization has been proposed based on a PH/TH domain‐mediated association of Btk with heterotrimeric G‐protein b and g subunits (Gbg). Binding of Gbg to Btk leads to enhanced Btk kinase activity (Lowry and Huang, 2002). Furthermore, the purified a subunit of the G(q) class of heterotrimeric G‐proteins (Gaq) has also been shown to bind to the Btk PH domain, and to cause activation of Btk in vivo (Bence et al., 1997). This latter observation strengthens the role of Btk as a direct effector of G‐proteins. Finally, another G‐protein subunit, Ga12, also binds Btk, triggering Btk kinase activity (Jiang et al., 1998). Little is known about potential interactions between other Tec kinase members and heterotrimeric G‐proteins, although Itk has also been shown to bind to Gbg (Langhans‐Rajasekaran et al., 1995). 3.5.3. Pim‐1 Biochemical evidence has indicated an interaction between Bmx and the 44‐kDa serine/threonine kinase Pim‐1, a protein that has been implicated in tumorigenesis (Amson et al., 1989; Breuer et al., 1989; Dhanasekaran et al., 2001; van Lohuizen et al., 1989). Specifically, the N‐terminal proline‐rich motif of the 44‐kDa isoform of Pim‐1 was shown to compete with the proline‐rich motifs of p53 for binding to the Bmx SH3 domain. These data have suggested a model where the disruption of p53 binding to Bmx by Pim‐1 leads to enhanced Bmx activity in prostate cancer cells, thereby conferring resistance of these tumor cells to chemotherapeutic drugs (Xie et al., 2006). Similarly, Bmx has also been implicated in the progression of breast cancer. In these studies, p21‐ activated kinase 1 (PAK1), a CDC42/Rac‐dependent serine/threonine kinase, binds to Bmx via the Bmx PH domain leading to PAK1 phosphorylation and activation. Consistent with these data, a kinase‐inactive mutant of Bmx expressed in human cancer cells reduced proliferation and tumorigenicity, suggesting an important role for Bmx in tumor growth (Bagheri‐Yarmand et al., 2001). 3.5.4. Fas Btk has been shown to bind to the intracellular domain of Fas, linking Btk to the apoptotic cell death pathway in B cells. This interaction occurs via the Btk
Te c
KINASES IN T CELL AND MAST CELL SIGNALING
159
PH and kinase domains. Furthermore, Btk binding to Fas inhibits the Fas– FADD interaction, thereby preventing initiation of the apoptotic cascade that normally occurs following FADD recruitment of caspase‐8. As predicted by these data, B cell susceptibility to Fas‐mediated apoptosis is increased in the absence of Btk (Vassilev et al., 1999). 3.5.5. BRDG1, Grb10/GrbIR, Sak To determine downstream effectors of Tec, Ohya et al. (1999) performed a yeast two‐hybrid screen for interacting partners of the Tec kinase domain. This approach identified the Sak kinase, Grb10/Grb1R, and a previously unknown docking protein, BRDG1 (BCR downstream signaling 1) (Ohya et al., 1999). Of these, BRDG1 has been shown to be phosphorylated directly by Tec in vitro and to increase Tec activity in a positive feedback loop (Ohya et al., 1999). Sak, a poorly characterized serine/threonine kinase thought to participate in cell cycle control, is tyrosine phosphorylated by Tec in kidney 293 cells (Yamashita et al., 2001). Grb10 is an adapter molecule involved in insulin receptor signaling and implicated in c‐fos activation (Mano et al., 1998). Overexpression of Grb10 suppresses Tec‐mediated activation of the c‐fos promoter, indicating a novel role for Grb10 as an effector molecule downstream of Tec (Mano et al., 1998). 3.5.6. PTPD1 As described above for Tec, yeast two‐hybrid screens have been performed to identify potential interaction partners of Bmx. This approach identified protein‐tyrosine phosphatase D1 (PTPD1) as a binding partner of the Bmx PH domain (Jui et al., 2000). PTPD1 was found to enhance Bmx kinase activity, as well as STAT3 activity. In addition, PTPD1 can activate Tec, suggesting a more general role of PTPD1 in the regulation of Tec kinases (Jui et al., 2000). Interestingly, a direct Bmx–STAT3 interaction has also been reported. Further, overexpression of a dominant‐negative form of Bmx reduced v‐Src‐mediated activation of STAT3 in a rat liver cell line (Tsai et al., 2000). Together, these finding suggest an important role for Bmx in STAT3 activation and cell transformation. 3.5.7. c‐cbl Several Tec kinases bind to the proto‐oncogene, c‐cbl, a ubiquitin‐ligase. c‐cbl contains a unique tyrosine kinase binding (TKB) domain that recognizes phosphotyrosine residues on activated tyrosine kinases (Meng et al., 1999). Generally, c‐cbl exerts its regulatory capacity through interactions with receptor tyrosine kinases. However, both Itk and Btk have been shown to interact
160
MARTIN FELICES ET AL.
with c‐cbl via their SH3 domains binding to proline‐rich motfis in c‐cbl (Bunnell et al., 1996; Cory et al., 1995). 3.5.8. Caveolin‐1 One report describes an interaction between Btk and Bmx with the membrane‐organizing coat protein, caveolin‐1 (Vargas et al., 2002). Caveolin complexes with membrane components such as cholesterol and sphingolipids to form caveolae, subsets of lipid rafts (Harris et al., 2002). In the case of Btk, the kinase domain was verified as the critical mediator of this interaction. Together with the finding that caveolin‐1 downregulates tyrosine phosphorylation of Btk as well as Btk in vitro autokinase activity, these data suggest that caveolins may function as negative regulators of antigen receptor signaling. 4. Regulation of Tec Kinase Activation 4.1. Regulation by Tyrosine Phosphorylation In addition to membrane localization and interaction with adapter molecules, Tec family kinase activity is regulated by tyrosine phosphorylation. As with Src family kinases, phosphorylation occurs in a conserved activation loop in the kinase domain that generally results in a conformational change allowing substrate access to the catalytic site of the kinase domain (Berg et al., 2005; Roskoski, 2005). Unlike Src family kinases, Tec family kinases do not autophosphorylate initially and instead require transphosphorylation in the kinase domain by Src family tyrosine kinases (Chamorro et al., 2001; Debnath et al., 1999; Heyeck et al., 1997; Mahajan et al., 1995; Mano et al., 1996; Rawlings et al., 1996). Following phosphorylation by Src family kinases, Tec family kinases, at least Btk and Itk, then undergo autophosphorylation (Park et al., 1996; Rawlings et al., 1996; Wilcox and Berg, 2003). The initial transphosphorylation, which augments enzymatic activity of the Tec kinases, has been studied primarily for Btk and Itk, and to a lesser extent for Rlk and Tec. Mutational analyses of Itk and Rlk show that replacement of these tyrosine residues with phenylalanine (Itk‐Y511 and Rlk‐Y420) reduces in vitro kinase activity (Chamorro et al., 2001; Heyeck et al., 1997). Lck seems to be crucial for the transphosphorylation for Itk, as Jurkat T cells lacking Lck exhibit no TCR‐induced tyrosine phosphorylation of Itk (Gibson et al., 1996; Heyeck et al., 1997). In contrast, immunoprecipitation analysis together with in vitro kinase assays indicate that Rlk is transphosphorylated by Fyn, and not Lck (Chamorro et al., 2001; Debnath et al., 1999). Tec is activated by Lyn (Mano et al., 1996), whereas Btk seems to require both Lyn and Syk (Kurosaki and Kurosaki, 1997).
Te c
KINASES IN T CELL AND MAST CELL SIGNALING
161
Following transphosphorylation, Itk, Btk, and Bmx autophosphorylate on conserved residues in the SH3 domain (Park et al., 1996; Rawlings et al., 1996; Wilcox and Berg, 2003) (Itk Y180, Btk Y223, and Bmx Y215, the Tec SH3 domain is tyrosine phosphorylated at a nonhomologous site (Y206) (Nore et al., 2003). Mutational analyses of these autophosphorylation sites have been somewhat confusing. Substitution of Btk Y223 with phenylalanine has little effect on Btk activity in DT‐40 B cells, but seems to promote Btk activity in fibroblasts (Kurosaki and Kurosaki, 1997; Park et al., 1996). In contrast, mutation of Itk Y180 impairs Itk function in the TCR response (Wilcox and Berg, 2003). It is important to keep in mind that these residues are located in the SH3 domain, a region required for inter‐ and intramolecular interactions; thus, the consequences of these amino acid substitutions may, in part, be due to effects on protein–protein interactions rather than on catalytic activity. 4.2. Inter‐ and Intramolecular Domain Interactions The regulation of many PTKs is mediated by conformational changes that dictate the catalytic activity of the enzyme. For instance, Src family kinases are maintained in an inactive state prior to signaling via intramolecular interactions that stabilize binding of the SH2 domain to the C‐terminal negative regulatory phosphotyrosine (Roskoski, 2004). Tec family kinases lack this C‐terminal autoinhibitory sequence, and thus, are likely regulated by a distinct mechanism from that of the Src family kinases. The three‐dimensional X‐ray crystal structures of the Itk kinase domain in both the active (phosphorylated) and inactive (unphosphorylated) forms have been solved, and interestingly, are virtually identical; these findings suggest that additional domains of Itk beyond the kinase domain are required for the regulation of Itk activity (Brown et al., 2004). Several lines of evidence further suggest that conformational changes involving multiple protein domains are critical for the regulation of Tec family kinases (Fig. 4). For instance, the SH3 domains of Itk, Tec, and Btk, but not Rlk, can each interact with their neighboring PRR, precluding interactions of these domains with alternative ligands (Andreotti et al., 1997; Laederach et al., 2002, 2003; Pursglove et al., 2002). Tec family kinases favor intermolecular formation of homodimers over intramolecular interactions. Rlk, Tec, and Btk from homodimers via their PRR and SH3 domains, while Itk, distinctly, forms homodimers via its SH2 and SH3 domains (Brazin et al., 2000). While not yet definitively demonstrated, it seems likely that these interdomain interactions yield inactive forms of the Tec kinases. Differences in the regulatory mechanisms mediated by intra‐ and intermolecular domain interactions have been observed between the Tec kinase family
162
MARTIN FELICES ET AL.
Figure 4 Models of Tec kinase regulation via intra‐ and intermolecular interactions. (A) Unlike the other Tec family kinases, Rlk does not appear to undergo intramolecular interactions. Instead, at steady state levels, Rlk may exist as an intermolecular homodimer engaged through SH3–PRR interactions. On TCR activation, Rlk is proposed to undergo a conformational change prompted by transphosphorylation of its kinase domain and autophosphorylation of the SH3 domain. This would inhibit homodimerization and lead to interactions of the SH2 and SH3 domains with other signaling components (adapters). (B) Itk is proposed to undergo intramolecular interactions via the SH3 and PRR regions. However, at steady state levels, the preferred conformation is an intermolecular homodimer mediated by SH2 and SH3 binding. This mode of interaction is distinct from the other Tec family kinases, which form homodimers through SH3–PRR interactions. On TCR activation, Itk may undergo a conformational change prompted by transphosphorylation of
Te c
KINASES IN T CELL AND MAST CELL SIGNALING
163
members. For instance, disruption of SH3–PRR interaction, which dramatically increases kinase activity of Btk and Tec, has minimal effects on Itk kinase activity (Ching et al., 2000; Hao and August, 2002; Li et al., 1995; Wilcox and Berg, 2003; Yamashita et al., 1996). These data fit models of Btk regulation, since the Btk PRR binds to Src family kinases, possibly providing an activation signal; in contrast, the effect of altered accessibility of the Itk PRR has not been elucidated (Bunnell et al., 2000; Cheng et al., 1994; Yang et al., 1995). Nonetheless, these data suggest that Itk uses a distinct mechanism of regulating ligand binding.
5. Distinct Versus Redundant Functions of Tec Kinases 5.1. Tec Kinases in T Cell Development Several lines of evidence indicate a role for Tec family kinases in T cell development and selection. Here again, Itk appears to have the principal role, with Rlk and Tec having little to no known effects (Berg et al., 2005; Liao and Littman, 1995; Liu et al., 1998; Schaeffer et al., 1999). Experiments using Itk‐deficient mice crossed to TCR transgenic lines demonstrated a role for Itk in positive selection (Liao and Littman, 1995; Lucas et al., 2002; Schaeffer et al., 2000). Specifically, positive selection into the CD4 lineage is less efficient when Itk is absent (Lucas et al., 2002). Other studies have indicated that a deficiency in Itk, or both Itk and Rlk, leads to impaired negative selection; in some cases, a deficiency in Itk may cause a delay, rather than a block in negative selection (Lucas et al., 2003; Schaeffer et al., 2000). Consistent with these defects, Itk‐deficient mice also have a mild defect in natural killer‐T (NKT) cell development that increases in severity as the mice age (Gadue and Stein, 2002). Of interest, recent publications have demonstrated a role for Itk and Rlk in CD8 T cell development and function (Atherly et al., 2006a,b; Broussard et al., 2006; Dubois et al., 2006). Mice deficient in Itk have increased numbers and the kinase domain and autophosphorylation of the SH3 domain. This conformational switch is accompanied by cis–trans proline isomerization in the SH2 domain of Itk. These changes inhibit dimerization and lead to SH2 and SH3 domains accessibility for binding to other signaling components (adapters). (C, D) Tec and Btk can undergo intramolecular interactions via SH3– PRR binding. However, at steady state levels, intermolecular homodimers, mediated by trans SH3–PRR binding, are the preferred conformations. On antigen receptor activation, Tec and Btk may undergo conformational changes prompted by transphosphorylation of the kinase domains and autophosphorylation of the SH3 domains. These changes would inhibit dimerization and lead to SH2 and SH3 domains interactions with other signaling components (adapters).
164
MARTIN FELICES ET AL.
percentages of CD8 single positive (SP) T cells in the thymus (Lucas et al., 2002). Three studies have analyzed these cells more closely and have concluded that they share features with lineages of innate and memory CD8þ T cells (Atherly et al., 2006b; Broussard et al., 2006; Dubois et al., 2006). Specifically, CD8þ T cells in mice lacking Itk, or both Itk and Rlk, are CD44hi, CD122þ, and NK1.1þ; further, these cells produce Interferon‐g directly ex vivo, and can be selected on bone marrow‐derived major histocompatibility complex (MHC) class I molecules—all characteristics of innate T cells such NKT cells and MHC class‐Ib‐restricted T cells (Kronenberg, 2005; Rodgers and Cook, 2005). Differences between the Itk/ and the Itk/Rlk/ CD8þ T cells are minimal, indicating a role for Itk, but not Rlk, in regulating the development of these cells. Given that T cell development appears normal in Tec‐deficient mice, it is not likely that Tec contributes significantly to the development of CD8þ T cells (Ellmeier et al., 2000). Taken together, these findings suggest a role for Tec kinases in the development of both adaptive and innate lymphocytes. 5.2. Tec Kinases in Other Cell Types There is much less data that establishes the functional importance of Tec family kinases that are found in hematopoietic cells other than lymphocytes (for review, see Schmidt et al., 2004). Btk is the best‐studied, and is present in many hematopoietic lineages. For instance, monocytes/macrophages devoid of Btk have been shown to be impaired in TNF production, phagocytosis, and nitric oxide production (Horwood et al., 2003; Mukhopadhyay et al., 2002). Functions of platelets derived from signals through the GPVI also seem to be impaired with Btk and Btk/Tec deficiency (Atkinson et al., 2003; Quek et al., 1998). Contrary to these reports that indicate a positive influence of Btk in these cells, one study demonstrates that Btk may play a negative role in the development and function of dendritic cells (Kawakami et al., 2006). 5.3. Redundancy Among Tec Kinase Family Members As described above, T cells, B cells, and mast cells each express multiple Tec kinase family members (Fig. 5). In T cells, Itk appears to be the predominant Tec kinase expressed, based on biochemical analyses of TCR signaling pathways in T cells lacking each of the Tec family kinases. The basic conclusions from these studies were that Tec and Rlk play little essential role in TCR signaling; further, these studies indicated that a deficiency in both Itk and Rlk created the most severe defect (Schaeffer et al., 1999). The hierarchy of impaired signaling correlates with the expression levels of each Tec kinase in naı¨ve T cells. In addition, the enhanced defect in the Itk/Rlk‐deficient T cells indicates some
Te c
KINASES IN T CELL AND MAST CELL SIGNALING
165
Figure 5 Differential expression of Tec family kinases in T cells, B cells, and mast cells. Itk, Rlk, and Tec are expressed in T cells, while Btk and Tec are expressed in B cells. Current data indicate that Tec kinases in T cells and B cells mediate activation of PLC‐g downstream of Src kinases following antigen receptor stimulation. In mast cells, which express all of these Tec kinases, only the positive role of Btk has been established.
redundancy between these two family members in TCR signaling (Schaeffer et al., 1999). In contrast, the role of Tec in TCR signaling has been more difficult to discern. While Tec‐deficient primary T cells are unimpaired (Ellmeier et al., 2000), overexpression of Tec in T cell tumor lines enhances TCR signaling leading to increased NFAT activation (Tomlinson et al., 2004b). Tec may also have a more prominent role in signaling in previously activated T cells (Altman et al., 2004). In B cells, an analogous situation has been observed with Btk and Tec. While primary B cells lacking Btk are severely impaired in BCR signaling (Takata and Kurosaki, 1996), B cells lacking Tec are not (Ellmeier et al., 2000). However, in the absence of both Btk and Tec, BCR signaling is further impaired to the extent that doubly deficient mice totally lack mature B cells, suggesting redundant functions for these two Tec kinases in B cells (Ellmeier et al., 2000). Interestingly, reconstitution studies performed in Btk‐deficient DT‐40 B cells indicate that Rlk, Tec, and Itk can each restore PLC‐g phosphorylation and Ca2þ mobilization in these cells in response to BCR stimulation; however, Itk and Tec, but not Rlk are also able to restore BCR‐induced apoptosis (Tomlinson et al., 1999). While evidence for redundancies in function among Tec kinases is apparent, additional data indicate that each Tec kinase also shows unique characteristics. For instance, in in vitro studies, overexpression of Tec and Rlk augment PLC‐g phosphorylation and downstream events; in contrast, overexpression of Itk
166
MARTIN FELICES ET AL.
seems to have no effect (Sommers et al., 1999; Tomlinson et al., 2004b). It may be that differences in intermolecular interactions and modes of regulation of the Tec family members account for these disparate outcomes. Furthermore, overexpression of Btk has no ability to enhance T cell signaling, in spite of the similar role of Btk in activating PLC‐g in B cells and mast cells (Tomlinson et al., 2004b); this failure may result from an inability of Btk to interact properly with T cell‐specific adapters and other signaling proteins. Thus far, mast cells are the only cell type known to express the four predominant Tec kinases, Btk, Itk, Rlk, and Tec (Sommers et al., 1995; Yamada et al., 1993; and our unpublished observations). Thus, although little is currently known about Itk, Rlk, or Tec in these cells, studies of mast cells present an opportunity to examine the interplay between these Tec kinases residing in a single cell type. 6. Tec Kinases in Mast Cell Signaling 6.1. Overview of Mast Cells Mast cells are widely accepted as effector cells in allergic responses and innate immunity (for recent comprehensive reviews, see Galli et al., 2005a; Okayama and Kawakami, 2006). Mounting evidence has established a role for mast cells in adaptive immune responses (Galli et al., 2005b). Overall, these cells are capable of widespread influence due to the impressive variety of mediators, both pro‐ and anti‐inflammatory, that they release upon stimulation. During innate immune responses, mast cells are highly specialized to respond rapidly upon stimulation, and can serve as ‘‘sentinels’’ that alert the local surroundings to rapidly counter potentially detrimental challenges. This is due to the presence of numerous granules containing preformed factors that are released by exocytosis within seconds to minutes following mast cell triggering. Many different factors are sequestered in these granules, including histamine, serotonin, a variety of proteases, and a number of cytokines. In addition to degranulation, activated mast cells also respond within minutes of stimulation by producing proinflammatory arachidonic acid metabolites such as leukotrienes and prostaglandins. These early‐phase mediators not only enhance responses such as vascular permeability and smooth muscle contraction but also have direct effects on immune cells that express the appropriate receptors (Galli et al., 2005b). The recent escalated interest in mast cells is based largely on a growing appreciation for the later responses of these cells, specifically, the de novo synthesis of cytokines and chemokines that drive adaptive immune responses and of which mast cells are known to produce a large variety. The use of mast
Te c
KINASES IN T CELL AND MAST CELL SIGNALING
167
cell‐deficient mice in a variety of immunopathological settings has been especially revealing, indicating a role for mast cells in situations such as autoimmunity and transplant tolerance (Lu et al., 2006; Rottem and Mekori, 2005; Tsai et al., 2005). These studies have definitively expanded the role of mast cells from innate effectors to integral participants of acquired immunity. 6.2. FceR1 Signaling The process of mast cell activation through stimulation of the high‐affinity receptor for IgE (FceR1) involves a complex series of signaling events (for comprehensive reviews, see Gilfillan and Tkaczyk, 2006; Rivera and Gilfillan, 2006) (Fig. 6). Like the antigen receptors for T cells and B cells, FceR1 is a multisubunit receptor containing ITAM motifs that are phosphorylated following receptor aggregation. Signaling events downstream of FceR1 are known
Figure 6 Activation of receptor–proximal pathways in FceR1 signaling. Aggregation of FceR1 induces the activation of Lyn and Syk tyrosine kinases. This results in the formation of a multiprotein complex anchored by LAT at the membrane. Btk is believed to associate with this complex and directly phosphorylate and activate PLC‐g. A similar function may also exist for the other Tec kinases, Itk, Rlk, and Tec in mast cells, but this is currently unknown (?). In addition, FceR1 aggregation also activates a parallel pathway that is initiated by Fyn. This pathway leads to PI3K activation and thus, to the production of PIP3. PIP3 stabilizes the recruitment of PH domain‐ containing proteins, such as the Tec kinases, to the activated receptor.
168
MARTIN FELICES ET AL.
to utilize intermediates that are common to both B cells and T cells, and therefore, it is not surprising that many of the biochemical pathways described in lymphocyte signaling are shared with mast cells. The earliest FceR1 activation‐induced signaling events require the recruitment and activation of tyrosine kinases. In mast cells, the Src‐family kinase Lyn binds to FceR1 and phosphorylates the b and g chain ITAMs of FceR1, which induces the recruitment and activation of Syk. This potentiates the formation of a complex of proteins that are brought into close proximity by their interaction, directly or indirectly, with the adaptor molecule LAT (Rivera et al., 2001). Components of this complex include Grb2, Gads, PLC‐g1, PLC‐g2, SLP‐76, and Vav. Btk (and other Tec kinases) is also assumed to participate in this LAT‐ anchored complex in mast cells, given their key role in regulating PLC‐g in lymphocytes. Similar to lymphocytes, PLC‐g activation is a crucial outcome of assembling this complex in mast cells, as indicated by the reduced levels of FceR1‐induced PLC‐g activation and Ca2þ release observed in mast cells that lack proteins associated with this complex (Manetz et al., 2001; Pivniouk et al., 1999; Saitoh et al., 2000). Signaling defects in these mutant mast cells also translate to impairments in degranulation and cytokine responses. In addition to signaling processes that are known to stem directly from PLC‐g activation, PI3K‐dependent pathways also play an essential role in FceR1‐ induced signaling (Fukao et al., 2003). As discussed above, PI3K‐catalyzed PIP3 production is important for recruitment of PH domain‐containing proteins, including Tec family kinases. However, the PI3K pathway has been postulated to be distinct, although functionally complementary to the LAT– PLC‐g pathway (Parravicini et al., 2002). This pathway is linked to the Src kinase Fyn, which, like Lyn, also associates with FceR1. Fyn activation leads to Gab2 phosphorylation and association with the p85 subunit of PI3K, enabling PI3K activity. Evidence suggests that this axis is particularly important in sustaining Ca2þ signals necessary for degranulation responses of mast cells, but it is clear that PI3K‐mediated pathways are necessary for overall optimal mast cell function, since cytokine responses are also attenuated in mice that lack molecules involved in this pathway (Gu et al., 2001; Parravicini et al., 2002). FceR1‐proximal events culminate in the activation of multiple downstream pathways, including the MAP kinases p38, ERK, and JNK, as well as the NF‐kB and NFAT family transcription factors. As expected, these activation events are also coupled to the induction of negative regulatory events. For instance, deficiencies in SHIP or PTEN in mast cells results in functional hyperresponsiveness (Furumoto et al., 2006; Huber et al., 1998; Kalesnikoff et al., 2002). Additionally, it is well established that Lyn phosphorylation of ITIM
Te c
KINASES IN T CELL AND MAST CELL SIGNALING
169
motifs in receptors such as FcgRIIb is critical (Ali et al., 2004; Gomez et al., 2005; Gu et al., 2001), as highlighted by the hyperresponsiveness of Lyn/ mast cells (Hernandez‐Hansen et al., 2003; Malbec et al., 1998; Odom et al., 2004). How extracellular stimuli, as well as the coinduction of inhibitory receptors, elicit distinct functional responses from mast cells is still poorly understood.
6.3. Btk in Mast Cell Function and Signaling The key role of Btk in mast cell activation has been established by extensive studies conducted by Kawakami and colleagues. Initially, these investigators showed that Btk is phosphorylated following FceR1 stimulation, suggesting a functional role for Btk in this pathway (Kawakami et al., 1994). Indeed, Btk‐ deficient and xid (expressing functionally inactive Btk protein) mast cells demonstrate multiple defects in effector function. Specifically, in vitro degranulation responses have been found to be modestly impaired (Hata et al., 1998; Heinonen et al., 2002; Kawakami et al., 2000b; Setoguchi et al., 1998). This finding was supported by studies demonstrating defective anaphylactic reactions elicited in vivo in Btk/ mice (Hata et al., 1998). Leukotriene production by Btk/ mast cells is also impaired (Kawakami et al., 2000b). Further, Btk is critical in regulating de novo cytokine production; antigen‐induced secretion of GM‐CSF, TNF‐a, IL‐2, and IL‐6 are all reduced with Btk/ mast cells (Hata et al., 1998). In the case of IL‐2 and TNF‐a, deficient cytokine secretion was found to be due to impaired transcription of these genes. The biochemical consequences of the Btk deficiency in mast cells closely parallel that seen in B cells following BCR stimulation (Fig. 5). For example, Btk/ mast cells are impaired in PLC‐g2 activation, IP3 generation, and Ca2þ mobilization (Kawakami et al., 2000b). Additionally, Akt phosphorylation is reduced in Btk/ mast cells, indicating that PI3K activity is impaired (Kitaura et al., 2000). These defects are accompanied by a failure to activate the JNK and p38 MAPK pathways to normal levels (Kawakami et al., 1997). However, in contrast to the defects in B cell development observed in the absence of Btk, mast cell development both in vivo and in vitro appears normal. Interestingly, in vitro culture of Btk/ bone marrow cells with IL‐3 produces increased numbers of mast cells; this increase is associated with a defect in JNK‐dependent apoptosis on IL‐3 withdrawal (Kawakami et al., 1997). These data suggest that Btk is required for signaling events distinct from those initiated by FceR1. In this regard, Btk has been found to associate with c‐kit and to be involved in mast cell c‐kit signaling (Iwaki et al., 2005; Setoguchi et al., 1998).
170
MARTIN FELICES ET AL.
6.4. Possible Role of Itk in Mast Cells Initial studies carried out by the Kawakami laboratory indicate that Itk participates, albeit in an unknown capacity, in mast cell signaling pathways (Kawakami et al., 1995; Yamada et al., 1993). As in T cells, endogenous Itk is phosphorylated and activated in FceR1‐stimulated bone marrow‐derived mast cells. Furthermore, like Btk, Itk was found to interact with multiple PKC members in mast cells (Kawakami et al., 1995). To date, one report has addressed the functional responses of mast cells in Itk‐deficient mice. Although this study indicated that mast cells in Itk/ mice were present in normal numbers with unaltered morphology, these cells exhibited more profound defects than mast cells lacking Btk (Forssell et al., 2005). Itk/ mast cells were found to be significantly impaired in an allergic airway inflammation model in which the extent of degranulation can be measured by plasma extravasation and direct visualization of mast cell granules. An issue to consider with these (and other) in vivo studies is the potential contribution of the overall environment in intact Itk/ mice. Since mast cells develop from precursors that leave the bone marrow and differentiate in the periphery, the possibility that systemic differences between wild type and Itk‐ deficient mice could influence in vivo mast cell biology cannot be ruled out. For instance, it has been noted that Itk/ mice have elevated levels of serum IgE (Schaeffer et al., 2001). IgE alone, in the absence of antigen, has been shown to generate signals that can modify the characteristics of mast cells by enhancing their survival and increasing surface FceR1 expression (Kawakami and Galli, 2002). The possibility also exists that the high levels of spontaneous IgE bound to mast cells might prevent antigen‐specific IgE from aggregating and inducing degranulation in the allergy model used. Despite these concerns, the in vivo data described above are noteworthy; it will be interesting to determine whether future in vitro studies will provide data to support these conclusions. 6.5. Potential Positive Roles of Multiple Tec Kinases in Mast Cells Thus far, potential functional redundancy of Tec kinases in mast cells has not been addressed. Given the positive role of Itk in promoting optimal activation of PLC‐g1 in T cells, as well as the known function of Btk in mast cells, it is possible that Itk also promotes PLC‐g activation in mast cells. This type of redundancy might be revealed by studies of Itk/ mast cells, or possibly, only by analyses of doubly deficient Itk/Btk/ mast cells. As mentioned above, T cells from Rlk/ mice are nearly normal, whereas T cells lacking both Itk and Rlk exhibit defects more severe than T cells lacking Itk alone. These data have suggested that Rlk is partially able to compensate for the absence of Itk
Te c
KINASES IN T CELL AND MAST CELL SIGNALING
171
(Schaeffer et al., 1999). A similar situation has been observed for Btk and Tec in B cells (Ellmeier et al., 2000). Given the defects seen in Btk‐deficient mast cells, it is clear that the presence of Itk, Rlk, and Tec at endogenous levels is insufficient to fully compensate for the loss of Btk. However, despite the critical role of Btk in regulating PLC‐g2, a deficiency in Btk does not render mast cells as severely compromised as does a deficiency in LAT or Syk (Costello et al., 1996; Saitoh et al., 2000), suggesting the possibility that the other Tec kinases may partially compensate for the absence of Btk. Consistent with this notion, when Itk was overexpressed in Btk/ mast cells, a partial restoration of responses was observed (Hata et al., 1998). Similarly, it has been shown that overexpression of Itk, Tec, or Rlk can restore function to Btk/ B cells (Fluckiger et al., 1998; Tomlinson et al., 1999). As the enzymatic activity of Itk has been reported to be less potent than that of Btk (Hawkins and Marcy, 2001; Lowry et al., 2001), it is possible that even higher levels of Itk may be necessary to functionally replace Btk in mast cells. In addition to differences in the expression levels and catalytic activities of Btk, Itk, Rlk, and Tec, it is likely that these kinases also have different functions based on their nonenzymatic domains. Although Rlk/ T cells and mice have few obvious defects, studies suggest that Itk and Rlk have distinct functions in T cells. For example, Itk and Rlk display differential expression in T helper‐ type 1 (Th1) and Th2 cells (Miller et al., 2004). Itk, Rlk, and Tec also have different localization patterns, as described above. Therefore, the possibility exists that Btk and Itk are also important for different types of effector functions or at different stages of development in mast cells. 6.6. Potential Negative Roles for Tec Kinases in Mast Cell Signaling Although the current evidence suggests that Itk plays a positive role in mast cells, it is worth considering a potential negative regulatory role for Itk in these cells. As mentioned briefly above, an interesting study suggests that Btk performs a negative regulatory function in dendritic cells, despite the established positive function it has in B cells and mast cells (Kawakami et al., 2006). Such data open up the possibility that Tec family kinases may have unexpected roles in distinct cell types. A precedent for this has been seen in recent studies demonstrating hyperresponsiveness of mast cells lacking particular intracellular signaling molecules, suggesting a role for these proteins in antagonizing positive responses. For instance, intriguing data has emerged from the study of LAT and its structural homologues, LAT2 (LAB, NTAL), and LAX in mast cells (Saitoh et al., 2000; Volna et al., 2004; Zhu et al., 2004, 2006). LAT is a necessary component of positive signaling in T cells, functioning as a scaffolding protein that links upstream phosphorylation events to PLC‐g‐dependent
172
MARTIN FELICES ET AL.
signaling. As might be expected from its positive role in T cells, LAT/ mast cells are significantly impaired in effector function. LAT2 shares homology with LAT but importantly, does not bind to PLC‐g. Upon disruption of LAT2, B cells behave relatively normally, but surprisingly, LAT2/ mast cells showed enhanced responses compared to wild‐type, suggesting a negative role for LAT2 in mast cell signaling (Janssen et al., 2003). Interestingly, when both LAT2 and LAT are absent, mast cell responses are more defective than in the absence of LAT alone. Therefore, LAT2 may function as an inefficient replacement for LAT when LAT is absent, but may act predominantly to negatively regulate LAT when both family members are present. Furthermore, LAX/ mast cells also share a phenotype similar to that of LAT2/ mast cells. The mechanism underlying these latter observations is still not established; LAT2 may compete with LAT for localization and signaling partners, or may be critical in a distinct pathway that interferes with positive LAT signals. Regardless of the mechanism, a similar scenario can be envisioned for the Tec kinases in mast cells, where Btk is the dominant kinase based on high levels of expression and/or kinase activity, and Itk (or the others) has a predominantly negative regulatory role. 7. Conclusions This chapter has summarized the known functions of Tec family tyrosine kinases in T cell and mast cell signaling, focusing on the biochemical interactions and modes of regulation of Itk, Btk, Rlk, and Tec. Overall, the current data indicate some degree of redundancy among these kinases, based on observations of modest deficiencies in cells lacking a single Tec kinase, and more severe deficiencies in the absence of two family members. Nonetheless, distinct activities, binding partners, subcellular localization, and intra‐ and intermolecular domain interactions have been seen for each individual Tec kinase. These findings highlight the fact that, while each Tec kinase family member shares some functional activities with the others members, a unique role for each kinase in each distinct cell type is likely to be found. Acknowledgments This work was supported by grants from the NIH (AI37584 and AI66118) and the Center for Disease Control (CI000101).
References Abassi, Y. A., Rehn, M., Ekman, N., Alitalo, K., and Vuori, K. (2003). p130Cas couples the tyrosine kinase Bmx/Etk with regulation of the actin cytoskeleton and cell migration. J. Biol. Chem. 278, 35636–35643.
Te c
KINASES IN T CELL AND MAST CELL SIGNALING
173
Ali, K., Bilancio, A., Thomas, M., Pearce, W., Gilfillan, A. M., Tkaczyk, C., Kuehn, N., Gray, A. Giddings, J., Peskett, E., Fox, R., Bruce, I., et al. (2004). Essential role for the p110delta phosphoinositide 3‐kinase in the allergic response. Nature 431, 1007–1011. Altman, A., Kaminski, S., Busuttil, V., Droin, N., Hu, J., Tadevosyan, Y., Hipskind, R. A., and Villalba, M. (2004). Positive feedback regulation of PLCgamma1/Ca(2þ) signaling by PKCtheta in restimulated T cells via a Tec kinase‐dependent pathway. Eur. J. Immunol. 34, 2001–2011. Amson, R., Sigaux, F., Przedborski, S., Flandrin, G., Givol, D., and Telerman, A. (1989). The human protooncogene product p33pim is expressed during fetal hematopoiesis and in diverse leukemias. Proc. Natl. Acad. Sci. USA 86, 8857–8861. Andreotti, A. H., Bunnell, S. C., Feng, S., Berg, L. J., and Schreiber, S. L. (1997). Regulatory intramolecular association in a tyrosine kinase of the Tec family. Nature 385, 93–97. Aoki, N., Ueno, S., Mano, H., Yamasaki, S., Shiota, M., Miyazaki, H., Yamaguchi‐Aoki, Y., Matsuda, T., and Ullrich, A. (2004). Mutual regulation of protein‐tyrosine phosphatase 20 and protein‐tyrosine kinase Tec activities by tyrosine phosphorylation and dephosphorylation. J. Biol. Chem. 279, 10765–10775. Atherly, L. O., Brehm, M. A., Welsh, R. M., and Berg, L. J. (2006a). Tec kinases Itk and Rlk are required for CD8þ T cell responses to virus infection independent of their role in CD4þ T cell help. J. Immunol. 176, 1571–1581. Atherly, L. O., Lucas, J. A., Felices, M., Yin, C. C., Reiner, S. L., and Berg, L. J. (2006b). The Tec family tyrosine kinases Itk and Rlk regulate the development of conventional CD8þ T cells. Immunity 25, 79–91. Atkinson, B. T., Ellmeier, W., and Watson, S. P. (2003). Tec regulates platelet activation by GPVI in the absence of Btk. Blood 102, 3592–3599. August, A., Gibson, S., Kawakami, Y., Kawakami, T., Mills, G. B., and Dupont, B. (1994). CD28 is associated with and induces the immediate tyrosine phosphorylation and activation of the Tec family kinase ITK/EMT in the human Jurkat leukemic T‐cell line. Proc. Natl. Acad. Sci. USA 91, 9347–9351. August, A., Sadra, A., Dupont, B., and Hanafusa, H. (1997). Src‐induced activation of inducible T cell kinase (ITK) requires phosphatidylinositol 3‐kinase activity and the Pleckstrin homology domain of inducible T cell kinase. Proc. Natl. Acad. Sci. USA 94, 11227–11232. Bagheri‐Yarmand, R., Mandal, M., Taludker, A. H., Wang, R. A., Vadlamudi, R. K., Kung, H. J., and Kumar, R. (2001). Etk/Bmx tyrosine kinase activates Pak1 and regulates tumorigenicity of breast cancer cells. J. Biol. Chem. 276, 29403–29409. Bence, K., Ma, W., Kozasa, T., and Huang, X. Y. (1997). Direct stimulation of Bruton’s tyrosine kinase by G(q)‐protein alpha‐subunit. Nature 389, 296–299. Berg, L. J., Finkelstein, L. D., Lucas, J. A., and Schwartzberg, P. L. (2005). Tec family kinases in T lymphocyte development and function. Annu. Rev. Immunol. 23, 549–600. Brazin, K. N., Fulton, D. B., and Andreotti, A. H. (2000). A specific intermolecular association between the regulatory domains of a Tec family kinase. J. Mol. Biol. 302, 607–623. Brazin, K. N., Mallis, R. J., Fulton, D. B., and Andreotti, A. H. (2002). Regulation of the tyrosine kinase Itk by the peptidyl‐prolyl isomerase cyclophilin A. Proc. Natl. Acad. Sci. USA 99, 1899–1904. Breheny, P. J., Laederach, A., Fulton, D. B., and Andreotti, A. H. (2003). Ligand specificity modulated by prolyl imide bond Cis/Trans isomerization in the Itk SH2 domain: A quantitative NMR study. J. Am. Chem. Soc. 125, 15706–15707. Breuer, M. L., Cuypers, H. T., and Berns, A. (1989). Evidence for the involvement of pim‐2, a new common proviral insertion site, in progression of lymphomas. EMBO J. 8, 743–748.
174
MARTIN FELICES ET AL.
Broussard, C., Fleischecker, C., Horai, R., Chetana, M., Venegas, A. M., Sharp, L. L., Hedrick, S. M., Fowlkes, B. J., and Schwartzberg, P. L. (2006). Altered development of CD8þ T cell lineages in mice deficient for the Tec kinases Itk and Rlk. Immunity 25, 93–104. Brown, K., Long, J. M., Vial, S. C., Dedi, N., Dunster, N. J., Renwick, S. B., Tanner, A. J., Frantz, J. D., Fleming, M. A., and Cheetham, G. M. (2004). Crystal structures of interleukin‐2 tyrosine kinase and their implications for the design of selective inhibitors. J. Biol. Chem. 279, 18727–18732. Bunnell, S. C., Henry, P. A., Kolluri, R., Kirchhausen, T., Rickles, R. J., and Berg, L. J. (1996). Identification of Itk/Tsk Src homology 3 domain ligands. J. Biol. Chem. 271, 25646–25656. Bunnell, S. C., Diehn, M., Yaffe, M. B., Findell, P. R., Cantley, L. C., and Berg, L. J. (2000). Biochemical interactions integrating Itk with the T cell receptor‐initiated signaling cascade. J. Biol. Chem. 275, 2219–2230. Chamorro, M., Czar, M. J., Debnath, J., Cheng, G., Lenardo, M. J., Varmus, H. E., and Schwartzberg, P. L. (2001). Requirements for activation and RAFT localization of the T‐lymphocyte kinase Rlk/Txk. BMC Immunol. 2, 3. Chan, T. O., Rittenhouse, S. E., and Tsichlis, P. N. (1999). AKT/PKB and other D3 phosphoinositide‐ regulated kinases: Kinase activation by phosphoinositide‐dependent phosphorylation. Annu. Rev. Biochem. 68, 965–1014. Chen, R., Kim, O., Li, M., Xiong, X., Guan, J. L., Kung, H. J., Chen, H., Shimizu, Y., and Qiu, Y. (2001). Regulation of the PH‐domain‐containing tyrosine kinase Etk by focal adhesion kinase through the FERM domain. Nat. Cell Biol. 3, 439–444. Cheng, G., Ye, Z. S., and Baltimore, D. (1994). Binding of Bruton’s tyrosine kinase to Fyn, Lyn, or Hck through a Src homology 3 domain‐mediated interaction. Proc. Natl. Acad. Sci. USA 91, 8152–8155. Ching, K. A., Kawakami, Y., Kawakami, T., and Tsoukas, C. D. (1999). Emt/Itk associates with activated TCR complexes: Role of the pleckstrin homology domain. J. Immunol. 163, 6006–6013. Ching, K. A., Grasis, J. A., Tailor, P., Kawakami, Y., Kawakami, T., and Tsoukas, C. D. (2000). TCR/ CD3‐Induced activation and binding of Emt/Itk to linker of activated T cell complexes: Requirement for the Src homology 2 domain. J. Immunol. 165, 256–262. Colgan, J., Asmal, M., Neagu, M., Yu, B., Schneidkraut, J., Lee, Y., Sokolskaja, E., Andreotti, A., and Luban, J. (2004). Cyclophilin A regulates TCR signal strength in CD4þ T cells via a proline‐ directed conformational switch in Itk. Immunity 21, 189–201. Cory, G. O., Lovering, R. C., Hinshelwood, S., MacCarthy‐Morrogh, L., Levinsky, R. J., and Kinnon, C. (1995). The protein product of the c‐cbl protooncogene is phosphorylated after B cell receptor stimulation and binds the SH3 domain of Bruton’s tyrosine kinase. J. Exp. Med. 182, 611–615. Costello, P. S., Turner, M., Walters, A. E., Cunningham, C. N., Bauer, P. H., Downward, J., and Tybulewicz, V. L. (1996). Critical role for the tyrosine kinase Syk in signalling through the high affinity IgE receptor of mast cells. Oncogene 13, 2595–2605. Crabtree, G. R., and Olson, E. N. (2002). NFAT signaling: Choreographing the social lives of cells. Cell 109(Suppl.), S67–S79. Dal Porto, J. M., Gauld, S. B., Merrell, K. T., Mills, D., Pugh‐Bernard, A. E., and Cambier, J. (2004). B cell antigen receptor signaling 101. Mol. Immunol. 41, 599–613. Debnath, J., Chamorro, M., Czar, M. J., Schaeffer, E. M., Lenardo, M. J., Varmus, H. E., and Schwartzberg, P. L. (1999). rlk/TXK encodes two forms of a novel cysteine string tyrosine kinase activated by Src family kinases. Mol. Cell. Biol. 19, 1498–1507. Dhanasekaran, S. M., Barrette, T. R., Ghosh, D., Shah, R., Varambally, S., Kurachi, K., Pienta, K. J., Rubin, M. A., and Chinnaiyan, A. M. (2001). Delineation of prognostic biomarkers in prostate cancer. Nature 412, 822–826.
Te c
KINASES IN T CELL AND MAST CELL SIGNALING
175
Dombroski, D., Houghtling, R. A., Labno, C. M., Precht, P., Takesono, A., Caplen, N. J., Billadeau, D. D., Wange, R. L., Burkhardt, J. K., and Schwartzberg, P. L. (2005). Kinase‐independent functions for Itk in TCR‐induced regulation of Vav and the actin cytoskeleton. J. Immunol. 174, 1385–1392. Dubois, S., Waldmann, T. A., and Muller, J. R. (2006). ITK and IL‐15 support two distinct subsets of CD8þ T cells. Proc. Natl. Acad. Sci. USA 103, 12075–12080. Egloff, A. M., and Desiderio, S. (2001). Identification of phosphorylation sites for Bruton’s tyrosine kinase within the transcriptional regulator BAP/TFII‐I. J. Biol. Chem. 276, 27806–27815. Ellmeier, W., Jung, S., Sunshine, M. J., Hatam, F., Xu, Y., Baltimore, D., Mano, H., and Littman, D. R. (2000). Severe B cell deficiency in mice lacking the tec kinase family members Tec and Btk. J. Exp. Med. 192, 1611–1624. Fluckiger, A. C., Li, Z., Kato, R. M., Wahl, M. I., Ochs, H. D., Longnecker, R., Kinet, J. P., Witte, O. N., Scharenberg, A. M., and Rawlings, D. J. (1998). Btk/Tec kinases regulate sustained increases in intracellular Ca2þ following B‐cell receptor activation. EMBO J. 17, 1973–1985. Forssell, J., Sideras, P., Eriksson, C., Malm‐Erjefalt, M., Rydell‐Tormanen, K., Ericsson, P. O., and Erjefalt, J. S. (2005). Interleukin‐2‐inducible T cell kinase regulates mast cell degranulation and acute allergic responses. Am. J. Respir. Cell Mol. Biol. 32, 511–520. Fowell, D. J., Shinkai, K., Liao, X. C., Beebe, A. M., Coffman, R. L., Littman, D. R., and Locksley, R. M. (1999). Impaired NFATc translocation and failure of Th2 development in Itk‐deficient CD4þ T cells. Immunity 11, 399–409. Fukao, T., Terauchi, Y., Kadowaki, T., and Koyasu, S. (2003). Role of phosphoinositide 3‐kinase signaling in mast cells: New insights from knockout mouse studies. J. Mol. Med. 81, 524–535. Furumoto, Y., Brooks, S., Olivera, A., Takagi, Y., Miyagishi, M., Taira, K., Casellas, R., Beaven, M. A., Gilfillan, A. M., and Rivera, J. (2006). Cutting Edge: Lentiviral short hairpin RNA silencing of PTEN in human mast cells reveals constitutive signals that promote cytokine secretion and cell survival. J. Immunol. 176, 5167–5171. Gadue, P., and Stein, P. L. (2002). NK T cell precursors exhibit differential cytokine regulation and require Itk for efficient maturation. J. Immunol. 169, 2397–2406. Galli, S. J., Kalesnikoff, J., Grimbaldeston, M. A., Piliponsky, A. M., Williams, C. M., and Tsai, M. (2005a). Mast cells as ‘‘tunable’’ effector and immunoregulatory cells: Recent advances. Annu. Rev. Immunol. 23, 749–786. Galli, S. J., Nakae, S., and Tsai, M. (2005b). Mast cells in the development of adaptive immune responses. Nat. Immunol. 6, 135–142. Garcon, F., Bismuth, G., Isnardon, D., Olive, D., and Nunes, J. A. (2004a). Tec kinase migrates to the T cell‐APC interface independently of its pleckstrin homology domain. J. Immunol. 173, 770–775. Garcon, F., Ghiotto, M., Gerard, A., Yang, W. C., Olive, D., and Nunes, J. A. (2004b). The SH3 domain of Tec kinase is essential for its targeting to activated CD28 costimulatory molecule. Eur. J. Immunol. 34, 1972–1980. Gerard, A., Favre, C., Garcon, F., Nemorin, J. G., Duplay, P., Pastor, S., Collette, Y., Olive, D., and Nunes, J. A. (2004). Functional interaction of RasGAP‐binding proteins Dok‐1 and Dok‐2 with the Tec protein tyrosine kinase. Oncogene 23, 1594–1598. Gibson, S., Leung, B., Squire, J. A., Hill, M., Arima, N., Goss, P., Hogg, D., and Mills, G. B. (1993). Identification, cloning, and characterization of a novel human T‐cell‐specific tyrosine kinase located at the hematopoietin complex on chromosome 5q. Blood 82, 1561–1572. Gibson, S., August, A., Kawakami, Y., Kawakami, T., Dupont, B., and Mills, G. B. (1996). The EMT/ITK/TSK (EMT) tyrosine kinase is activated during TCR signaling: LCK is required for optimal activation of EMT. J. Immunol. 156, 2716–2722.
176
MARTIN FELICES ET AL.
Gilfillan, A. M., and Tkaczyk, C. (2006). Integrated signalling pathways for mast‐cell activation. Nat. Rev. Immunol. 6, 218–230. Gomez, G., Gonzalez‐Espinosa, C., Odom, S., Baez, G., Cid, M. E., Ryan, J. J., and Rivera, J. (2005). Impaired FcepsilonRI‐dependent gene expression and defective eicosanoid and cytokine production as a consequence of Fyn deficiency in mast cells. J. Immunol. 175, 7602–7610. Gray, P., Dunne, A., Brikos, C., Jefferies, C. A., Doyle, S. L., and O’Neill, L. A. (2006). MyD88 adapter‐like (Mal) is phosphorylated by Bruton’s tyrosine kinase during TLR2 and TLR4 signal transduction. J. Biol. Chem. 281, 10489–10495. Gu, H., Saito, K., Klaman, L. D., Shen, J., Fleming, T., Wang, Y., Pratt, J. C., Lin, G., Lim, B., Kinet, J. P., and Neel, B. G. (2001). Essential role for Gab2 in the allergic response. Nature 412, 186–190. Guarnieri, D. J., Dodson, G. S., and Simon, M. A. (1998). SRC64 regulates the localization of a Tec‐family kinase required for Drosophila ring canal growth. Mol. Cell 1, 831–840. Guinamard, R., Fougereau, M., and Seckinger, P. (1997). The SH3 domain of Bruton’s tyrosine kinase interacts with Vav, Sam68 and EWS. Scand. J. Immunol. 45, 587–595. Haire, R. N., Ohta, Y., Lewis, J. E., Fu, S. M., Kroisel, P., and Litman, G. W. (1994). TXK, a novel human tyrosine kinase expressed in T cells shares sequence identity with Tec family kinases and maps to 4p12. Hum. Mol. Genet. 3, 897–901. Hao, S., and August, A. (2002). The proline rich region of the Tec homology domain of ITK regulates its activity. FEBS Lett. 525, 53–58. Harris, J., Werling, D., Hope, J. C., Taylor, G., and Howard, C. J. (2002). Caveolae and caveolin in immune cells: Distribution and functions. Trends Immunol. 23, 158–164. Hata, D., Kawakami, Y., Inagaki, N., Lantz, C. S., Kitamura, T., Khan, W. N., Maeda‐Yamamoto, M., Miura, T., Han, W., Hartman, S. E., Yao, L., Nagai, H., et al. (1998). Involvement of Bruton’s tyrosine kinase in FcepsilonRI‐dependent mast cell degranulation and cytokine production. J. Exp. Med. 187, 1235–1247. Hawkins, J., and Marcy, A. (2001). Characterization of Itk tyrosine kinase: Contribution of noncatalytic domains to enzymatic activity. Protein Expr. Purif. 22, 211–219. Heinonen, J. E., Smith, C. I., and Nore, B. F. (2002). Silencing of Bruton’s tyrosine kinase (Btk) using short interfering RNA duplexes (siRNA). FEBS Lett. 527, 274–278. Hernandez‐Hansen, V., Mackay, G. A., Lowell, C. A., Wilson, B. S., and Oliver, J. M. (2004). The Src kinase Lyn is a negative regulator of mast cell proliferation. J. Leukoc. Biol. 75, 143–151. Heyeck, S. D., and Berg, L. J. (1993). Developmental regulation of a murine T‐cell‐specific tyrosine kinase gene, Tsk. Proc. Natl. Acad. Sci. USA 90, 669–673. Heyeck, S. D., Wilcox, H. M., Bunnell, S. C., and Berg, L. J. (1997). Lck phosphorylates the activation loop tyrosine of the Itk kinase domain and activates Itk kinase activity. J. Biol. Chem. 272, 25401–25408. Hirano, M., Kikuchi, Y., Nisitani, S., Yamaguchi, A., Satoh, A., Ito, T., Iba, H., and Takatsu, K. (2004). Bruton’s tyrosine kinase (Btk) enhances transcriptional co‐activation activity of BAM11, a Btk‐associated molecule of a subunit of SWI/SNF complexes. Int. Immunol. 16, 747–757. Horwood, N. J., Mahon, T., McDaid, J. P., Campbell, J., Mano, H., Brennan, F. M., Webster, D., and Foxwell, B. M. (2003). Bruton’s tyrosine kinase is required for lipopolysaccharide‐induced tumor necrosis factor alpha production. J. Exp. Med. 197, 1603–1611. Horwood, N. J., Page, T. H., McDaid, J. P., Palmer, C. D., Campbell, J., Mahon, T., Brennan, F. M., Webster, D., and Foxwell, B. M. (2006). Bruton’s tyrosine kinase is required for TLR2 and TLR4‐induced TNF, but not IL‐6, production. J. Immunol. 176, 3635–3641. Hu, Q., Davidson, D., Schwartzberg, P. L., Macchiarini, F., Lenardo, M. J., Bluestone, J. A., and Matis, L. A. (1995). Identification of Rlk, a novel protein tyrosine kinase with predominant expression in the T cell lineage. J. Biol. Chem. 270, 1928–1934.
Te c
KINASES IN T CELL AND MAST CELL SIGNALING
177
Huber, M., Helgason, C. D., Damen, J. E., Liu, L., Humphries, R. K., and Krystal, G. (1998). The src homology 2‐containing inositol phosphatase (SHIP) is the gatekeeper of mast cell degranulation. Proc. Natl. Acad. Sci. USA 95, 11330–11335. Hwang, E. S., Szabo, S. J., Schwartzberg, P. L., and Glimcher, L. H. (2005). T helper cell fate specified by kinase‐mediated interaction of T‐bet with GATA‐3. Science 307, 430–433. Iwaki, S., Tkaczyk, C., Satterthwaite, A. B., Halcomb, K., Beaven, M. A., Metcalfe, D. D., and Gilfillan, A. M. (2005). Btk plays a crucial role in the amplification of Fc epsilonRI‐mediated mast cell activation by kit. J. Biol. Chem. 280, 40261–40270. Janssen, E., Zhu, M., Zhang, W., and Koonpaew, S. (2003). LAB: A new membrane‐associated adaptor molecule in B cell activation. Nat. Immunol. 4, 117–123. Jefferies, C. A., Doyle, S., Brunner, C., Dunne, A., Brint, E., Wietek, C., Walch, E., Wirth, T., and O’Neill, L. A. (2003). Bruton’s tyrosine kinase is a Toll/interleukin‐1 receptor domain‐binding protein that participates in nuclear factor kappaB activation by Toll‐like receptor 4. J. Biol. Chem. 278, 26258–26264. Jiang, Y., Ma, W., Wan, Y., Kozasa, T., Hattori, S., and Huang, X. Y. (1998). The G protein G alpha12 stimulates Bruton’s tyrosine kinase and a rasGAP through a conserved PH/BM domain. Nature 395, 808–813. Johannes, F. J., Hausser, A., Storz, P., Truckenmuller, L., Link, G., Kawakami, T., and Pfizenmaier, K. (1999). Bruton’s tyrosine kinase (Btk) associates with protein kinase C mu. FEBS Lett. 461, 68–72. Jui, H. Y., Tseng, R. J., Wen, X., Fang, H. I., Huang, L. M., Chen, K. Y., Kung, H. J., Ann, D. K., and Shih, H. M. (2000). Protein‐tyrosine phosphatase D1, a potential regulator and effector for Tec family kinases. J. Biol. Chem. 275, 41124–41132. Kalesnikoff, J., Baur, N., Leitges, M., Hughes, M. R., Damen, J. E., Huber, M., and Krystal, G. (2002). SHIP negatively regulates IgEþ antigen‐induced IL‐6 production in mast cells by inhibiting NF‐kappa B activity. J. Immunol. 168, 4737–4746. Kane, L. P., and Watkins, S. C. (2005). Dynamic regulation of Tec kinase localization in membrane‐ proximal vesicles of a T cell clone revealed by total internal reflection fluorescence and confocal microscopy. J. Biol. Chem. 280, 21949–21954. Kane, L. P., Lin, J., and Weiss, A. (2000). Signal transduction by the TCR for antigen. Curr. Opin. Immunol. 12, 242–249. Kashiwakura, J., Suzuki, N., Nagafuchi, H., Takeno, M., Takeba, Y., Shimoyama, Y., and Sakane, T. (1999). Txk, a nonreceptor tyrosine kinase of the Tec family, is expressed in T helper type 1 cells and regulates interferon gamma production in human T lymphocytes. J. Exp. Med. 190, 1147–1154. Kawakami, T., and Galli, S. J. (2002). Regulation of mast‐cell and basophil function and survival by IgE. Nat. Rev. Immunol. 2, 773–786. Kawakami, Y., Yao, L., Miura, T., Tsukada, S., Witte, O. N., and Kawakami, T. (1994). Tyrosine phosphorylation and activation of Bruton tyrosine kinase upon Fc epsilon RI cross‐linking. Mol. Cell. Biol. 14, 5108–5113. Kawakami, Y., Yao, L., Tashiro, M., Gibson, S., Mills, G. B., and Kawakami, T. (1995). Activation and interaction with protein kinase C of a cytoplasmic tyrosine kinase, Itk/Tsk/Emt, on Fc epsilon RI cross‐linking on mast cells. J. Immunol. 155, 3556–3562. Kawakami, Y., Miura, T., Bissonnette, R., Hata, D., Khan, W. N., Kitamura, T., Maeda‐Yamamoto, M., Hartman, S. E., Yao, L., Alt, F. W., and Kawakami, T. (1997). Bruton’s tyrosine kinase regulates apoptosis and JNK/SAPK kinase activity. Proc. Natl. Acad. Sci. USA 94, 3938–3942. Kawakami, Y., Kitaura, J., Hartman, S. E., Lowell, C. A., Siraganian, R. P., and Kawakami, T. (2000a). Regulation of protein kinase CbetaI by two protein‐tyrosine kinases, Btk and Syk. Proc. Natl. Acad. Sci. USA 97, 7423–7428.
178
MARTIN FELICES ET AL.
Kawakami, Y., Kitaura, J., Satterthwaite, A. B., Kato, R. M., Asai, K., Hartman, S. E., Maeda‐Yamamoto, M., Lowell, C. A., Rawlings, D. J., Witte, O. N., and Kawakami, T. (2000b). Redundant and opposing functions of two tyrosine kinases, Btk and Lyn, in mast cell activation. J. Immunol. 165, 1210–1219. Kawakami, Y., Inagaki, N., Salek‐Ardakani, S., Kitaura, J., Tanaka, H., Nagao, K., Kawakami, Y., Xiao, W., Nagai, H., Croft, M., and Kawakami, T. (2006). Regulation of dendritic cell maturation and function by Bruton’s tyrosine kinase via IL‐10 and Stat3. Proc. Natl. Acad. Sci. USA 103, 153–158. Kikuchi, Y., Hirano, M., Seto, M., and Takatsu, K. (2000). Identification and characterization of a molecule, BAM11, that associates with the pleckstrin homology domain of mouse Btk. Int. Immunol. 12, 1397–1408. King, P. D., Sadra, A., Han, A., Liu, X. R., Sunder‐Plassmann, R., Reinherz, E. L., and Dupont, B. (1996). CD2 signaling in T cells involves tyrosine phosphorylation and activation of the Tec family kinase, EMT/ITK/TSK. Int. Immunol. 8, 1707–1714. King, P. D., Sadra, A., Teng, J. M., Bell, G. M., and Dupont, B. (1998). CD2‐mediated activation of the Tec‐family tyrosine kinase ITK is controlled by proline‐rich stretch‐4 of the CD2 cytoplasmic tail. Int. Immunol. 10, 1009–1016. Kitaura, J., Asai, K., Maeda‐Yamamoto, M., Kawakami, Y., Kikkawa, U., and Kawakami, T. (2000). Akt‐dependent cytokine production in mast cells. J. Exp. Med. 192, 729–740. Kline, J. B., Moore, D. J., and Clevenger, C. V. (2001). Activation and association of the Tec tyrosine kinase with the human prolactin receptor: Mapping of a Tec/Vav1‐receptor binding site. Mol. Endocrinol. 15, 832–841. Kojima, T., Fukuda, M., Watanabe, Y., Hamazato, F., and Mikoshiba, K. (1997). Characterization of the pleckstrin homology domain of Btk as an inositol polyphosphate and phosphoinositide binding domain. Biochem. Biophys. Res. Commun. 236, 333–339. Kosaka, Y., Felices, M., and Berg, L. J. (2006). Itk and Th2 responses: Action but no reaction. Trends Immunol. 27, 453–460. Kronenberg, M. (2005). Toward an understanding of NKT cell biology: Progress and paradoxes. Annu. Rev. Immunol. 23, 877–900. Kurosaki, T., and Kurosaki, M. (1997). Transphosphorylation of Bruton’s tyrosine kinase on tyrosine 551 is critical for B cell antigen receptor function. J. Biol. Chem. 272, 15595–15598. Labno, C. M., Lewis, C. M., You, D., Leung, D. W., Takesono, A., Kamberos, N., Seth, A., Finkelstein, L. D., Rosen, M. K., Schwartzberg, P. L., and Burkhardt, J. K. (2003). Itk functions to control actin polymerization at the immune synapse through localized activation of Cdc42 and WASP. Curr. Biol. 13, 1619–1624. Laederach, A., Cradic, K. W., Brazin, K. N., Zamoon, J., Fulton, D. B., Huang, X. Y., and Andreotti, A. H. (2002). Competing modes of self‐association in the regulatory domains of Bruton’s tyrosine kinase: Intramolecular contact versus asymmetric homodimerization. Protein Sci. 11, 36–45. Laederach, A., Cradic, K. W., Fulton, D. B., and Andreotti, A. H. (2003). Determinants of intra versus intermolecular self‐association within the regulatory domains of Rlk and Itk. J. Mol. Biol. 329, 1011–1020. Langhans‐Rajasekaran, S. A., Wan, Y., and Huang, X. Y. (1995). Activation of Tsk and Btk tyrosine kinases by G protein beta gamma subunits. Proc. Natl. Acad. Sci. USA 92, 8601–8605. Lewis, R. S., and Cahalan, M. D. (1995). Potassium and calcium channels in lymphocytes. Annu. Rev. Immunol. 13, 623–653. Li, T., Tsukada, S., Satterthwaite, A., Havlik, M. H., Park, H., Takatsu, K., and Witte, O. N. (1995). Activation of Bruton’s tyrosine kinase (BTK) by a point mutation in its pleckstrin homology (PH) domain. Immunity 2, 451–460.
Te c
KINASES IN T CELL AND MAST CELL SIGNALING
179
Liang, X., Wisniewski, D., Strife, A., Shivakrupa, R., Clarkson, B., and Resh, M. D. (2002). Phosphatidylinositol 3‐kinase and Src family kinases are required for phosphorylation and membrane recruitment of Dok‐1 in c‐Kit signaling. J. Biol. Chem. 277, 13732–13738. Liao, X. C., and Littman, D. R. (1995). Altered T cell receptor signaling and disrupted T cell development in mice lacking Itk. Immunity 3, 757–769. Liu, K. Q., Bunnell, S. C., Gurniak, C. B., and Berg, L. J. (1998). T cell receptor‐initiated calcium release is uncoupled from capacitative calcium entry in Itk‐deficient T cells. J. Exp. Med. 187, 1721–1727. Liu, W., Quinto, I., Chen, X., Palmieri, C., Rabin, R. L., Schwartz, O. M., Nelson, D. L., and Scala, G. (2001). Direct inhibition of Bruton’s tyrosine kinase by IBtk, a Btk‐binding protein. Nat. Immunol. 2, 939–946. Lowry, W. E., and Huang, X. Y. (2002). G Protein beta gamma subunits act on the catalytic domain to stimulate Bruton’s agammaglobulinemia tyrosine kinase. J. Biol. Chem. 277, 1488–1492. Lowry, W. E., Huang, J., Lei, M., Rawlings, D., and Huang, X. Y. (2001). Role of the PHTH module in protein substrate recognition by Bruton’s agammaglobulinemia tyrosine kinase. J. Biol. Chem. 276, 45276–45281. Lu, L. F., Lind, E. F., Gondek, D. C., Bennett, K. A., Gleeson, M. W., Pino‐Lagos, K., Scott, Z. A., Coyle, A. J., Reed, J. L., Van Snick, J., Strom, T. B., Zheng, X. X., et al. (2006). Mast cells are essential intermediaries in regulatory T‐cell tolerance. Nature 442, 997–1002. Lu, Y., Cuevas, B., Gibson, S., Khan, H., LaPushin, R., Imboden, J., and Mills, G. B. (1998). Phosphatidylinositol 3‐kinase is required for CD28 but not CD3 regulation of the TEC family tyrosine kinase EMT/ITK/TSK: Functional and physical interaction of EMT with phosphatidylinositol 3‐kinase. J. Immunol. 161, 5404–5412. Lucas, J. A., Atherly, L. O., and Berg, L. J. (2002). The absence of Itk inhibits positive selection without changing lineage commitment. J. Immunol. 168, 6142–6151. Lucas, J. A., Miller, A. T., Atherly, L. O., and Berg, L. J. (2003). The role of Tec family kinases in T cell development and function. Immunol. Rev. 191, 119–138. Machide, M., Mano, H., and Todokoro, K. (1995). Interleukin 3 and erythropoietin induce association of Vav with Tec kinase through Tec homology domain. Oncogene 11, 619–625. Mahajan, S., Fargnoli, J., Burkhardt, A. L., Kut, S. A., Saouaf, S. J., and Bolen, J. B. (1995). Src family protein tyrosine kinases induce autoactivation of Bruton’s tyrosine kinase. Mol. Cell. Biol. 15, 5304–5311. Malbec, O., Fong, D. C., Turner, M., Tybulewicz, V. L., Cambier, J. C., Fridman, W. H., and Daeron, M. (1998). Fc epsilon receptor I‐associated lyn‐dependent phosphorylation of Fc gamma receptor IIB during negative regulation of mast cell activation. J. Immunol. 160, 1647–1658. Mallis, R. J., Brazin, K. N., Fulton, D. B., and Andreotti, A. H. (2002). Structural characterization of a proline‐driven conformational switch within the Itk SH2 domain. Nat. Struct. Biol. 9, 900–905. Manetz, T. S., Gonzalez‐Espinosa, C., Arudchandran, R., Xirasagar, S., Tybulewicz, V., and Rivera, J. (2001). Vav1 regulates phospholipase cgamma activation and calcium responses in mast cells. Mol. Cell. Biol. 21, 3763–3774. Mano, H., Mano, K., Tang, B., Koehler, M., Yi, T., Gilbert, D. J., Jenkins, N. A., Copeland, N. G., and Ihle, J. N. (1993). Expression of a novel form of Tec kinase in hematopoietic cells and mapping of the gene to chromosome 5 near Kit. Oncogene 8, 417–424. Mano, H., Yamashita, Y., Miyazato, A., Miura, Y., and Ozawa, K. (1996). Tec protein‐tyrosine kinase is an effector molecule of Lyn protein‐tyrosine kinase. FASEB J. 10, 637–642. Mano, H., Ohya, K., Miyazato, A., Yamashita, Y., Ogawa, W., Inazawa, J., Ikeda, U., Shimada, K., Hatake, K., Kasuga, M., Ozawa, K., and Kajigaya, S. (1998). Grb10/GrbIR as an in vivo substrate of Tec tyrosine kinase. Genes Cells 3, 431–441.
180
MARTIN FELICES ET AL.
Mao, J., Xie, W., Yuan, H., Simon, M. I., Mano, H., and Wu, D. (1998). Tec/Bmx non‐receptor tyrosine kinases are involved in regulation of Rho and serum response factor by Galpha12/13. EMBO J. 17, 5638–5646. Marengere, L. E., Okkenhaug, K., Clavreul, A., Couez, D., Gibson, S., Mills, G. B., Mak, T. W., and Rottapel, R. (1997). The SH3 domain of Itk/Emt binds to proline‐rich sequences in the cytoplasmic domain of the T cell costimulatory receptor CD28. J. Immunol. 159, 3220–3229. Meng, W., Sawasdikosol, S., Burakoff, S. J., and Eck, M. J. (1999). Structure of the amino‐terminal domain of Cbl complexed to its binding site on ZAP‐70 kinase. Nature 398, 84–90. Miller, A. T., and Berg, L. J. (2002). Defective Fas ligand expression and activation‐induced cell death in the absence of IL‐2‐inducible T cell kinase. J. Immunol. 168, 2163–2172. Miller, A. T., Wilcox, H. M., Lai, Z., and Berg, L. J. (2004). Signaling through Itk promotes T helper 2 differentiation via negative regulation of T‐bet. Immunity 21, 67–80. Mohamed, A. J., Vargas, L., Nore, B. F., Backesjo, C. M., Christensson, B., and Smith, C. I. (2000). Nucleocytoplasmic shuttling of Bruton’s tyrosine kinase. J. Biol. Chem. 275, 40614–40619. Morrogh, L. M., Hinshelwood, S., Costello, P., Cory, G. O., and Kinnon, C. (1999). The SH3 domain of Bruton’s tyrosine kinase displays altered ligand binding properties when auto‐ phosphorylated in vitro. Eur. J. Immunol. 29, 2269–2279. Mukhopadhyay, S., Ramars, A. S., and Dash, D. (2001). Bruton’s tyrosine kinase associates with the actin‐based cytoskeleton in activated platelets. J. Cell. Biochem. 81, 659–665. Mukhopadhyay, S., Mohanty, M., Mangla, A., George, A., Bal, V., Rath, S., and Ravindran, B. (2002). Macrophage effector functions controlled by Bruton’s tyrosine kinase are more crucial than the cytokine balance of T cell responses for microfilarial clearance. J. Immunol. 168, 2914–2921. Newton, A. C. (2004). Diacylglycerol’s affair with protein kinase C turns 25. Trends Pharmacol. Sci. 25, 175–177. Nore, B. F., Mattsson, P. T., Antonsson, P., Backesjo, C. M., Westlund, A., Lennartsson, J., Hansson, H., Low, P., Ronnstrand, L., and Smith, C. I. (2003). Identification of phosphorylation sites within the SH3 domains of Tec family tyrosine kinases. Biochem. Biophys. Acta 1645, 123–132. Novina, C. D., Kumar, S., Bajpai, U., Cheriyath, V., Zhang, K., Pillai, S., Wortis, H. H., and Roy, A. L. (1999). Regulation of nuclear localization and transcriptional activity of TFII‐I by Bruton’s tyrosine kinase. Mol. Cell. Biol. 19, 5014–5024. Odom, S., Gomez, G., Kovarova, M., Furumoto, Y., Ryan, J. J., Wright, H. V., Gonzalez‐Espinosa, C., Hibbs, M. L., Harder, K. W., and Rivera, J. (2004). Negative regulation of immunoglobulin E‐dependent allergic responses by Lyn kinase. J. Exp. Med. 199, 1491–1502. Ohya, K., Kajigaya, S., Kitanaka, A., Yoshida, K., Miyazato, A., Yamashita, Y., Yamanaka, T., Ikeda, U., Shimada, K., Ozawa, K., and Mano, H. (1999). Molecular cloning of a docking protein, BRDG1, that acts downstream of the Tec tyrosine kinase. Proc. Natl. Acad. Sci. USA 96, 11976–11981. Okayama, Y., and Kawakami, T. (2006). Development, migration, and survival of mast cells. Immunol. Res. 34, 97–115. Park, H., Wahl, M. I., Afar, D. E., Turck, C. W., Rawlings, D. J., Tam, C., Scharenberg, A. M., Kinet, J. P., and Witte, O. N. (1996). Regulation of Btk function by a major autophosphorylation site within the SH3 domain. Immunity 4, 515–525. Parravicini, V., Gadina, M., Kovarova, M., Odom, S., Gonzalez‐Espinosa, C., Furumoto, Y., Saitoh, S., Samelson, L. E., O’Shea, J. J., and Rivera, J. (2002). Fyn kinase initiates complementary signals required for IgE‐dependent mast cell degranulation. Nat. Immunol. 3, 741–748. Perez‐Villar, J. J., and Kanner, S. B. (1999). Regulated association between the tyrosine kinase Emt/Itk/Tsk and phospholipase‐C gamma 1 in human T lymphocytes. J. Immunol. 163, 6435–6441.
Te c
KINASES IN T CELL AND MAST CELL SIGNALING
181
Perez‐Villar, J. J., O’Day, K., Hewgill, D. H., Nadler, S. G., and Kanner, S. B. (2001). Nuclear localization of the tyrosine kinase Itk and interaction of its SH3 domain with karyopherin alpha (Rch1alpha). Int. Immunol. 13, 1265–1274. Petro, J. B., Rahman, S. M., Ballard, D. W., and Khan, W. N. (2000). Bruton’s tyrosine kinase is required for activation of IkappaB kinase and nuclear factor kappaB in response to B cell receptor engagement. J. Exp. Med. 191, 1745–1754. Pivniouk, V. I., Martin, T. R., Lu‐Kuo, J. M., Katz, H. R., Oettgen, H. C., and Geha, R. S. (1999). SLP‐76 deficiency impairs signaling via the high‐affinity IgE receptor in mast cells. J. Clin. Invest. 103, 1737–1743. Pursglove, S. E., Mulhern, T. D., Mackay, J. P., Hinds, M. G., and Booker, G. W. (2002). The solution structure and intramolecular associations of the Tec kinase SRC homology 3 domain. J. Biol. Chem. 277, 755–762. Quek, L. S., Bolen, J., and Watson, S. P. (1998). A role for Bruton’s tyrosine kinase (Btk) in platelet activation by collagen. Curr. Biol. 8, 1137–1140. Raab, M., Cai, Y. C., Bunnell, S. C., Heyeck, S. D., Berg, L. J., and Rudd, C. E. (1995). p56Lck and p59Fyn regulate CD28 binding to phosphatidylinositol 3‐kinase, growth factor receptor‐bound protein GRB‐2, and T cell‐specific protein‐tyrosine kinase ITK: Implications for T‐cell costimulation. Proc. Natl. Acad. Sci. USA 92, 8891–8895. Rawlings, D. J., Saffran, D. C., Tsukada, S., Largaespada, D. A., Grimaldi, J. C., Cohen, L., Mohr, R. N., Bazan, J. F., Howard, M., Copeland, N. G., Jenkins, N. A., and Witte, O. N. (1993). Mutation of unique region of Bruton’s tyrosine kinase in immunodeficient XID mice. Science 261, 358–361. Rawlings, D. J., Scharenberg, A. M., Park, H., Wahl, M. I., Lin, S., Kato, R. M., Fluckiger, A. C., Witte, O. N., and Kinet, J. P. (1996). Activation of BTK by a phosphorylation mechanism initiated by SRC family kinases. Science 271, 822–825. Rhee, S. G. (2001). Regulation of phosphoinositide‐specific phospholipase C. Annu. Rev. Biochem. 70, 281–312. Rivera, J., and Gilfillan, A. M. (2006). Molecular regulation of mast cell activation. J. Allergy Clin. Immunol. 117, 1214–1225; quiz 1226. Rivera, J., Arudchandran, R., Gonzalez‐Espinosa, C., Manetz, T. S., and Xirasagar, S. (2001). A perspective: Regulation of IgE receptor‐mediated mast cell responses by a LAT‐organized plasma membrane‐localized signaling complex. Int. Arch. Allergy Immunol. 124, 137–141. Robson, J. D., Davidson, D., and Veillette, A. (2004). Inhibition of the Jun N‐terminal protein kinase pathway by SHIP‐1, a lipid phosphatase that interacts with the adaptor molecule Dok‐3. Mol. Cell. Biol. 24, 2332–2343. Rodgers, J. R., and Cook, R. G. (2005). MHC class Ib molecules bridge innate and acquired immunity. Nat. Rev. Immunol. 5, 459–471. Roskoski, R., Jr. (2004). Src protein‐tyrosine kinase structure and regulation. Biochem. Biophys. Res. Commun. 324, 1155–1164. Roskoski, R., Jr. (2005). Src kinase regulation by phosphorylation and dephosphorylation. Biochem. Biophys. Res. Commun. 331, 1–14. Rottem, M., and Mekori, Y. A. (2005). Mast cells and autoimmunity. Autoimmun. Rev. 4, 21–27. Roulier, E. M., Panzer, S., and Beckendorf, S. K. (1998). The Tec29 tyrosine kinase is required during Drosophila embryogenesis and interacts with Src64 in ring canal development. Mol. Cell 1, 819–829. Saito, K., Tolias, K. F., Saci, A., Koon, H. B., Humphries, L. A., Scharenberg, A., Rawlings, D. J., Kinet, J. P., and Carpenter, C. L. (2003). BTK regulates PtdIns‐4,5‐P2 synthesis: Importance for calcium signaling and PI3K activity. Immunity 19, 669–678.
182
MARTIN FELICES ET AL.
Saitoh, S., Arudchandran, R., Manetz, T. S., Zhang, W., Sommers, C. L., Love, P. E., Rivera, J., and Samelson, L. E. (2000). LAT is essential for Fc(epsilon)RI‐mediated mast cell activation. Immunity 12, 525–535. Samelson, L. E. (2002). Signal transduction mediated by the T cell antigen receptor: The role of adapter proteins. Annu. Rev. Immunol. 20, 371–394. Schaeffer, E. M., Debnath, J., Yap, G., McVicar, D., Liao, X. C., Littman, D. R., Sher, A., Varmus, H. E., Lenardo, M. J., and Schwartzberg, P. L. (1999). Requirement for Tec kinases Rlk and Itk in T cell receptor signaling and immunity. Science 284, 638–641. Schaeffer, E. M., Broussard, C., Debnath, J., Anderson, S., McVicar, D. W., and Schwartzberg, P. L. (2000). Tec family kinases modulate thresholds for thymocyte development and selection. J. Exp. Med. 192, 987–1000. Schaeffer, E. M., Yap, G. S., Lewis, C. M., Czar, M. J., McVicar, D. W., Cheever, A. W., Sher, A., and Schwartzberg, P. L. (2001). Mutation of Tec family kinases alters T helper cell differentiation. Nat. Immunol. 2, 1183–1188. Schmidt, U., Boucheron, N., Unger, B., and Ellmeier, W. (2004). The role of Tec family kinases in myeloid cells. Int. Arch. Allergy Immunol. 134, 65–78. Schneider, H., Guerette, B., Guntermann, C., and Rudd, C. E. (2000). Resting lymphocyte kinase (Rlk/Txk) targets lymphoid adaptor SLP‐76 in the cooperative activation of interleukin‐2 transcription in T‐cells. J. Biol. Chem. 275, 3835–3840. Schwartzberg, P. L., Finkelstein, L. D., and Readinger, J. A. (2005). TEC‐family kinases: Regulators of T‐helper‐cell differentiation. Nat. Rev. Immunol. 5, 284–295. Setoguchi, R., Kinashi, T., Sagara, H., Hirosawa, K., and Takatsu, K. (1998). Defective degranulation and calcium mobilization of bone‐marrow derived mast cells from Xid and Btk‐deficient mice. Immunol. Lett. 64, 109–118. Shan, X., and Wange, R. L. (1999). Itk/Emt/Tsk activation in response to CD3 cross‐linking in Jurkat T cells requires ZAP‐70 and Lat and is independent of membrane recruitment. J. Biol. Chem. 274, 29323–29330. Shan, X., Czar, M. J., Bunnell, S. C., Liu, P., Liu, Y., Schwartzberg, P. L., and Wange, R. L. (2000). Deficiency of PTEN in Jurkat T cells causes constitutive localization of Itk to the plasma membrane and hyperresponsiveness to CD3 stimulation. Mol. Cell. Biol. 20, 6945–6957. Siliciano, J. D., Morrow, T. A., and Desiderio, S. V. (1992). itk, a T‐cell‐specific tyrosine kinase gene inducible by interleukin 2. Proc. Natl. Acad. Sci. USA 89, 11194–11198. Smith, C. I., Islam, T. C., Mattsson, P. T., Mohamed, A. J., Nore, B. F., and Vihinen, M. (2001). The Tec family of cytoplasmic tyrosine kinases: Mammalian Btk, Bmx, Itk, Tec, Txk and homologs in other species. Bioessays 23, 436–446. Sommers, C. L., Huang, K., Shores, E. W., Grinberg, A., Charlick, D. A., Kozak, C. A., and Love, P. E. (1995). Murine txk: A protein tyrosine kinase gene regulated by T cell activation. Oncogene 11, 245–251. Sommers, C. L., Rabin, R. L., Grinberg, A., Tsay, H. C., Farber, J., and Love, P. E. (1999). A role for the Tec family tyrosine kinase Txk in T cell activation and thymocyte selection. J. Exp. Med. 190, 1427–1438. Su, Y. W., Zhang, Y., Schweikert, J., Koretzky, G. A., Reth, M., and Wienands, J. (1999). Interaction of SLP adaptors with the SH2 domain of Tec family kinases. Eur. J. Immunol. 29, 3702–3711. Takata, M., and Kurosaki, T. (1996). A role for Bruton’s tyrosine kinase in B cell antigen receptor‐ mediated activation of phospholipase C‐gamma 2. J. Exp. Med. 184, 31–40. Tamir, I., Stolpa, J. C., Helgason, C. D., Nakamura, K., Bruhns, P., Daeron, M., and Cambier, J. C. (2000). The RasGAP‐binding protein p62dok is a mediator of inhibitory FcgammaRIIB signals in B cells. Immunity 12, 347–358.
Te c
KINASES IN T CELL AND MAST CELL SIGNALING
183
Tanaka, N., Asao, H., Ohtani, K., Nakamura, M., and Sugamura, K. (1993). A novel human tyrosine kinase gene inducible in T cells by interleukin 2. FEBS Lett. 324, 1–5. Tanaka, N., Abe, H., Yagita, H., Okumura, K., Nakamura, M., and Sugamura, K. (1997). Itk, a T cell‐specific tyrosine kinase, is required for CD2‐mediated interleukin‐2 promoter activation in the human T cell line Jurkat. Eur. J. Immunol. 27, 834–841. Tomlinson, M. G., Kurosaki, T., Berson, A. E., Fujii, G. H., Johnston, J. A., and Bolen, J. B. (1999). Reconstitution of Btk signaling by the atypical tec family tyrosine kinases Bmx and Txk. J. Biol. Chem. 274, 13577–13585. Tomlinson, M. G., Heath, V. L., Turck, C. W., Watson, S. P., and Weiss, A. (2004a). SHIP family inositol phosphatases interact with and negatively regulate the Tec tyrosine kinase. J. Biol. Chem. 279, 55089–55096. Tomlinson, M. G., Kane, L. P., Su, J., Kadlecek, T. A., Mollenauer, M. N., and Weiss, A. (2004b). Expression and function of Tec, Itk, and Btk in lymphocytes: Evidence for a unique role for Tec. Mol. Cell. Biol. 24, 2455–2466. Tsai, M., Grimbaldeston, M. A., Yu, M., Tam, S. Y., and Galli, S. J. (2005). Using mast cell knock‐in mice to analyze the roles of mast cells in allergic responses in vivo. Chem. Immunol. Allergy 87, 179–197. Tsai, Y. T., Su, Y. H., Fang, S. S., Huang, T. N., Qiu, Y., Jou, Y. S., Shih, H. M., Kung, H. J., and Chen, R. H. (2000). Etk, a Btk family tyrosine kinase, mediates cellular transformation by linking Src to STAT3 activation. Mol. Cell. Biol. 20, 2043–2054. Tsukada, S., Saffran, D. C., Rawlings, D. J., Parolini, O., Allen, R. C., Klisak, I., Sparkes, R. S., Kubagawa, H., Mohandas, T., Quan, S., Belmont, J. W., Cooper, M. D., et al. (1993). Deficient expression of a B cell cytoplasmic tyrosine kinase in human X‐linked agammaglobulinemia. Cell 72, 279–290. Turner, M., and Billadeau, D. D. (2002). VAV proteins as signal integrators for multi‐subunit immune‐recognition receptors. Nat. Rev. Immunol. 2, 476–486. van Dijk, T. B., van Den Akker, E., Amelsvoort, M. P., Mano, H., Lowenberg, B., and von Lindern, M. (2000). Stem cell factor induces phosphatidylinositol 30 ‐kinase‐dependent Lyn/Tec/Dok‐1 complex formation in hematopoietic cells. Blood 96, 3406–3413. van Lohuizen, M., Verbeek, S., Krimpenfort, P., Domen, J., Saris, C., Radaszkiewicz, T., and Berns, A. (1989). Predisposition to lymphomagenesis in pim‐1 transgenic mice: Cooperation with c‐myc and N‐myc in murine leukemia virus‐induced tumors. Cell 56, 673–682. Vargas, L., Nore, B. F., Berglof, A., Heinonen, J. E., Mattsson, P. T., Smith, C. I., and Mohamed, A. J. (2002). Functional interaction of caveolin‐1 with Bruton’s tyrosine kinase and Bmx. J. Biol. Chem. 277, 9351–9357. Vassilev, A., Ozer, Z., Navara, C., Mahajan, S., and Uckun, F. M. (1999). Bruton’s tyrosine kinase as an inhibitor of the Fas/CD95 death‐inducing signaling complex. J. Biol. Chem. 274, 1646–1656. Vetrie, D., Vorechovsky, I., Sideras, P., Holland, J., Davies, A., Flinter, F., Hammarstrom, L., Kinnon, C., Levinsky, R., Bobrow, M., Edvard Smith, C. I., and Bentley, D. R. (1993). The gene involved in X‐linked agammaglobulinaemia is a member of the src family of protein‐tyrosine kinases. Nature 361, 226–233. Volna, P., Lebduska, P., Draberova, L., Simova, S., Heneberg, P., Boubelik, M., Bugajev, V., Malissen, B., Wilson, B. S., Horejsi, V., Malissen, M., and Draber, P. (2004). Negative regulation of mast cell signaling and function by the adaptor LAB/NTAL. J. Exp. Med. 200, 1001–1013. Wilcox, H. M., and Berg, L. J. (2003). Itk phosphorylation sites are required for functional activity in primary T cells. J. Biol. Chem. 278, 37112–37121. Woods, M. L., Kivens, W. J., Adelsman, M. A., Qiu, Y., August, A., and Shimizu, Y. (2001). A novel function for the Tec family tyrosine kinase Itk in activation of beta 1 integrins by the T‐cell receptor. EMBO J. 20, 1232–1244.
184
MARTIN FELICES ET AL.
Xie, Y., Xu, K., Dai, B., Guo, Z., Jiang, T., Chen, H., and Qiu, Y. (2006). The 44 kDa Pim‐1 kinase directly interacts with tyrosine kinase Etk/BMX and protects human prostate cancer cells from apoptosis induced by chemotherapeutic drugs. Oncogene 25, 70–78. Yamada, N., Kawakami, Y., Kimura, H., Fukamachi, H., Baier, G., Altman, A., Kato, T., Inagaki, Y., and Kawakami, T. (1993). Structure and expression of novel protein‐tyrosine kinases, Emb and Emt, in hematopoietic cells. Biochem. Biophys. Res. Commun. 192, 231–240. Yamadori, T., Baba, Y., Matsushita, M., Hashimoto, S., Kurosaki, M., Kurosaki, T., Kishimoto, T., and Tsukada, S. (1999). Bruton’s tyrosine kinase activity is negatively regulated by Sab, the Btk‐SH3 domain‐binding protein. Proc. Natl. Acad. Sci. USA 96, 6341–6346. Yamashita, Y., Miyazato, A., Ohya, K., Ikeda, U., Shimada, K., Miura, Y., Ozawa, K., and Mano, H. (1996). Deletion of Src homology 3 domain results in constitutive activation of Tec protein‐ tyrosine‐kinase. Jpn. J. Cancer Res. 87, 1106–1110. Yamashita, Y., Kajigaya, S., Yoshida, K., Ueno, S., Ota, J., Ohmine, K., Ueda, M., Miyazato, A., Ohya, K., Kitamura, T., Ozawa, K., and Mano, H. (2001). Sak serine‐threonine kinase acts as an effector of Tec tyrosine kinase. J. Biol. Chem. 276, 39012–39020. Yang, W., Malek, S. N., and Desiderio, S. (1995). An SH3‐binding site conserved in Bruton’s tyrosine kinase and related tyrosine kinases mediates specific protein interactions in vitro and in vivo. J. Biol. Chem. 270, 20832–20840. Yang, W. C., and Olive, D. (1999). Tec kinase is involved in transcriptional regulation of IL‐2 and IL‐4 in the CD28 pathway. Eur. J. Immunol. 29, 1842–1849. Yang, W. C., Ching, K. A., Tsoukas, C. D., and Berg, L. J. (2001). Tec kinase signaling in T cells is regulated by phosphatidylinositol 3‐kinase and the Tec pleckstrin homology domain. J. Immunol. 166, 387–395. Yao, L., Janmey, P., Frigeri, L. G., Han, W., Fujita, J., Kawakami, Y., Apgar, J. R., and Kawakami, T. (1999). Pleckstrin homology domains interact with filamentous actin. J. Biol. Chem. 274, 19752–19761. Yoshida, K., Yamashita, Y., Miyazato, A., Ohya, K., Kitanaka, A., Ikeda, U., Shimada, K., Yamanaka, T., Ozawa, K., and Mano, H. (2000). Mediation by the protein‐tyrosine kinase Tec of signaling between the B cell antigen receptor and Dok‐1. J. Biol. Chem. 275, 24945–24952. Zhu, M., Liu, Y., Koonpaew, S., Granillo, O., and Zhang, W. (2004). Positive and negative regulation of FcepsilonRI‐mediated signaling by the adaptor protein LAB/NTAL. J. Exp. Med. 200, 991–1000. Zhu, M., Rhee, I., Liu, Y., and Zhang, W. (2006). Negative regulation of Fc epsilonRI‐mediated signaling and mast cell function by the adaptor protein LAX. J. Biol. Chem. 281, 18408–18413.
Integrin Regulation of Lymphocyte Trafficking: Lessons from Structural and Signaling Studies Tatsuo Kinashi Department of Molecular Genetics, Institute of Biomedical Science, Kansai Medical University, Kyoto 606, Japan
1. 2. 3. 4. 5. 6. 7. 8. 9.
Abstract............................................................................................................. Introduction ....................................................................................................... Leukocyte Integrins ............................................................................................. Affinity and Valency Regulation.............................................................................. Integrin Conformational Changes........................................................................... Integrin‐Mediated Adhesion Steps in Lymphocyte Trafficking...................................... Talin as Intracellular Regulator for Lymphocyte Adhesion and Migration....................... Intracellular Signals in Chemokine‐Induced Adhesion and Migration............................ Inside‐Out Signaling Events in TCR‐Stimulated Lymphocytes ..................................... Concluding Remarks............................................................................................ References .........................................................................................................
185 185 186 189 189 195 201 203 211 215 216
Abstract High trafficking capability of lymphocytes is crucial in immune surveillance and antigen responses. Central to this regulatory process is a dynamic control of lymphocyte adhesion behavior regulated by chemokines and adhesion receptors such as integrins. Modulation of lymphocyte adhesive responses occurs in a wide range of time window from less than a second to hours, enabling rolling lymphocyte to attach to and migrate through endothelium and interact with antigen‐presenting cells. While there has been a rapid progress in the understanding of integrin structure, elucidation of signaling events to relay extracellular signaling to integrins in physiological contexts has recently emerged from studies using gene‐targeting and gene‐silencing technique. Regulatory molecules critical for integrin activity control distribution of integrins, polarized cell morphology and motility, suggesting a signaling network that coordinates integrin function with lymphocyte migration. Here, I review recent studies of integrin structural changes and intracellular signal molecules that trigger integrin activation (inside‐out signals), and discuss molecular mechanisms that control lymphocyte integrins and how inside‐out signals coordinately modulate adhesive reactions and cell shape and migration. 1. Introduction Immune cells are the most motile cells in the body. Multiphoton microscopy has been used to reveal a vivid picture of the robust motility that occurs during lymphocyte interactions with dendritic cells (DCs) in peripheral lymphoid
185 advances in immunology, vol. 93 # 2007 Elsevier Inc. All rights reserved.
0065-2776/07 $35.00 DOI: 10.1016/S0065-2776(06)93005-3
186
TAT S U O K I N A S H I
tissues (Mempel et al., 2004; Miller et al., 2002). The dynamic regulation of immune cell adhesive interactions is fundamentally integrated into immunological responses, and the integrin adhesion receptors play critical roles in this process (Butcher and Picker, 1996; Butcher et al., 1999; Springer, 1990, 1995). Integrins constitute a large family of surface glycoproteins, and they are composed of a and b subunits (Hemler, 1990). In particular, leukocyte integrins, such as lymphocyte function‐associated antigen (LFA‐1; aL /b2) and the a4 integrins are important in lymphocyte trafficking to peripheral lymphoid tissues through binding to the endothelial ligands ICAM (intercellular adhesion molecule)‐1 and ICAM‐2 for LFA‐1 and VCAM (vascular cell adhesion molecule)‐1 and MAdCAM (mucosal addressin cell adhesion molecule)‐1 for a4 integrins. LFA‐1 and a4 integrins mediate firm attachment of lymphocytes to high endothelial venules (HEV) and facilitate subsequent migration into tissues (Butcher et al., 1999). LFA‐1 is also the critical adhesion molecule in the immunological synapse, a specialized adhesion complex between T cells and antigen‐presenting cells (APC), and these interactions promote the activation of naive T cells (Sims and Dustin, 2002). The ability of cells to modulate the strength of integrin adhesion in response to extracellular stimuli such as antigen or chemokines is essential to proper immune function. This activation process, referred to as ‘‘inside‐out signaling’’ (Dustin and Springer, 1989), ultimately modulates integrin adhesiveness through affinity modulation (Carman and Springer, 2003), in which ligand‐binding affinity is altered, and avidity modulation, in which integrin cell surface diffusion and clustering are modified (van Kooyk and Figdor, 2000), which is referred to as valency modulation here. Recently, our understanding of these phenomena has been facilitated by three‐dimensional structures of integrins. Distinct conformational changes in the integrin extracellular domains are clearly associated with affinity changes on ligand binding or cell activation (Shimaoka et al., 2002; Takagi and Springer, 2002). Although integrin activation following physiological adhesion has been documented, the molecules that relay the inside‐out signal and the mechanism(s) by which affinity and valency modulation are regulated have been elusive. In this article, I review the recent studies of lymphocyte integrin regulations from viewpoints of structure and valency, intracellular signaling, and their physiological relevancies in lymphocyte trafficking. 2. Leukocyte Integrins Integrin adhesion molecules are a large family of 24 members of heterodimeric cell‐surface receptors composed of 18 a and 8 b subunits (Fig. 1). Cell–matrix and cell–cell interactions mediated by integrins are central to
187
I N T E G R I N R E G U L AT I O N O F LY M P H O C Y T E T R A F F I C K I N G
a7
aL* b2
b4
a M*
a9
aE
b7
a4
aIIb
a 10* b3
a11* b1
a3
b5
aV
a5
a X* a D*
a6
a8
a 2*
a 1*
b8
b6
Figure 1 Integrin family. The associations between the 18 a chains and 8 chains form at least 24 integrins. Leukocyte integrins are in gray. The integrins that contain the aI domain are indicated with asterisks ().
many fundamental biological processes such as embryogenesis, angiogenesis, organ formation, and immune functions (Hynes, 2002). The leukocyte integrin, LFA‐1 (aLb2) is a member of the b2 integrins exclusively expressed on leukocytes, and shares a common b2 subunit with Mac‐1 (aMb2), p150/95 (aXb2), and a D (aDb2). LFA‐1 plays important roles in binding to endothelium during leukocyte extravasation, lymphocyte homing, and in immunological synapse formation between T cells and APC (Sims and Dustin, 2002). Lymphocytes also express a4 integrins (a4b1, a4b7) that contribute to lymphocyte trafficking to inflamed or peripheral lymphoid tissues. Ligands for LFA‐1 include ICAM‐1, ‐2, ‐3, and junctional adhesion molecule‐1 (JAM‐1) that are expressed on endothelium or APC. aMb2 and aXb2, also known as complement receptor (CR)‐3 and ‐4, bind to iC3b‐coated particles in addition to ICAM‐1, and mediate phagocytosis of microbes. A hereditary defect in the b2 subunit that impairs expressions of leukocyte integrins causes a life‐ threatening immunodeficiency, leukocyte‐adhesion deficiency (LAD; Etzioni, 1996). b2 and a4 integrins have been attractive drug targets for inhibition of inflammatory or autoimmune diseases (Staunton et al., 2006). In the absence of activation, aLb2 has low affinity for ligand. In inside‐out signaling, signals received by other receptors activate intracellular signaling pathways that impinge on integrin cytoplasmic domains and make the extracellular domain competent for ligand binding on a timescale of less than 1s. This property enables leukocytes to rapidly respond to signals in the environment, such as cognate antigen or chemoattractant, to activate adhesion, and direct cell migration. Rapid progress in the integrin extracellular structure has recently made, which provides important clues how the integrin conformational changes are propagated through the cytoplasmic domain to the leg domains to the ligand‐binding headpiece (Carman and Springer, 2003; Dustin et al., 2004).
188
TAT S U O K I N A S H I
A
aI
a7 Helix
Head
Linker
b -Propeller
bI
Thigh Genu
Leg
Hybrid PSI
Calf-1 I-EGF 1-4 Extracellular
Calf-2 b-Tail
Plasma membrane "Hinge" GFFKR Intracellular NPXF
B
Extended forms Bent form
Low affinity
Closed
Intermediate affinity
Open
High affinity
Figure 2 Structure of b2 integrin. (A) Schematic representation of the b2 integrin. The head region comprises the aI domain and b‐propeller domain of the a subunit (light shade) and bI domain of the b subunit (dark shade). The leg region comprises the thigh, calf‐1, calf‐2 of the a subunit and the hybrid domain, N‐terminal PSI (plexin, semaphorin, and integrin) domain, four I‐EGF (epidermal growth factor) repeats, and b‐tail domain. Both subunits have a transmembrane domain and short cytoplasmic domain. A MIDAS is indicated by black spheres. The glycine‐ phenylalanine‐phenylalanine‐lysine‐arginine (GFFKR) motif in the a subunit cytoplasmic domain and corresponding amino acids in the b subunit cytoplasmic domain constitute a ‘‘hinge’’ region.
I N T E G R I N R E G U L AT I O N O F LY M P H O C Y T E T R A F F I C K I N G
189
3. Affinity and Valency Regulation Before going into details of integrin structural changes and regulatory signaling pathways, how integrin controls total cell adhesiveness (avidity) is briefly considered. Theoretically, avidity is related to affinity and surface density (valency) of integrins. Inside‐out signals are thought to modulate either or both of these parameters and act in a time window ranging from less than a second to minutes. Initial attachments are often transient and weak, and stabilization subsequently occurs by ligand‐induced conformational changes, linkage to the cytoskeleton, or cell spreading. It is difficult to distinguish avidity changes by inside‐out signals from those induced by ligand occupancy even in a short time window. To distinguish inside‐out signals from postadhesion events, integrin affinity or valency changes should be examined before cell adhesion. Since conventional affinity measurements are not sensitive enough to detect affinity changes in micromolar ranges, affinity modulation has been underestimated. Thus, valency regulation has been often inferred when activators induce adhesion without detectable affinity changes. Availability of monoclonal antibodies to detect distinct conformations of integrins eases this difficulty, and more sensitive methods to detect affinity (Chan et al., 2003; Lollo et al., 1993), conformation (Chigaev et al., 2003; Larson et al., 2005), and mobility (Cairo et al., 2006) are reported and shown to be instrumental to dissect effects of inside‐out signals on integrins (Sections 4 and 5). These materials and methods are expected to be exploited widely to study roles of inside‐out signals. 4. Integrin Conformational Changes 4.1. Global Changes of Extracellular Domains in Integrins That Lack the aI Domains The overall integrin structure resembles a ‘‘head’’ connected to ‘‘two legs’’ (Fig. 2A). The a subunit comprises an N‐terminal b‐propeller at the top, followed by three b‐sandwich modules (thigh, calf‐1, and calf‐2). The b subunit comprises an N‐terminal PSI (plexin, semaphorin, and integrin) domain, followed by a b‐sandwich hybrid domain, a bI domain (von Willebrand factor The b cytoplasmic domain contains a talin‐binding asparagine‐proline‐(any amino acid)‐ phenylalanine (NPXF) motif. (B) Equilibrium of the bent (low affinity) and extended conformations with the ‘‘closed’’ (intermediate affinity) and the ‘‘open’’ (high affinity) states triggered by separation of the cytoplasmic tails. The extended‐open, high‐affinity conformation is induced/stabilized by separation of the a and b cytoplasmic and leg regions. The flexible joints at the genu and between I‐EGF‐1 and I‐EGF‐2, and the bI/hybrid domain interface are indicated by circles. The upright and outward motions of the extracellular domains and the hybrid domain in transition from the bent to the extended and from the closed to the open states are indicated by thick arrows.
190
TAT S U O K I N A S H I
A domain), four epidermal growth factor (EGF) repeats, and a b‐tail domain. Half of the 18 integrin a subunits (a1, a2, a10, a11, aL, aM, aX, aD, and aE) also include an I domain in their a subunits (aI‐domain) inserted through short linkers into the upper face of the b‐propeller. Where present, this domain is the major site of ligand binding. The major sites of ligand recognition of integrins that lack the aI domain are the top face of the bI domain and the loops on the upper surface of the b‐propeller. Both the aI and bI domains contain a metal ion‐dependent adhesion site (MIDAS), where a divalent metal is coordinated by a ligand’s acidic residue (Hynes, 2002). Recent structural studies of integrins that lack the I domain have led to a general model of integrin conformational changes; in the low‐affinity conformation, the leg region is acutely bent at the ‘‘genu’’ (knee) between the thigh and calf‐1 domains and between the I‐EGF‐1 and I‐EGF‐2, with the ligand‐ binding headpiece in proximity to the membrane proximal leg region, topologically pointing toward the plasma membrane (Xiong et al., 2001, 2002; Fig. 2B). The electron microscopic analysis of negatively stained soluble recombinant integrins together with mutational studies and physicochemical measurement elegantly demonstrate that the switch blade‐like extension of the leg regions shifts the molecule to the intermediate or high‐affinity conformations in a manner dependent on the orientation of the bI domain and hybrid domain. In a ‘‘closed’’ conformation, the bI makes an acute angle with the hybrid domain, and in an ‘‘open’’ high‐affinity conformation, the outward motion of the hybrid domain occurs, making an obtuse angle with the bI domain (Takagi et al., 2002). Therefore, the extension of the legpiece and the orientation between the hybrid and bI domains of the headpiece are the key translator for converting global conformational changes into regulation of affinity (Takagi and Springer, 2002). Although a bent conformation may not be equated with low‐affinity binding in all situations (Adair et al., 2005; Xiong et al., 2002), the extension is thought to be particularly relevant in cell–cell adhesion mediated by leukocyte integrins. Indeed, it has been suggested from many studies using monoclonal antibodies that integrins undergo dynamic conformational changes in the legpiece (Lu et al., 2001a) as well as the headpiece (Humphries, 2004; Lu et al., 2001b, 2004), depending on divalent metals, ligand binding, or inside‐out signals. 4.2. Extensions of Extracellular Domains of b2 Integrins It has been recently demonstrated by using soluble recombinant aXb2 and aLb2 that b2 integrins also show three distinct conformations: a bent conformation, extended conformations with closed or open states of the headpiece (Nishida et al., 2006; Fig. 2B), as seen in integrins that lack I domains (Takagi
I N T E G R I N R E G U L AT I O N O F LY M P H O C Y T E T R A F F I C K I N G
191
et al., 2002). When the entire extracellular domains of a and b subunits are linked via a disulfide bond and coiled‐coil sequences fused at the C‐terminal ends (clasped form), aXb2 predominantly showed V‐shaped bent forms in physiological Mg2þ and Ca2þ concentrations. Compared with clasped aXb2, clasped aLb2 appears to be more relaxed in conformation, showing both the bent (55%) and extended‐closed (45%). This is in line with the characteristics of aXb2, which requires stronger cellular activation for adhesion than other members of b2 integrins. Removal of C‐terminal clasp (unclasped) of aXb2 increased extends forms with the closed (50%) and open (25%) headpiece with the rest remained bent. Unclasping of aLb2 also increased the extended‐open conformation. These results are in an excellent agreement with those of integrins without the aI‐domain, and support a coherent model of integrin conformational changes through the bent to the extended‐closed to the extended‐open states. Since these distinct states can coexist under the defined conditions, the conformational changes are not all‐or‐none responses, but should be regarded as equilibria among multiple states (Carman and Springer, 2003). Thus, in basal states integrin molecules are continually flexing (breathing) to some degree, and stabilization of the legpiece prefers the bent form, and its separation shifts an equilibrium toward the extended forms. The equilibrium points likely differ in integrin family members. A b2 monoclonal antibody (CBR‐LFA1/2; Petruzzelli et al., 1995), which induces high‐affinity states and stimulates adhesion by binding an epitope in the I‐EGF3 domain, separates a and b leg regions and induced or stabilized extended conformations. Thus, disruption of the interaction of the a and b cytoplasmic tails by inside‐out signals probably leads to a loss of the interactions between the leg regions, resulting in repositioning of the ligand‐binding headpiece pointing away from the plasma membrane (Fig. 2B). This model is consistent with studies on epitopes of stimulatory mAb that have now been shown to lie in the knee or leg regions (Lu et al., 2001a; Xie et al., 2004). Exposure of these epitopes is low in the bent state of the integrin (where they are masked) but high in the extended state (Lu et al., 2001a; Xie et al., 2004). The bI domain appears to play a regulatory role in this conformational change relay. The treatment of the clasped and unclasped aXb2 with a small molecule antagonist, XVA143, greatly increased extended conformations predominantly with the open state (Nishida et al., 2006). This is consistent with the proposed mechanism of XVA143, acting on the MIDAS of the bI domain, leading to the bI activation with the hybrid domain swing‐out, while inhibiting activation of the aI domain (Shimaoka et al., 2003a). The bI and hybrid domains may serve as a switch in transmitting the conformational signals from the ligand‐binding aI domain to the C‐terminal regions on ligand binding and from the cytoplasmic tails to the aI domain by inside‐out signals.
192
TAT S U O K I N A S H I
4.3. Multiple Affinity States of the aI Domain The I domain was crystallized in three major forms: closed (low affinity, 2 mM), intermediate (3–9 mM), and open (high affinity, 0.2 mM; Shimaoka et al., 2002, 2003b). The major conformational changes during the transition from the closed to open states include a rearrangement of the cation‐coordinating residues in the MIDAS site, accompanied by a small inward movement of the a1 helix and a large downward shift of the mobile C‐terminal (a7) helix. Crystal structures of aL I domain reveal that the a7 helix can adopt three different positions. An intermediate state between the fully closed and fully open forms of the domain involves a downward shift halfway to that observed for the fully open state. Thus, rearrangement of the MIDAS into the ligand‐binding configuration is tightly coupled to a downward movement of the C‐terminal helix. 4.4. Regulation of the aI Domain Conformations by the bI Domain The open and closed conformations of the aI domain are regulated by interaction of the C‐terminal linker with the bI domain. A conserved glutamic acid in the C‐terminal linker appears to act as an internal ligand to the bI domain and plays important role in conformational changes of the aI domain (Huth et al., 2000; Yang et al., 2004b). Mutations of the glutamic acid in the linker or amino acids constituting the MIDAS of the bI domain result in the low‐affinity state of the aI domain. Furthermore, double mutation of these residues to cysteine, allowing formation of the disulfide bond between the linker and bI, results in a constitutive high‐affinity state of aI (Yang et al., 2004b). These results support the hypothesis that the bI domain regulates the activity of aI by pulling down on the linker region leading to a downward movement of the C‐terminal a helix by exertion of a bell‐rope‐like pull on a segment within the C‐terminal linker region (Carman and Springer, 2003). Because this site is equivalent to the ligand‐ binding site in integrins that lack I domains, the interaction of the linker with the MIDAS of the bI domain may occur that are analogous to those that regulated interactions with ligands in integrins that lack I domains. Thus, the three headpiece units, the aI, b‐propeller, and bI domains, make a ternary interaction interface where structural rearrangements of the latter two domains affect the conformation of the aI domain. 4.5. Regulation of the bI Domain by Extensions and Divalent Metals Affinity regulation of the bI domain is thought to occur by the same mechanism as that regulating the aI domain. Both a1 and a7 helix movements are critical for bI domain regulation generating low‐ and high‐affinity states (Luo
I N T E G R I N R E G U L AT I O N O F LY M P H O C Y T E T R A F F I C K I N G
193
et al., 2004; Mould et al., 2002, 2003b; Yang et al., 2004a). The outward motion of the hybrid domain is linked to a7 helix movements presumably because the hybrid domain exerts a downward pull on this structural element. The orientation between the hybrid and bI domains is therefore thought to be a key translator for converting global conformational changes into regulation of affinity. However, the high‐affinity state of the b3 integrin locked by a disulfide bond between the b6 and a7 loop remains in the bent conformer. This suggests that a7 helix downward movement of the bI domain leading to the high‐affinity states does not necessarily lead to extended conformers (Luo et al., 2004). It has been well known that divalent metal ions affect integrin activities, depending on concentrations and metal species. For examples, Mn2þ has a potent stimulatory effect on integrin activity, and Mg2þ and Ca2þ are stimulatory and inhibitory on lymphocyte integrins, depending on concentrations, respectively (Dransfield et al., 1992; Shimizu and Mobley, 1993). The major sites of the modulatory effects of the divalent metals are in the bI domain. The bI domain contains a MIDAS (b MIDAS) centered between two other metal‐binding sites, the adjacent MIDAS, ADMIDAS, and the ligand‐induced metal‐binding site, LIMBS (Xiong et al., 2001). Ligand‐binding activity of the bI domain is regulated by variable divalent cation occupancy. Occupation of the ADMIDAS in high Ca2þ decreases ligand binding, whereas replacement by competing Mn2þ activates ligand binding. Low Ca2þ, with Ca2þ occupancy at the LIMBS, may synergize with Mg2þ to support ligand binding (Chen et al., 2003; Mould et al., 2003a). A mutation of the LIMBS site in a4b7 results in a low‐affinity state, capable of supporting lymphocyte rolling, whereas mutation of the ADMIDAS results in a high‐affinity state, supporting firm adhesion of lymphocytes (Chen et al., 2003), suggesting that the ADMIDAS and LIMBS also have global effects on integrin bent/extension conformations. 4.6. Cytoplasmic Domain Both a and b subunits have short cytoplasmic domains (Sastry and Horwitz, 1993). The cytoplasmic domains have categorically three functions: a /b heterodimer formation, signaling interface from the inside and outside, and integrin endocytosis/recycling. It is becoming clear that these functions may cross‐talk in lymphocyte trafficking. From the studies using soluble extracellular regions of integrins, a physical association of C‐terminal regions induces or stabilizes bent conformations and its separation trigger the extension and affinity upregulation. The membrane proximal glycine‐phenylalanine‐phenylalanine‐lysine‐arginine (GFFKR) motif of the a subunit, referred to as the ‘‘hinge’’ domain, is conserved throughout all integrin families. This motif acts as a negative regulatory sequence suppressing
194
TAT S U O K I N A S H I
integrin adhesion (Hughes et al., 1996); deletion of the motif converts inactive LFA‐1 into constitutively active LFA‐1 (Lu and Springer, 1997). The arginine in this GFFKR motif and an aspartic acid at the corresponding position in the b chain form a salt bridge, placing the a and b cytoplasmic regions in close juxtaposition. This may stabilize bent conformations of integrins, making adhesive activities low. Consistently, lymphocytes generated from ‘‘knock‐in’’ mice expressing the aL subunit that lacks the GFFKR motif show higher basal adhesion levels than wild‐type lymphocytes (Semmrich et al., 2005). Deletion of the GFFKR motif also lowers surface amounts of LFA‐1, but not other integrins members, supporting an important role of the GFFKR motif in heterodimer formation with the b2 subunit (Lu and Springer, 1997). Thus, the GFFKR motif facilitates a heterodimer formation, which is a requisite process to transport an a /b heterodimer to cell surface as an inactive, perhaps bent conformer. On the other hand, regulatory functions through the GFFKR motif in inside‐out signaling, or outside‐in signaling are less clear, compared to its structural requirement for inactive integrin on cell surface. The LFA‐1 that lacks the GFFKR motif still responds to inside‐out signals including the TCR complex for attachment to ICAM‐1, and activation of JNK or Erk is not altered on binding to ICAM‐1 (Semmrich et al., 2005). Interestingly, lymphocyte expressing LFA‐1 that lacks the GFFKR motif is impaired in detachment on ICAM‐1. This defect may underlie hypoplastic peripheral lymph nodes, and impaired humoral responses to T cell‐dependent antigen and leukocyte recruitment into inflamed peritoneum (Semmrich et al., 2005). The integrin cytoplasmic domains play crucial roles in transmitting the inside‐out signals to the extracellular domains as well as outside‐in signals from ligand‐bound I domains, through binding to cytoskeletal linker proteins and intracellular proteins to the distinct sites of the cytoplasmic domains (Calderwood, 2004; Liu et al., 2000). The NPxY/F is well conserved in all b integrins and is shown to interact with an actin cytoskeleton linker protein, talin (Calderwood, 2004). In addition, phosphorylation of amino acids in the cytoplasmic domains is increased by inside‐out signals or after ligand binding (Fagerholm et al., 2004). Both aL and b2 cytoplasmic phosphorylations are triggered by inside‐out signals or modulates integrin functions (Fagerholm et al., 2005; Hibbs et al., 1991), perhaps through recruitment of binding proteins that recognize phosphorylated amino acids. The integrin surface distribution is thought to be regulated by lateral diffusion through linkage of cytoplasmic domains to the cytoskeleton. Distinct conformations of LFA‐1 are shown to have different surface mobility measured by single‐particle tracking (Cairo et al., 2006; Kucik et al., 1996). Intracellular transport also plays an important role of integrin distribution. Integrins are endocytosed and recycled back between the plasma membrane
I N T E G R I N R E G U L AT I O N O F LY M P H O C Y T E T R A F F I C K I N G
195
and intracellular pools. The critical role of the cytoplasmic domain is demonstrated for polarized endocytic recycle of avb3 to the migrating front in neutrophils and fibroblasts (Jones et al., 2006; Lawson and Maxfield, 1995). The mutation of the membrane proximal endocytosis motif Y735xxF (F, a bulky hydrophobic amino acid) of the human b2 subunit inhibits internalization of LFA‐1, and impairs detachment (Tohyama et al., 2003) and transporting of LFA‐1 to the ruffling membrane (Fabbri et al., 1999), resulting in defective migration. Endocytic recycling pathways of LFA‐1 are different from conventional clathrin‐mediated pathways and depend on lipid raft (Fabbri et al., 2005). The polarized redistribution of LFA‐1 to the leading edge after chemokine stimulation is also inhibited by mutations of the aL cytoplasmic region after the GFFKR motif (Katagiri et al., 2003). These mutations make LFA‐1 in low‐affinity bent conformations with a low exposure of a NKI‐L16 epitope (Tohyama et al., 2003), a legpiece extension reporter antibody that recognizes the interface the aL genu and thigh domains (Xie et al., 2004). Thus, the cytoplasmic regions also have key roles in endocytosis and recycling of leukocyte integrins and link affinity/conformational changes with spatial regulation. In summary, the extension and the hybrid domain–bI interface can act as flexible joints and may adopt distinct positions, each of which is likely to have a global effect on the overall ligand‐binding affinity of the integrin. Integrin extension may affect cell adhesion through two distinct modes: accessibility to ligands by extending the head region into a position appropriate for recognition of extracellular ligands, and affinity to ligands by freeing the hybrid domain from the structural restrain. Association and separation of a /b cytoplasmic domains play regulatory roles in transmitting signals from inside‐out and outside‐in signals and also control integrin distribution coupled with cytoskeleton and endocytic recycling. 5. Integrin‐Mediated Adhesion Steps in Lymphocyte Trafficking It has been becoming apparent that chemokines and antigens play decisive roles in adhesive interactions with endothelial cells and APC. In this section, I focus the critical steps of lymphocyte trafficking from attachment and migration through endothelial venules to interactions with APC (Fig. 3), and discuss how lymphocyte adhesiveness is modulated by chemokines and antigens in terms of integrin affinity/conformation and spatial regulation. 5.1. Conversion of Rolling to Firm Adhesion by Chemokines During entry into peripheral lymph nodes, naive T cells interact with HEV in a process involving sequential adhesion steps: (1) tether (capture) or roll on HEV through selectin‐mediated interactions, (2) arrest (stop) mediated by
196
TAT S U O K I N A S H I
A Rolling tethering
Firm adhesion
Arrest
Transmigration Lumen
HEV Selectin Tissue
Chemokines
LFA-1 a 4 integrins
CD31 CD99 JAM-1
B Brief contacts
Crawling/tethering
Chemokines
Synapse
TCR LFA-1/ICAM
Figure 3 Integrin‐mediated adhesive interactions of lymphocytes. (A) Adhesion cascades from rolling to transmigration. The weak interaction of selectins on lymphocytes with cognate sialyl glycoproteins on the vascular endothelium induces lymphocyte rolling/tethering. Chemokines associated with the apical surface of the endothelium activate the LFA‐1/a4 integrins of rolling lymphocytes, augmenting their adhesiveness to ICAMs, MAdCAM‐1, or VCAM‐1 to mediate arrest (stop), followed by firm attachment. Attached lymphocytes migrate over the endothelium and transmigration through these layers, usually at intercellular junctions where junctional adhesion molecules such as CD31, CD99, or JAM‐1 accumulate to mediate diapedesis. (B) Sequential steps of T‐APC interactions. Migrating T lymphocytes transiently contacts with APC under guidance with chemokines, which may be associated with cell surface of APC. Chemokine‐ activated lymphocytes crawl over APC to scan cognate antigens. During this step, tethering of lymphocytes may be occurred through the uropod, depending on LFA‐1 and ICAMs. Antigen recognition through TCR converts unstable adhesion to firm adhesion, leading to immunological synapse formations through LFA‐1 and ICAM‐1.
I N T E G R I N R E G U L AT I O N O F LY M P H O C Y T E T R A F F I C K I N G
197
LFA‐1 and a4 integrins on lymphocytes activated by chemokines through binding to ICAM‐1 and MAdCAM‐1 on the endothelium, and (3) diapedesis (transendothelial migration; Fig. 3A). Although rolling is facilitated by lymphocyte expression of L‐selectin, with a minor contribution from LFA‐1 and a4 integrins, LFA‐1 and a4b7 have major roles in the firm attachment of lymphocytes to HEVs of peripheral lymph nodes and Peyer’s patches (Butcher et al., 1999). Chemokines, including C‐C‐chemokine ligand 21 (CCL21), CXC‐ chemokine ligand 12 (CXCL12), and CXCL13 (Ebisuno et al., 2003; Okada et al., 2002; Stein et al., 2000; Warnock et al., 2000), localized on the apical endothelial surface rapidly increase integrin avidity, resulting in lymphocyte arrest. Since upregulation of lymphocyte adhesion by chemokines are transient and affinity changes likely occur in micromolar ranges, it is technically difficult to detect affinity modulation using conventional assays. Thus, it has been often controversial whether affinity modulation occurs in physiological contexts. Nonetheless, the modality of integrin avidity regulation in this step has been reported to involve both affinity and valency regulation. Stimulation of primary T cells with chemokines induces the patch‐like clustering of LFA‐1 and the microclustering of a4b1, which correlate respectively with increased cellular adhesion to low‐density ICAM‐1 (Constantin et al., 2000) and transient tethering and firm adhesion under shear flow (Grabovsky et al., 2000). LFA‐1 and a4 integrin affinity is also augmented by chemokine signaling (Chan et al., 2003; Grabovsky et al., 2000; Shimaoka et al., 2006) and is important for lymphocyte homing to peripheral lymph nodes (Constantin et al., 2000). In terms of currently understood integrin conformations, the conformation mediating rolling appears to most closely correspond to lymphocyte integrins in an extended conformation with a low‐affinity I domain, whereas the conformation that mediates arrest adhesion appears to most closely correspond to an extended conformation with an intermediate or high‐affinity I domain. The experiments using K562 cells reconstituted LFA‐1 carrying a locked aL I domain with either low, intermediate, or high‐affinity state demonstrate that rolling adhesion occurs when extension of low‐affinity LFA‐1 is induced by the treatment with XVA143 and that the shift from low to intermediate affinity transforms rolling adhesion to firm adhesion in shear flow (Salas et al., 2002, 2004, 2006). In neutrophil LFA‐1, a shift from low to intermediate affinity stabilized by IC487475, an aL I domain allosteric antagonist, supports rolling, whereas high affinity is associated with shear‐resistant leukocyte arrest (Green et al., 2006). Thus, extension with affinity changes is thought to be a key step in transition of lymphocyte rolling to arrest triggered by chemokines. Does chemokines actually induce extension of integrins and affinity changes during a shift from rolling? It has been shown that immobilized chemokines induce extended conformations under physiological shear flow, whereas
198
TAT S U O K I N A S H I
soluble chemokines do not (Shamri et al., 2005). Immobilized chemokines induce lymphocyte b2 legpiece extension recognized by a reporter antibody KIM127 (Robinson et al., 1992; Xie et al., 2004) with intermediate affinity changes under shear flow (Shamri et al., 2005). The extension depends on Gi‐coupled signaling, suggesting endothelial chemokines induce extension of LFA‐1 with affinity changes in less than a second (Shamri et al., 2005). This study proposes a model, in which extension of bent LFA‐1 is the critical first step of lymphocyte arrest, making LFA‐1 accessible to surface ICAM‐1, leading to ICAM‐1‐induced high‐affinity LFA‐1 conformations and stabilization of cell adhesion under flow (Shamri et al., 2005). The whole process occurs within a second at restricted sites on the lymphocyte surface and requires cooperation of inside‐out and outside‐in signaling. To examine unbending more directly, conformational changes in cell surface a4b1 are probed using fluorescent resonance energy transfer (FRET) between an FITC‐labelled ligand peptide donor and rhodamine B acceptors in the plasma membrane. Stimulation with Mn2þ induced a high affinity to ligand and placing the headpiece of the resting integrin near the membrane surface allows for an extension of the Mn2þ activated headpiece 50 A˚ from the surface. This distance is approximately one‐half that expected if the integrin molecule undergoes the conformational change from the fully folded to the fully extended conformation. The activation of the integrin by inside‐out signaling through a G‐protein–coupled receptor, resulting in the intermediate affinity, leads to the head region moving away from the surface by 25 A˚ after stimulation by a chemoattractant. The distance change is correlated with ligand‐binding affinity. The half‐time corresponding the diminution of FRET due to activation of the integrin is less than 30 s. The results indicate that there is a coordination between extension of the ligand‐binding headpiece away from the cell surface and affinity to ligand, and the fully extended conformation were not observed with this method. Although it could be possible that the extended‐open conformations are not induced by inside‐out signals alone, the fully extended conformation may exist at the moment of the engagement of the integrin by the natural endothelial ligand under shear flow. The transient bond formation in rolling would allow the forces to induce a molecular extension, and a ligand‐ bound I domain induces or stabilizes fully extended conformations with the open headpiece, resulting in arrest and firm adhesion (Shamri et al., 2005). Interestingly, a study using FRET technology demonstrates that separation of the aL and b2 cytoplasmic regions occurs following chemokine stimulation and ligand binding (Kim et al., 2003). This study indicates that separation of cytoplasmic regions occurs by inside‐out and outside‐in signaling and support the notion that chemokine‐stimulated inside‐out signals inhibit close associations of
I N T E G R I N R E G U L AT I O N O F LY M P H O C Y T E T R A F F I C K I N G
199
a and b cytoplasmic regions, which likely releases a restrain on bent conformations and induce unbending of the extracellular domains to mediate lymphocyte arrest. 5.2. Transmigration Given the presence of chemokines on the apical side of the endothelium, it is unlikely that a chemokine gradient across the endothelium stimulate transmigration of T cells in vivo. Thus, apical chemokines arrest rolling lymphocytes and subsequently stimulate cell motility over the endothelium. When migrating lymphocytes reach intercellular junctions, they begin diapedesis between apposed endothelial cells (Johnson‐Leger et al., 2000). b1 and b2 integrins are involved in transmigration step, in addition to adhesion molecules such as CD31, CD99, or JAM‐1 (Muller, 2003). In addition, shear flow is required for efficient lymphocyte transmigration (Cinamon et al., 2001). Lymphocyte transmigration needs apical chemokines and Gi‐dependent signaling under shear flow conditions (Cinamon et al., 2001). Requirement of shear stress in lymphocyte transmigration suggest a mechanosensitive regulatory process (Vogel and Sheetz, 2006) acting on migrating lymphocytes and endothelial barriers through activation of intracellular signaling such as focal adhesion kinases (Li et al., 1997) and small GTPases (de Bruyn et al., 2003; Tamada et al., 2004). This may cause enhancement lymphocyte adhesion and motility in vertical directions, or modulation of junctional permeability. In addition to paracellular pathways of transmigration, lymphocyte may migrate in a transcellular fashion (Carman and Springer, 2004), as reported in leukocytes in vivo (Feng et al., 1998). During transcellular migration, cuplike‐endothelial projections enriched for ICAM‐1 and VCAM‐1 surround leukocytes. b2 and a4 integrins are distributed in linear clustering patterns oriented parallel to the direction of diapedesis (Carman and Springer, 2004). Vimentin is also involved in transcellular machineries (Nieminen et al., 2006). Apparently, transcellular migration does not require chemokine gradients, and arrested lymphocytes may go through endothelial barrier directly, perhaps skipping firm attachment and migration steps. Further studies are necessary using recent advances in imaging technology to address the site of lymphocyte transmigration in vivo. 5.3. Interstitial Migration in Lymphoid Tissues In situ imaging techniques using multiphoton microscopy have revealed robust interstitial migration of naive lymphocytes into peripheral lymph nodes (Miller et al., 2002), probably under the control of chemokines and
200
TAT S U O K I N A S H I
integrins. Lymphocyte migration behavior appears to be a random walk, but with spatial restrictions; the movement of T cells is confined to subcortical T cell areas and they are excluded from B cell follicles. The high motility of naive T cells enables them to encounter the rare population of antigen‐ presenting DCs that have migrated into draining lymph nodes from peripheral tissues. Specific targeting of lymphocyte migration to T cell areas depends on chemokines such as CCL21 and CXCL12, and migration to B cell follicles depends on CXCL13 (Moser et al., 2004), and lymphocyte homing to splenic white pulp has been shown to depend on LFA‐1 and a4 integrins (Lo et al., 2003). Soluble chemokine gradients might direct lymphocyte migration to specific compartments through chemotaxis in lymphoid tissues. But there are little convincing data to indicate gradient distributions of chemokines in vivo. Chemokines are highly charged molecules and readily associated with extracellular matrix (ECM) proteins and cell surface via heparan sulfates or glycosaminoglycans, as seen in HEV (Miyasaka and Tanaka, 2004). Chemokines bound to ECM or cell surface of reticular stromal cells could guide lymphocyte interstitial migration in chemokinetic (migration dependent on nongradient chemoattaractants) and haptokinetic (migration dependent on substrates) fashions, independently of chemokine gradients. 5.4. Interactions with APC The transient activation of integrins by chemokines enables lymphocytes to scan for cognate antigen during brief contacts with APCs (Fig. 3B). LFA‐1 activation by inside‐out signaling is demonstrated for binding of T cells to ICAM‐1 on stimulation with TCR ligation (Dustin and Springer, 1989). Once T cells recognize cognate antigen through peptide–MHC ligation of the TCR, a dynamic redistribution of TCR and LFA‐1 to the contact site occurs within minutes (Grakoui et al., 1999); LFA‐1 then translocates from the center of the contact site to the periphery, accompanied by the reciprocal movement of the TCR complex. These events lead to the formation of a stable adhesion termed immunological synapses (IS), or supramolecular activating clusters (SMACs), a characteristic structure in which an external LFA‐1 ring surrounds central TCR clusters (cSMAC; Monks et al., 1998). In the peripheral SMAC (pSMAC), ICAM‐1‐engaged LFA‐1 is colocalized with talin, and likely takes extended conformations. Thus, segregation of LFA‐1 to the peripheral is structurally relevant distribution so that large extracellular domains of LFA‐1 and ICAM‐1 do not sterically hinder relatively small TCR and antigen– peptide–MHC complex, allowing stable antigen recognition (Sims and Dustin, 2002). However, the mechanisms underlying the SMAC, especially how LFA‐1 molecules are redistributed as a ring remains elusive.
I N T E G R I N R E G U L AT I O N O F LY M P H O C Y T E T R A F F I C K I N G
201
It is becoming clear that T cells, particularly naive cells are activated during short contacts with antigen peptide‐MHC bearing APC. For example, T cells in a collagen matrix stop very infrequently but still get activated and proliferate (Gunzer et al., 2000). Multiphoton scanning laser microscopy have shown that after encountering APC‐presented cognate antigen in vivo, T cells undergo distinct changes in their adhesion patterns (Bousso and Robey, 2003; Mempel et al., 2004; Miller et al., 2004): initial short‐lived contacts with antigen‐ presenting DCs followed by the formation of stable T cell–APC conjugates, which eventually lead to autonomous T cells migration and cell division. Integrins and intracellular signaling from receptors for chemokines and antigens likely regulate these changes in T cell behavior after activation (Friedman et al., 2005). It has been recently demonstrated that CCL21 is bound to cell surface of CD11cþ dendritic APC (Friedman et al., 2006). Interestingly, chemokines bound to APC stimulate the initial short‐lived interactions of lymphocytes via LFA‐1 and ICAMs, and enhances the subsequent formations of an antigen‐dependent stable adhesion. During initial contacts, a T cell moves over a chemokine‐bound APC, which often results in tethering at uropod, while the leading edge is active and the cell often appears to crawl away from the APC. The uropod tethering occurs depending on LFA‐1 and ICAMs. When the leading edge subsequently engages with antigen‐bearing cell surface of the same (in cis) or a neighboring cell (in trans), the uropod tether rapidly released, concomitant with initiation of Ca2þ influx and IS formation, indicating antigen recognition and activation (Friedman et al., 2006). The initial transient interaction and tethering may help keep lymphocytes in proximity to APC until LFA‐1 is sufficiently activated. Antigen engagement triggers TCR‐mediated inside‐out signals and further stabilizes attachments and initiates IS formation (Fig. 3B). Thus, this two‐step ‘‘tether‐ to‐synapse’’ dynamic is mediated by sequential activation of LFA‐1 by surface‐ bound chemokines and cognate antigens and may correspond to a transition from a ‘‘swarming’’ pattern of lymphocyte interactions with antigen‐bearing APC to stopping and IS formation in vivo (Miller et al., 2004). 6. Talin as Intracellular Regulator for Lymphocyte Adhesion and Migration Talin is a 250‐kDa cytoskeletal protein that links integrins and the actin cytoskeleton (Horwitz et al., 1986). It is a component of focal adhesion complexes in fibroblasts (Burridge and Connell, 1983). Talin has an additional function in regulating cadherin gene expression, which is independent of integrins (Becam et al., 2005). Talin is localized in the leading edge of chemokine‐ stimulated lymphocytes (Foger et al., 2006; Gomez‐Mouton et al., 2001) and in immunological synapse (Monks et al., 1998). In addition to linking integrins
202
TAT S U O K I N A S H I
with actin cytoskeleton, it has been proposed that talin serves as inside‐out signals (Calderwood, 2004). Talin has an N‐terminal integrin‐binding FERM (4.1 ezrin, radixin, moesin) domain and a C‐terminal actin‐binding tail domain and serves as a linker between integrins and actin cytoskeleton. The FERM domain contains a region that directly associates with the NPXY/F motif, which is conserved in the b chains of most integrins (Calderwood, 2004). Overexpression of this domain activates b,b,and b3 integrins (Calderwood et al., 1999; Kim et al., 2003). Knockdown of talin by small interference RNA inhibits b3 integrin activation (Tadokoro et al., 2003). Proteolytic cleavage of talin by calpain produces talin head fragments (Yan et al., 2001). Separation of the cytoplasmic domains of aLb2 is detected by FRET by overexpression of the talin head (Kim et al., 2003). Thus, generation of this talin fragment potentially serves as an inside‐out signal to modulate LFA‐1 affinity by separation of LFA‐1 cytoplasmic domains. However, it was reported that calpain inhibitors reduce TCR‐ stimulated LFA‐1‐mediated adhesion of lymphocytes to ICAM‐1 (Stewart et al., 1998). But this study did not focus on either talin cleavage or affinity regulation of LFA‐1. Rather it was proposed that calpain induced release of LFA‐1 from a cytoskeletal restraint that prevents lateral diffusion and clustering. Thus, the result was interpreted in terms of valency regulation. In support of a negative function for talin, LFA‐1 is constitutively associated with talin in resting neutrophils, but after activation LFA‐1 dissociates from talin and associates with a‐actinin (Sampath et al., 1998). Furthermore, treatment with a low dose of cytochalasin D, which inhibits actin polymerization, upregulates integrin surface diffusion and adhesion (Kucik et al., 1996). Latrunclin A, which also prevents actin polymerization by binding to actin monomers, increases rolling and firm adhesion by LFA‐1 (Salas et al., 2002). Although talin and actin cytoskeletons are important in postadhesion events by strengthening of adhesion complex or cell migration (Smith et al., 2005), cleavage of talin is not involved in transition from rolling adhesion to firm adhesion (Constantin et al., 2000; Shamri et al., 2005). Knockdown of talin lowers chemokine‐ triggered lymphocyte interactions to low‐density, but not high‐density ICAM‐1 in shear flow, indicating an important role of talin in adhesion strengthening (Shamri et al., 2005). Interestingly, in migrating lymphocytes ICAM‐1‐engaged, high‐affinity conformations of LFA‐1 recognized by mAb24 is localized in the midbody area termed focal zone and colocalized with talin (Smith et al., 2005). Internal reflection microscopy shows that a cell attaches strongly in the focal zone and to a lesser extent at the leading edge, but not in the uropod. Thus, this suggests that LFA‐1 affinity/conformation changes are spatially regulated: high in the focal zone, low in the uropod, perhaps intermediate in the leading edge. ICAM‐1‐engaged, high‐affinity LFA‐1 is low mobility on the cell surface,
203
I N T E G R I N R E G U L AT I O N O F LY M P H O C Y T E T R A F F I C K I N G
suggesting a linkage of this subpopulation of LFA‐1 to cytoskeleton via talin. This study shows that the LFA‐1–talin complex formation is required for efficient migration on ICAM‐1 (Smithi, 2005). 7. Intracellular Signals in Chemokine‐Induced Adhesion and Migration Chemokines activate multiple signaling pathways, including the phosphatidylinositol 3‐kinase (PI3K), phospholipase C (PLC), Ras/Rho family of small GTPases, and mitogen activated protein (MAP) kinase cascades, each of which has been implicated in the inside‐out signaling cascades that control integrin affinity and valency regulation and the associated changes in cytoskeleton, cell polarity, and morphology, which regulate lymphocyte migration (Fig. 4). 7.1. PI3K Pathways PI3K plays a crucial role in chemotaxis or directed migration along a chemokine gradient (Ward, 2004). Experiments using PI3K inhibitors have shown that inhibition of PI3K activity blocks chemokine‐triggered LFA‐1 clustering and adhesion to low density ICAM‐1. However, treatment with PI3K inhibitors did not block adhesion to high density ICAM‐1 or in vivo lymphocyte homing GPCR
G12/13
Gi
Rac-GEF SWAP-70 Vav DOCK2 Rac
Rap1-GEF (CalDAG-GEF, C3G)
PI3Kg PIP3
RhoA
Rap1 PKCz
Cytohesin-1
RAPL Mst1
RhoH PKCz
Integrin activation
Leading edge
Rho-GEF (Lsc)
ROCK
Uropod
(B cell) Figure 4 GPCR‐triggered signals lead to integrin activation and development of the leading edge and uropod structures.
204
TAT S U O K I N A S H I
(Constantin et al., 2000). Therefore, whereas it is clear that activation of PI3K can function in inside‐out signaling following ligation of costimulatory molecules (Shimizu et al., 1995; Zell et al., 1996) or activation of c‐kit (Kinashi et al., 1995), and that a constitutively active form of the PI3Ka catalytic subunit increases ligand‐binding affinity and the observed conformational changes in LFA‐1 (Katagiri et al., 2000), the contribution of PI3K signaling pathways to integrin activation by chemokines remain ill‐defined. Indeed, although PI3K is required for efficient chemotaxis of myeloid cells (Hirsch et al., 2000; Li et al., 2000) and lymphocytes (Reif et al., 2004), studies using gene targeting of the catalytic subunits of PI3Kg, PI3Kd, or other isoforms did not show any defects indicative of reduced integrin function (Nombela‐Arrieta et al., 2004; Okkenhaug and Vanhaesebroeck, 2003). These results suggest that PI3K is critical in directional sensing but does not play a major role in integrin activation in lymphocytes. Cytohesin‐1, isolated in a yeast two‐hybrid screen using the b2 integrin cytoplasmic region as bait (Kolanus et al., 1996), has a plekstrin homology (PH) domain that binds to phosphatidylinositol (3,4,5) triphosphate (PIP3). This protein also functions as a guanine exchange factor (GEF) for members of the ADP ribosylation factor (ARF) family of GTPases (Meacci et al., 1997). Overexpression and mutational analyses showed that cytohesin‐1 upregulates LFA‐1 adhesion through valency modulation in a manner dependent on the PH domain and its association with LFA‐1. These experiments indicate a role for cytohesin‐1 in leukocyte arrest and transmigration, which also requires the actin regulator ARF6 (Weber et al., 2001). Cytohesin‐1 is reportedly involved in outside‐in signaling pathways leading to MAP kinase activation (Perez et al., 2003); however, its physiological function as an inside‐out signaling molecule has yet to be demonstrated in vivo. 7.2. Rho Pathways RhoA is involved in lymphoid polarization and chemotaxis (Sanchez‐Madrid and del Pozo, 1999). Rho signaling is thought to be critical in both chemokine‐ triggered LFA‐1 activation and LFA‐1 mediated lymphocyte homing in vivo (Constantin et al., 2000; Laudanna et al., 1996). In a transgenic mouse model, a constitutively active mutant of RhoA increase basal adhesion of thymocytes and peripheral lymphocytes to VCAM‐1, ICAM‐1, and fibronectin (Vielkind et al., 2005). The distinct RhoA effector regions differentially modulate LFA‐1 affinity and valency regulation by chemokines (Giagulli et al., 2004). For example, the high‐affinity form of LFA‐1 induced by chemokines is inhibited by the peptide containing RhoA amino acids 24–40, which also impairs lymphocyte adhesion to high‐density ICAM‐1 and in vivo homing to Peyer’s
I N T E G R I N R E G U L AT I O N O F LY M P H O C Y T E T R A F F I C K I N G
205
patches HEVs. Chemokine‐stimulated PKC‐z kinase activity and its translocation to the plasma membrane depends on PI3K partially and the RhoA 24–40 effector region, respectively. ROCK, a serine/threonine kinase effector molecule of RhoA, is ruled out in these processes using specific inhibitors. The effector molecule interacting with the RhoA 24–40 region responsible for the generation of high affinity LFA‐1 or PKC‐z translocation has not yet been identified. Rho signaling also has a negative role in integrin‐mediated adhesion. RhoA is required to retract the tail of the migrating lymphocytes and monocytes through ROCK (Smith et al., 2003; Worthylake et al., 2001). Inhibition of RhoA or ROCK increases LFA‐1‐mediated adhesion through valency modulation in human T cells (Rodriguez‐Fernandez et al., 2001). Lsc, a murine homologue of human p115 Rho GEF, is specifically expressed in hematopoietic‐lineage cells and is shown to be critical in lymphocyte motility and antigen responses (Girkontaite et al., 2001; Rubtsov et al., 2005). Lsc‐deficient B cells, especially a marginal zone B (MZB) cells display enhanced chemotactic responses to serum and sphingosine 1‐phosphate (S1P), but not chemokines. Furthermore, S1P‐ induced attachment to ICAM‐1 and VCAM‐1 is increased in Lsc‐deficient MZB cells, which display defective detachment at the trailing edge (Rubtsov et al., 2005). The chemotactic response of MZB cells to S1P is largely mediated by S1P3 (Cinamon et al., 2004), a seven transmembrane receptor coupled with Gi as well as G13 and Gq (Windh et al., 1999); the latter two activate RhoA (Sah et al., 2000). Lsc contains a regulator of G‐protein signaling (RGS) domain that downmodulates heterotrimeric G‐proteins, especially Ga13 (Hart et al., 1998; Kozasa et al., 1998). Lsc deficiency may result in sustained activation of Ga13 and impaired Rho activation at the trailing edge. Thus, ‘‘wiring’’ of Rho signaling to upstream and downstream elements may vary in distinct subcellular regions, generating positive and negative influences on integrin‐mediated adhesion and migration. 7.3. Rap1 Pathways The small GTPase Rap proteins have emerged as an important regulator of integrin adhesiveness (Bos et al., 2001). The Rap1 family consists of two highly homologous rap1a and rap1b, and two related rap2 genes. Constitutively active mutants of Rap1A and Rap1B potently increase b1, b2, and b3 integrin (Bertoni et al., 2002; Caron et al., 2000; Katagiri et al., 2000; Reedquist et al., 2000; Sebzda et al., 2002). Rap2 is also stimulatory in B cell migration (McLeod et al., 2002). Rap1 is activated by the chemokines CCL21, CXCL12, CXCL13 (Durand et al., 2006; McLeod et al., 2002; Shimonaka et al., 2003). Inhibition of Rap1 abrogates chemokine‐stimulated adhesion mediated by LFA‐1 and VLA‐4
206
TAT S U O K I N A S H I
(Shimonaka et al., 2003), indicating an important role for Rap1 in inside‐out signaling triggered by chemokines. Rap1 activation is also required for a chemoattractant S1P (Rosen and Goetzl, 2005) to induce B cell migration and adhesion to ICAM‐1 and VCAM‐1 (Durand et al., 2006). Rap1 upregulates ligand‐binding affinity to soluble dimeric ICAM‐1‐Fc and induces extended conformations of LFA‐1 detected with NKI L‐16 mAb (Katagiri et al., 2000; Reedquist et al., 2000; Tohyama et al., 2003) and also stimulates LFA‐1 clustering (Katagiri et al., 2003; Sebzda et al., 2002). Activated Rap1 also robustly stimulates lymphocyte migration on ICAM‐1 and transendothelial migration under shear flow (Shimonaka et al., 2003). The adhesion‐stimulatory effect of Rap1 requires the aL cytoplasmic domain, especially, the lysine residues at positions 1097 and 1099 after the GFFKR motif; replacement of these lysines with alanines suppressed the increases in LFA‐1 affinity and the accompanying conformational changes impairs LFA‐1 activation on stimulation with chemokines or TCR cross‐linking (Tohyama et al., 2003), emphasizing the physiological importance of this region in transmitting inside‐out signals to the extracellular region. In agreement with the proposed importance of Rap1 in chemokine‐mediated integrin activation, defective regulation of Rap1 occurs in Epstein‐Barr virus (EBV)‐transformed lymphocytes derived from some patients with LAD (Kinashi et al., 2004). Although Rap1 activation by chemokines is a pertussis toxin‐ sensitive Gi/o‐dependent process (Shimonaka et al., 2003), regulatory processes to trigger Rap1 activation including GDP/GTP exchange factors are not clear. A Rap1 exchange factor CalDAG‐GEFI and Rap1b are critically important for platelet aggregation and thrombus formation via aIIbb3 (Chrzanowska‐ Wodnicka et al., 2005; Crittenden et al., 2004), but their importance on leukocyte trafficking are not reported. Chat‐H, a hematopoietic‐specific isoform of a Cas family protein (Sakakibara et al., 2003), is shown to be involved in Rap1 activation by chemokines in lymphocytes (Regelmann et al., 2006). Knockdown of Chat‐H by lentivirus‐ mediated RNA interference impairs chemokine‐stimulated Rap1 activation and adhesion mediated by LFA‐1. Chat‐H deficient lymphocytes are also defective in lymphocyte trafficking to peripheral lymph nodes. Chat‐H localization with the plasma membrane and association with an adaptor protein CasL are required for T cell migration. Chat‐H knockdown neither affects Rac activation by chemokines nor impairs Rap1 activation by TCR ligation (Regelmann et al., 2006). Chat‐H may act as a critical signaling molecule upstream of Rap1 to regulate chemokine‐induced adhesion and migration. A Rap1‐binding protein, RAPL (regulator of adhesion and cell polarization enriched in lymphoid tissues) is isolated in a yeast two‐hybrid screen using Rap1V12 as bait (Katagiri et al., 2003). RAPL possesses a central Ras/Rap
I N T E G R I N R E G U L AT I O N O F LY M P H O C Y T E T R A F F I C K I N G
207
association (RA) domain, which has a protein‐interacting coiled‐coil region at the C‐terminus. RAPL is an alternatively spliced form of Rassf5 (also known as Nore1), which belongs to the Rassf tumor suppressor family (Tommasi et al., 2002). RAPL, which is highly expressed in lymphocytes, binds to active Rap1‐ GTP, but not inactive Rap1‐GDP, and associates with Rap1 on lymphocyte stimulation with CXCL12 or following TCR ligation, and overexpression of RAPL was shown to increase LFA‐1 avidity by both affinity and valency modulation (Katagiri et al., 2003). Activated Rap1 or RAPL overexpression also induces cell polarization similar to that seen in chemokine‐stimulated lymphocytes, showing membrane ruffling at one end (the leading edge) and formation of a uropod at the rear. Furthermore, RAPL forms a complex with LFA‐1, the formation of which is dependent on Rap1 activation as well as the presence of lysines 1097 and 1099 in the aL chain. The association of RAPL and LFA‐1 is spatially regulated; on stimulation with chemokines or the introduction of activated Rap1, RAPL associates with LFA‐1 and relocates to the leading edge, forming large patch‐like clusters (Katagiri et al., 2003). Thus, affinity and valency modulations by Rap1 and RAPL are concurrent and coordinated with cell polarization. This result is further supported by studies of lymphocytes derived from RAPL‐deficient mice (Katagiri, 2004a); RAPL‐ deficient T and B cells were defective in chemokine‐stimulated adhesion, a process dependent on LFA‐1 and VLA‐4. These cells exhibited poorly polarized morphology and minimal LFA‐1 clustering. Studies of RAPL‐deficient mice have also shown a crucial role for RAPL in other integrin‐dependent processes controlled by chemokine stimulation, such as the trafficking of lymphocytes and DCs to peripheral lymph nodes and the spleen (Katagiri, 2004). Recently, mammalian Ste20‐like kinase MST1/STK4 is identified as a critical effector of RAPL. RAPL regulates the localization and kinase activity of Mst1 (Katagiri et al., 2006). Knockdown of Mst1 demonstrates its requirement for the induction of both a polarized morphology and integrin LFA‐1 clustering and adhesion triggered by chemokines and TCR ligation. RAPL and Mst1 localize to vesicular compartments and dynamically translocate with LFA‐1 to the leading edge on Rap1 activation, suggesting the regulatory role of RAPL– Mst1 complex in intracellular transport of LFA‐1 (Katagiri et al., 2006). Rap1‐interacting adaptor molecule (RIAM also known as RARP1; Inagaki et al., 2003) is isolated by yeast two‐hybrid screening with an active Rap1 mutant as bait (Lafuente et al., 2004). RIAM is a proline‐rich 100‐kDa protein bearing RA and PH domains. RIAM interacts with the active Rap1 mutant but not H‐Ras mutant in two‐hybrid assays. RIAM interacts with actin‐regulating enabled (Ena)/vasodilator‐stimulated phosphoprotein (VASP) proteins and profilin, and belongs to the MRL (Mig10/RIAM/Lamillipodin) family of proteins (Legg and Machesky, 2004). Overexpression of RIAM‐induced conformational
208
TAT S U O K I N A S H I
changes of b1 and b2 integrins and augmented cell spreading and adhesion of Jurkat T cells to fibronectin and ICAM‐1. Knockdown of RIAM expression by RNA interference reduces levels of polymerized actin and impairs Rap1‐induced adhesion. Interestingly, RIAM knockdown displaces active Rap1 from the plasma membrane. Actin polymerization by RIAM required Ena–VASP interactions, but the pro‐adhesive effect does not require these interactions, suggesting that actin polymerization is not involved in integrin activation. RIAM is also shown to enhance talin‐dependent aIIbb3 activation (Han et al., 2006). It is not known whether RIAM regulates integrin‐mediated lymphocyte adhesion by chemokines or TCR. A murine orthologue of human RIAM is independently identified by cross‐ reactivity of an antibody that binds a proline‐rich sequence of zyxin, and termed proline‐rich EVH1 ligand 1 (PREL1; Jenzora et al., 2005). PREL1 modestly associates with an active H‐Ras mutant, but not other Ras/Rho family members, including Rap1 by pulldown assays using the RA domain of PREL1, or coimmunoprecipitation with the full‐length PREL1. PREL1 is shown to relocate to the tips of circular lamellipodia and focal adhesion, and colocalized with VASP transiently in a time course similar to that of H‐Ras activation (Jenzora et al., 2005). Although the discrepancy regarding the specificities of small GTPases to which RIAM and PREL1 interact is not clear, the conserved function of RIAM and PREIL appears to translocate and activate actin‐ remodeling machineries. Further studies are required to clarify the relationship of RIAM/PREL1 and Rap1‐regulated adhesion. 7.4. Rac Pathways The deletion of both Rac1 and Rac2 genes leads to a massive egress of hematopoietic stem/progenitor cells (HSC/Ps) into the blood. HSC/Ps deficient for Rac1 and Rac2 displays decreased adhesion to fibronectin, defective chemotaxis to CXCL12, and a failure of bone marrow engraftment (Gu et al., 2003), suggesting a critical role of Rac1 and Rac2 in integrin‐mediated stem cell adhesion. Rac2‐ deficient leukocytes are defective in shear‐dependent L‐selectin‐mediated capture on Glycam‐1 as well as F‐actin generation, and chemoattractant‐stimulated MAP kinase activation (Roberts et al., 1999). Neutrophils deficient for both Rac1 and Rac2 show normal integrin‐mediated adhesion but markedly reduced migration and defective cell spreading (Gu et al., 2003). The effects of Rac deficiency on lymphocytes trafficking has not been described yet. DOCK2, a hematopoietic‐specific member of the CDM (Ced‐5, DOCK180, Myoblast city) family of proteins, regulates Rac activation in lymphocytes (Fukui et al., 2001). Deficiency in DOCK2 severely impairs Rac1 and Rac2 activation and
I N T E G R I N R E G U L AT I O N O F LY M P H O C Y T E T R A F F I C K I N G
209
defective development of the actin cytoskeleton in lymphocytes and neutrophils stimulated by chemokines (Fukui et al., 2001; Kunisaki et al., 2006; Sanui et al., 2003). As a consequence, both in vitro lymphocyte chemotactic responses and in vivo trafficking to peripheral lymphoid organs are severely diminished in these mice (Nombela‐Arrieta et al., 2004). DOCK2 deficiency differentially affects integrin activity in T and B cells; adhesive responses to chemokines and phorbol esters through LFA‐1 and a4 integrins are diminished in B cells, but not in T cells (Nombela‐Arrieta et al., 2004). This effect was also observed in vivo using intravital microcopy to show that firm attachment to peripheral lymph node venules was only impaired for B cells. Changes in affinity for ligand, however, is not observed in DOCK2‐deficient B cells. Furthermore, as LFA‐1 clustering occurs normally in CXCL13‐stimulated B cells, it remains unclear if DOCK2 deficiency affects integrin function directly. In in vitro experiments, DOCK2‐ deficient T cells are normal in arrest and firm attachment but defective in lateral lymphocyte motility before and after transendothelial migration under flow (Shulman et al., 2006). Since actin polymerization triggered by chemokines is defective in both T and B cells from DOCK2‐deficient mice (Fukui et al., 2001; Shulman et al., 2006), but the integrin defect was seen only in DOCK2‐deficient B, it is possible that actin polymerization is not an effector executing lymphocyte integrin activation. Instead, DOCK2 may serve a regulatory role controlling Rac activation or a cytoskeleton‐independent function, which could affect other inside‐out signaling molecules in a B cell‐specific manner. Further investigation to clarify the defect in B cell integrins activation will provide insight into lineage‐ specific integrin modulation. Vav1, a hematopoietic exchange factor for Rac is activated by CXCL12 (Vicente‐Manzanares et al., 2005) in human peripheral blood lymphocytes, and overexpression of a dominant‐negative form of Vav1 abolish lymphocyte polarization, actin polymerization, and migration. In one study (Garcia‐Bernal et al., 2005), Vav1 and Rac are shown to be a critical role in CXCL12‐triggered a4b1 integrin activation to mediate VCAM‐1‐dependent attachment of Molt4 and primary T cells under static and shear flow conditions. Vav1 is also shown to be involved in LFA‐1 activation by TCR (Krawczyk et al., 2002) (see below). In contrast, neutrophils deficient for both Vav1 and Vav3, major isoforms expressed in neutrophils, are shown to be normal in chemotaxis and attachment on ICAM‐1 under shear flow or on inflamed venule in vivo but are defective in stable attachment and spreading (Gakidis et al., 2004). Activation of Rac1 and Rac2 by a chemoattractant f‐MLP are normal in Vav1/Vav3‐ deficient neutrophils, but signaling through aMb2 to activate protein kinases including PAK are severely diminished, indicating a prominent role of Vav proteins in outside‐in signaling (Gakidis et al., 2004).
210
TAT S U O K I N A S H I
SWAP‐70 is a B‐cell specific Rac exchange factor that binds to PIP3 and F‐actin through a PH domain and C‐terminal region, respectively (Ihara et al., 2006; Shinohara et al., 2002). SWAP‐70‐deficient mice does not show any abnormalities in homeostatic lymphocyte trafficking. However, lymphocyte migration to inflamed lymph nodes is reduced (Pearce et al., 2006). SWAP‐ 70‐deficient B blasts show impairment in cell polarization displaying defective uropod formation and enhanced cell spreading on anti‐CD44 antibody cross‐ linking. Although chemokine‐stimulated adhesive responses to ICAM‐1 and MAdCAM‐1 are normal, lymphocyte polarization of SWAP‐70‐deficient B cells by chemokines is also impaired with enhanced cell spreading. SWAP‐ 70‐deficient B cells normally adhere to HEV but do not enter into lymph node tissues efficiently (Pearce et al., 2006). Since SWAP‐70 is shown to modulate a transitional subset of actin filaments in fibroblastic motile cells (Hilpela et al., 2003), SWAP‐70 may have a similar role in B cells and control lymphocyte polarization and migration that is necessary during diapedesis. Coronin1, an inhibitory protein opposing actin‐polymerizing Arp2/3, has important roles in T cell morphology and migration (Foger et al., 2006). Coronin1‐deficient mice display reduced T cell numbers in peripheral blood and lymph nodes and spleens. Coronin1‐deficient T cells do not develop chemokine‐stimulated polarized cell shapes with talin segregation to the leading edge. Moreover, steady‐state F‐actin is reduced and Rac1 activation by chemokine stimulation is diminished. Consequently, coronin1‐deficient T cells are defective in chemotaxis and reduced trafficking to peripheral lymph nodes (Foger et al., 2006), but it is not reported whether coronin1 modulate integrin functions. 7.5. RhoH The small GTPase RhoH is identified as a negative regulator of LFA‐1 avidity (Cherry et al., 2004). Gene inactivation of RHOH by insertional mutagenesis or knockdown of mRNA expression with RHOH‐specific siRNA induces constitutive activation of LFA‐1 and the structural changes associated with high‐ affinity or extended LFA‐1 conformations (Cherry et al., 2004). Inactivation of RHOH also activates a4b1. These findings strongly suggest that the low adhesive state of lymphocyte integrins is actively controlled and maintained by RhoH. RhoH is a leukocyte‐specific inhibitory Rho family member known to suppress the effects of Rac, Cdc42, and RhoA on nuclear factor‐kB, or p38 MAP kinase activation. This protein does not appear to have an effect on assembly of the actin cytoskeleton induced by activated RhoA or platelet‐ derived growth factor (PDGF; Li et al., 2002), but reduced CXCL12‐stimulated F‐actin and chemotaxis, and also impairs proliferation of HSC and Rac
211
I N T E G R I N R E G U L AT I O N O F LY M P H O C Y T E T R A F F I C K I N G
activation by stem cell factor (Gu et al., 2005). Although RhoH is a member of the Ras superfamily of small GTPases, it is GTPase‐deficient and constitutively in the active GTP‐bound form. It is therefore tempting to speculate that RhoH protein levels could set a default basal level of integrin activity in resting lymphocytes.
8. Inside‐Out Signaling Events in TCR‐Stimulated Lymphocytes Once T cells recognize cognate antigen through peptide–MHC ligation of the TCR, transient, unstable adhesion to APC transforms sustained, firm adhesion, concomitant with dynamic redistribution of TCR and LFA‐1 to the contact site; LFA‐1 then translocates from the center of the contact site to the periphery, accompanied by the reciprocal movement of the TCR complex, forming a mature IS. The molecular basis of inside‐out signaling by TCR has been intensively examined, implicating Tec tyrosine kinases, Vav1, ADAP (Fyb/SLAP130), and Rap1‐RAPL, PDK1 as inside‐out signaling molecules triggered by TCR engagement (Fig. 5).
TCR complex
Lck
Zap70
LAT Itk Vav1 SLP76 PLC-g1 PKD1 C3G
Rap1-GDP
DOCK2 RIAM
ADAP PKD1 SKAP55
CalDAG -GEFs
Vav1
Ena/VASP
Rac
Lipid raft clustering
WASP
Rap1-GTP
Rap1 translocation
Actin cytoskeleton
Rap1-GTP RAPL Mst1 Integrin activation (pSMAC)
TCR clutering (cSMAC)
Figure 5 TCR‐triggered signals, leading to integrin activation, actin cytoskeleton, and TCR clustering, also lead to the development of the peripheral (pSMAC) and central (cSMAC) SMACs.
212
TAT S U O K I N A S H I
8.1. Tec Family Kinases The Tec family kinases Itk, Rlk, and Tec are important mediators of TCR signaling pathways that regulate T cell activation and differentiation (Lucas et al., 2003). For example, TCR‐triggered Itk activation stimulates b1 integrin‐ dependent T cell adhesion, which requires PI3K‐dependent Itk membrane localization and kinase activity (Woods et al., 2001). Itk activation also induces actin polymerization triggered by TCR ligation (Woods et al., 2001) or chemokine stimulation (Takesono et al., 2004). Consistent with this, T cells from Itk/ mice are defective in IS formation, adhesion through b1 and b2 integrins, calcium flux, and actin polymerization (Labno et al., 2003). Itk has also been shown to be required for chemokine‐stimulated lymphocyte migration (Fischer et al., 2004), and adhesion of chemokine‐stimulated Itk/ thymocytes to fibronectin was impaired, indicating that Itk is also involved in integrin regulation by chemokines (Fischer et al., 2004). Mechanistically, Itk is shown to be required for activation of WASP and Cdc42 at the IS, likely explaining the defect in actin polymerization and IS formation in Itk‐deficient T cells (Labno et al., 2003). However, since WASP deficiency does not affect integrin activation (Krawczyk et al., 2002), defective actin polymerization is not likely a cause of impaired integrin activity in Itk/ T cells. In contrast, Itk is important in formation of the LAT, Vav1, and SLP‐76 signaling complex and activation of PLCg‐1 (Lucas et al., 2003), indicating that inside‐out signaling triggered by Itk is mediated by these downstream elements. 8.2. Rac Signaling Pathways The importance of Vav1 in LFA‐1 activation is demonstrated by gene targeting (Krawczyk et al., 2002). Vav1‐deficient thymocytes and peripheral T cells show impaired TCR‐dependent LFA‐1 activation and IS formation, concurrent with both defective actin cytoskeleton assembly and TCR clustering. In addition, Vav1‐deficient thymocytes and T cells exhibit deficiencies in TCR‐triggered calcium flux and PLCg‐1 and PI3K activation, leading to inhibition of T cell and thymocyte growth and differentiation (Tybulewicz et al., 2003). These pleiotropic defects in Vav1‐deficient mice make it difficult to identify the signaling molecule downstream of Vav1 crucial for LFA‐1 activation. As Vav1 is a GEF for Rho family GTPases, especially Rac, it was thought that defects in the actin cytoskeleton in Vav1‐deficient T cells impaired LFA‐1 function. However, deficiency in the Rac effector WASP affects only TCR clustering, and not LFA‐1 activation, indicating distinct pathways control LFA‐1 and TCR surface distribution (Krawczyk et al., 2002). This conclusion is further supported by studies with DOCK2‐deficient lymphocytes, which demonstrate
I N T E G R I N R E G U L AT I O N O F LY M P H O C Y T E T R A F F I C K I N G
213
impaired clustering of TCR molecules. In contrast, DOCK2 deficiency had little effect on the formation of the LFA‐1 ring, suggesting that the actin cytoskeleton is dispensable for LFA‐1 ring formation (Sanui et al., 2003). 8.3. Rap1 Signaling Pathways Although previous studies have indicated that enhanced Rap1 activity is associated with T cell anergy (Boussiotis et al., 1997), Rap1 has been shown to positively regulate LFA‐1 avidity and T cell–APC conjugate formation (Katagiri et al., 2002). Consistently, disruption of the rap1a gene reduced Rap1 activation by TCR ligation concomitant with modestly impaired LFA‐1 clustering and adhesion (Duchniewicz et al., 2006). Considerable Rap1 activation remained in Rap1A‐deficient lymphocytes is likely contributed by Rap1B. On TCR engagement, Rap1 is activated, altering its localization at the T‐cell– APC interface (Katagiri et al., 2002) and plasma membrane (Bivona et al., 2004). Rap1 associates with RAPL and quickly initiates translocation from the perinuclear region to the peripheral boundaries of the immunological synapse (Katagiri et al., 2003). Dominant‐negative RAPL inhibits TCR‐induced upregulation of LFA‐1 avidity and T cell–APC conjugate formation. MST1/STK4 isolated as a RAPL‐binding partner is also colocalized at the T cell–APC interface and is required by TCR‐stimulated adhesion to ICAM‐1 (Katagiri et al., 2006). In Jurkat T cells, PLCg‐1 is required for Rap1 activation, suggesting that the calcium and diacylglycerol (DAG)‐responsive CalDAG‐GEF family of proteins, which include the Rap1 GEFs, are perhaps involved in signaling downstream of PLCg‐1 (Katagiri et al., 2004b). The requirement for PLCg‐1 for Rap1 activation in T cells is in line with studies demonstrating a requirement for PLCg‐2 in Rap1 activation following B cell receptor ligation (McLeod and Gold, 2001). Another Rap1 GEF, C3G, may also contribute to TCR‐stimulated Rap1 activation, particularly in thymocytes (Amsen et al., 2000), anergic T cells (Boussiotis et al., 1997), and Cbl‐b‐deficient T cells (Zhang et al., 2003). PLCg‐1 activation is regulated by a complex containing linker for activated T cells (LAT), the adaptor proteins Gads and SLP‐76, and Itk (Samelson, 2002). Consistent with this, signaling molecules required for TCR‐stimulated PLC‐g1 activation, such as ZAP‐70, SLP‐76, and Itk, are critical for the activation of b1 integrins (Kellermann et al., 2002). Vav1 is also involved in PLC‐g1 activation following TCR stimulation through its association with SLP‐76 and also activation by Itk (Reynolds et al., 2002), placing Rap1 and RAPL downstream of Vav1, SLP‐76, and Itk activation. This organization raises the possibility that defective LFA‐1 activation in Vav1‐deficient cells may result from insufficient Rap1 activation.
214
TAT S U O K I N A S H I
8.4. PKD1 A serine/threonine kinase PKD1 (PKCm) is shown to form a complex with Rap1 and plays an important role in b1 integrin activation (Medeiros et al., 2005). PDK1 is a DAG‐responsive PKC, which is activated by PKC and a variety of external stimuli, including TCR (Rozengurt et al., 2005). PDK1 associates with active Rap1, but not inactive Rap1, through a PH domain of PKD1 (Medeiros et al., 2005). PKD1 further forms a complex with the b1 integrin subunit, depending on the C‐terminal five amino acids of the b1 subunit that are required in activation‐dependent adhesion (Romzek et al., 1998). This tertiary complex is formed in Jurkat and primary T cells and translocated to the plasma membrane on stimulation with phorbol ester PMA and TCR ligation (Medeiros et al., 2005). Furthermore, PKD1 associates with C3G, suggesting that PKD1 acts upstream of Rap1. Surprisingly, Rap1 activation also depends on the b1 integrin expression, as Rap1 activation is diminished in b1‐deficient Jurkat cells, which is restored by the b1 expression. Knockdown of PKD1 expression reduces b1 integrin clustering and adhesion to fibronectin. A mutant PKD1 lacking the PH domain (PKD1DPH) also decreases adhesion to fibronectin as well as Rap1 activation and membrane translocation, presumably through an abortive complex formation with the b1 integrin and C3G. The kinase activity of PKD1DPH is not required for the inhibitory effects. Collectively, these results support the notion that PKD1 acts as an adaptor to localize Rap1 activation to b1 integrin (Medeiros et al., 2005). It is also reported that PKD1 associates with avb3 integrin by binding to the b3 integrin C‐terminus, and thereby promotes recycling of avb3 to newly forming focal adhesion, suggesting a regulatory role of PDK1 in vesicle transport of integrins (Woods et al., 2004). This is in agreement with a proposed function of the Rap1/RAPL/Mst1 signaling in polarized LFA‐1 transport to the leading edge (Katagiri et al., 2006) and could be also involved in PDK1 regulation of b1 integrins. 8.5. Adhesion and Degranulation Adaptor Protein Unexpected effects of adhesion and degranulation adaptor protein (ADAP; Fyb/SLAP‐130) gene targeting on LFA‐1 activation indicate that it is an important inside‐out signaling molecule. ADAP‐deficient lymphocytes exhibit impaired TCR‐triggered b1 and b2 integrin‐dependent adhesion, defective interleukin‐2 production, and decreased proliferation, despite normal calcium flux and MAP kinase activation (Griffiths et al., 2001; Peterson, 2003). ADAP does not appear to be involved in chemokine‐stimulated integrin activation. ADAP is a hematopoietic adaptor protein, which associates with SLP‐76 on
I N T E G R I N R E G U L AT I O N O F LY M P H O C Y T E T R A F F I C K I N G
215
TCR engagement, although it can also associate with the Fyn, the Ena/VASP family of actin regulators and SKAP‐55 (Peterson, 2003). ADAP deficiency impairs TCR‐stimulated LFA‐1 clustering, but does not affect TCR clustering itself or assembly of the actin cytoskeleton (Griffiths et al., 2001; Peterson et al., 2001). ADAP colocalizes with LFA‐1 in IS (Wang et al., 2004). Its association with SLP‐76 appears to be crucial for its function in LFA‐1 activation. SKAP‐55 is involved in LFA‐1 activation downstream of ADAP (Wang et al., 2003). Disruption of ADAP and SKAP‐55 complex results in displacement of Rap1 from the plasma membrane without influencing its GTPase activity. Thus, ADAP/SKAP‐55 complex may control targeting of activated Rap1 to the membrane (Kliche et al., 2006). This result is consistent with the study reporting that the localization of active Rap1‐GTP at the plasma membrane is critical for Rap1‐dependent integrin regulation in T cells (Bivona et al., 2004). 9. Concluding Remarks Recent progress prompts us to think dynamic lymphocyte trafficking in terms of a spectrum of conformational states of integrins. Structural studies support a unifying model of global conformational changes from the bent to the extended‐closed to the extended‐open on activation of integrins, and further suggest that extended conformations by separation of the leg and cytoplasmic domains triggered by inside‐out signals transmit allostery to activate the ligand‐binding I domain. Lymphocyte integrins are also regulated spatially, which is often coupled with affinity modulation, during the processes of cell polarization, migration, and IS formations. A wide variety of intracellular molecules involved in integrin‐mediated adhesion are now identified by genetic approaches and characterized at cellular and organismic levels but needs further studies to clarify their regulatory mechanisms at molecular levels. The better appreciation of physiological relevance of each state of conformation and valency regulation should be required to dissect integrin regulation that occurs in from rolling through firm adhesion to transendothelial and interstitial migration and interactions with APC. It is important to elucidate what and how intracellular signaling processes coordinately regulate conformation and spatial regulation of integrins to translate external stimulation into dynamic adhesive responses. The answers to these questions will shed light on crucial roles of integrin regulation in immunological surveillance and antigen response. Acknowledgments I would like to thank Koko Katagiri for helpful comments.
216
TAT S U O K I N A S H I
References Adair, B. D., Xiong, J. P., Maddock, C., Goodman, S. L., Arnaout, M. A., and Yeager, M. (2005). Three‐dimensional EM structure of the ectodomain of integrin aVb3 in a complex with fibronectin. J. Cell Biol. 168, 1109–1118. Amsen, D., Kruisbeek, A., Bos, J. L., and Reedquist, K. (2000). Activation of the Ras‐related GTPase Rap1 by thymocyte TCR engagement and during selection. Eur. J. Immunol. 30, 2832–2841. Becam, I. E., Tanentzapf, G., Lepesant, J. A., Brown, N. H., and Huynh, J. R. (2005). Integrin‐ independent repression of cadherin transcription by talin during axis formation in Drosophila. Nat. Cell Biol. 7, 510–516. Bertoni, A., Tadokoro, S., Eto, K., Pampori, N., Parise, L. V., White, G. C., and Shattil, S. J. (2002). Relationships between Rap1b, affinity modulation of integrin alpha IIbbeta 3, and the actin cytoskeleton. J. Biol. Chem. 277, 25715–25721. Bivona, T. G., Wiener, H. H., Ahearn, I. M., Silletti, J., Chiu, V. K., and Philips, M. R. (2004). Rap1 up‐regulation and activation on plasma membrane regulates T cell adhesion. J. Cell Biol. 164, 461–470. Bos, J. L., de Rooij, J., and Reedquist, K. A. (2001). Rap1 signaling: Adhering to new models. Nat. Rev. Mol. Cell. Biol. 2, 369–377. Boussiotis, V. A., Freeman, G. J., Berezovskaya, A., Barber, D. L., and Nadler, L. M. (1997). Maintenance of human T cell anergy: Blocking of IL‐2 gene transcription by activated Rap1. Science 278, 124–128. Bousso, P., and Robey, E. (2003). Dynamics of CD8þ T cell priming by dendritic cells in intact lymph nodes. Nat. Immunol. 4, 579–585. Burridge, K., and Connell, L. (1983). Talin: A cytoskeletal component concentrated in adhesion plaques and other sites of actin‐membrane interaction. Cell Motil. 3, 405–417. Butcher, E. C., and Picker, L. J. (1996). Lymphocyte homing and homeostasis. Science 272, 60–66. Butcher, E. C., Williams, M., Youngman, K., Rott, L., and Briskin, M. (1999). Lymphocyte trafficking and regional immunity. Adv. Immunol. 72, 209–253. Cairo, C. W., Mirchev, R., and Golan, D. E. (2006). Cytoskeletal regulation couples LFA‐1 conformational changes to receptor lateral mobility and clustering. Immunity 25, 297–308. Calderwood, D. A. (2004). Integrin activation. J. Cell Sci. 117, 657–666. Calderwood, D. A., Zent, R., Grant, R., Rees, D. J., Hynes, R. O., and Ginsberg, M. H. (1999). The Talin head domain binds to integrin beta subunit cytoplasmic tails and regulates integrin activation. J. Biol. Chem. 274, 28071–28074. Carman, C. V., and Springer, T. A. (2003). Integrin avidity regulation: Are changes in affinity and conformation underemphasized? Curr. Opin. Cell Biol. 15, 547–556. Carman, C. V., and Springer, T. A. (2004). A transmigratory cup in leukocyte diapedesis both through individual vascular endothelial cells and between them. J. Cell Biol. 167, 377–388. Caron, E., Self, A. J., and Hall, A. (2000). The GTPase Rap1 controls functional activation of macrophage integrin alphaMbeta2 by LPS and other inflammatory mediators. Curr. Biol. 10, 974–978. Chan, J. R., Hyduk, S. J., and Cybulsky, M. I. (2003). Detecting rapid and transient upregulation of leukocyte integrin affinity induced by chemokines and chemoattractants. J. Immunol. Methods 273, 43–52. Chen, J., Salas, A., and Springer, T. A. (2003). Bistable regulation of integrin adhesiveness by a bipolar metal ion cluster. Nat. Struct. Biol. 10, 995–1001. Cherry, L. K., Li, X., Schwab, P., Lim, B., and Klickstein, L. B. (2004). RhoH is required to maintain the integrin LFA‐1 in a nonadhesive state on lymphocytes. Nat. Immunol. 5, 961–967.
I N T E G R I N R E G U L AT I O N O F LY M P H O C Y T E T R A F F I C K I N G
217
Chigaev, A., Buranda, T., Dwyer, D. C., Prossnitz, E. R., and Sklar, L. A. (2003). FRET detection of cellular alpha4‐integrin conformational activation. Biophys. J. 85, 3951–3962. Chrzanowska‐Wodnicka, M., Smyth, S. S., Schoenwaelder, S. M., Fischer, T. H., and White, G. C., 2nd (2005). Rap1b is required for normal platelet function and hemostasis in mice. J. Clin. Invest. 115, 680–687. Cinamon, G., Shinder, V., and Alon, R. (2001). Shear forces promote lymphocyte migration across vascular endothelium bearing apical chemokines. Nat. Immunol. 2, 515–522. Cinamon, G., Matloubian, M., Lesneski, M. J., Xu, Y., Low, C., Lu, T., Proia, R. L., and Cyster, J. G. (2004). Sphingosine 1‐phosphate receptor 1 promotes B cell localization in the splenic marginal zone. Nat. Immunol. 5, 713–720. Constantin, G., Majeed, M., Giagulli, C., Piccio, L., Kim, J. Y., Butcher, E. C., and Laudanna, C. (2000). Chemokines trigger immediate b2 integrin affinity and mobility changes: Differential regulation and roles in lymphocyte arrest under flow. Immunity 13, 759–769. Crittenden, J. R., Bergmeier, W., Zhang, Y., Piffath, C. L., Liang, Y., Wagner, D. D., Housman, D. E., and Graybiel, A. M. (2004). CalDAG‐GEFI integrates signaling for platelet aggregation and thrombus formation. Nat. Med. 10, 982–986. de Bruyn, K. M., Zwartkruis, F. J., de Rooij, J., Akkerman, J. W., and Bos, J. L. (2003). The small GTPase Rap1 is activated by turbulence and is involved in integrin aIIbb3‐mediated cell adhesion in human megakaryocytes. J. Biol. Chem. 278, 22412–22417. Dransfield, I., Cabanas, C., Craig, A., and Hogg, N. (1992). Divalent cation regulation of the function of the leukocyte integrin LFA‐1. J. Cell Biol. 116, 219–226. Duchniewicz, M., Zemojtel, T., Kolanczyk, M., Grossmann, S., Scheele, J. S., and Zwartkruis, F. J. (2006). Rap1A‐deficient T and B cells show impaired integrin‐mediated cell adhesion. Mol. Cell. Biol. 26, 643–653. Durand, C. A., Westendorf, J., Tse, K. W., and Gold, M. R. (2006). The Rap GTPases mediate CXCL13‐ and sphingosine1‐phosphate‐induced chemotaxis, adhesion, and Pyk2 tyrosine phosphorylation in B lymphocytes. Eur. J. Immunol. 36, 2235–2249. Dustin, M. L., and Springer, T. A. (1989). T‐cell receptor cross‐linking transiently stimulates adhesiveness through LFA‐1. Nature 341, 619–624. Dustin, M. L., Bivona, T. G., and Philips, M. R. (2004). Membranes as messengers in T cell adhesion signaling. Nat. Immunol. 5, 363–372. Ebisuno, Y., Tanaka, T., Kanemitsu, N., Kanda, H., Yamaguchi, K., Kaisho, T., Akira, S., and Miyasaka, M. (2003). Cutting edge: The B cell chemokine CXC chemokine ligand 13/B lymphocyte chemoattractant is expressed in the high endothelial venules of lymph nodes and Peyer’s patches and affects B cell trafficking across high endothelial venules. J. Immunol. 171, 1642–1646. Etzioni, A. (1996). Adhesion molecules: Their role in health and disease. Pediatr. Res. 39, 191–198. Fabbri, M., Fumagalli, L., Bossi, G., Bianchi, E., Bender, J. R., and Pardi, R. (1999). A tyrosine‐ based sorting signal in the b2 integrin cytoplasmic domain mediates its recycling to the plasma membrane and is required for ligand‐supported migration. EMBO J. 18, 4915–4925. Fabbri, M., Di Meglio, S., Gagliani, M. C., Consonni, E., Molteni, R., Bender, J. R., Tacchetti, C., and Pardi, R. (2005). Dynamic partitioning into lipid rafts controls the endo‐exocytic cycle of the aL /b2 integrin, LFA‐1, during leukocyte chemotaxis. Mol. Biol. Cell 16, 5793–5803. Fagerholm, S. C., Hilden, T. J., and Gahmberg, C. G. (2004). P marks the spot: Site‐specific integrin phosphorylation regulates molecular interactions. Trends Biochem. Sci. 29, 504–512. Fagerholm, S. C., Hilden, T. J., Nurmi, S. M., and Gahmberg, C. G. (2005). Specific integrin alpha and b chain phosphorylations regulate LFA‐1 activation through affinity‐dependent and ‐independent mechanisms. J. Cell Biol. 171, 705–715.
218
TAT S U O K I N A S H I
Feng, D., Nagy, J. A., Pyne, K., Dvorak, H. F., and Dvorak, A. M. (1998). Neutrophils emigrate from venules by a transendothelial cell pathway in response to FMLP. J. Exp. Med. 187, 903–915. Fischer, A. M., Mercer, J. C., Iyer, A., Ragin, M. J., and August, A. (2004). Regulation of CXC chemokine receptor 4‐mediated migration by the Tec family tyrosine kinase ITK. J. Biol. Chem. 279, 29816–29820. Foger, N., Rangell, L., Danilenko, D. M., and Chan, A. C. (2006). Requirement for coronin 1 in T lymphocyte trafficking and cellular homeostasis. Science 313, 839–842. Friedman, R. S., Jacobelli, J., and Krummel, M. F. (2005). Mechanisms of T cell motility and arrest: Deciphering the relationship between intra‐ and extracellular determinants. Semin. Immunol. 17, 387–399. Friedman, R. S., Jacobelli, J., and Krummel, M. F. (2006). Surface‐bound chemokines capture and prime T cells for synapse formation. Nat. Immunol. 7, 1101–1108. Fukui, Y., Hashimoto, O., Sanui, T., Oono, T., Koga, H., Abe, M., Inayoshi, A., Noda, M., Oike, M., Shirai, T., and Sasazuki, T. (2001). Haematopoietic cell‐specific CDM family protein DOCK2 is essential for lymphocyte migration. Nature 412, 826–831. Gakidis, M. A., Cullere, X., Olson, T., Wilsbacher, J. L., Zhang, B., Moores, S. L., Ley, K., Swat, W., Mayadas, T., and Brugge, J. S. (2004). Vav GEFs are required for b2 integrin‐dependent functions of neutrophils. J. Cell Biol. 166, 273–282. Garcia‐Bernal, D., Wright, N., Sotillo‐Mallo, E., Nombela‐Arrieta, C., Stein, J. V., Bustelo, X. R., and Teixido, J. (2005). Vav1 and Rac control chemokine‐promoted T lymphocyte adhesion mediated by the integrin a4b1. Mol. Biol. Cell. 16, 3223–3235. Giagulli, C., Scarpini, E., Ottoboni, L., Narumiya, S., Butcher, E. C., Constantin, G., and Laudanna, C. (2004). RhoA and zeta PKC control distinct modalities of LFA‐1 activation by chemokines: Critical role of LFA‐1 affinity triggering in lymphocyte in vivo homing. Immunity 20, 25–35. Girkontaite, I., Missy, K., Sakk, V., Harenberg, A., Tedford, K., Potzel, T., Pfeffer, K., and Fischer, K. D. (2001). Lsc is required for marginal zone B cells, regulation of lymphocyte motility and immune responses. Nat. Immunol. 2, 855–862. Gomez‐Mouton, C., Abad, J. L., Mira, E., Lacalle, R. A., Gallardo, E., Jimenez‐Baranda, S., Illa, I., Bernad, A., Manes, S., and Martinez, A. C. (2001). Segregation of leading‐edge and uropod components into specific lipid rafts during T cell polarization. Proc. Natl. Acad. Sci. USA 98, 9642–9647. Grabovsky, V., Feigelson, S., Chen, C., Bleijs, D. A., Peled, A., Cinamon, G., Baleux, F., Arenzana, S. F., Lapidot, T., van Kooyk, Y., Lobb, R. R., and Alon, R. (2000). Subsecond induction of alpha4 integrin clustering by immobilized chemokines stimulates leukocyte tethering and rolling on endothelial vascular cell adhesion molecule 1 under flow conditions. J. Exp. Med. 192, 495–506. Grakoui, A., Bromley, S. K., Sumen, C., Davis, M. M., Shaw, A. S., Allen, P. M., and Dustin, M. L. (1999). The immunological synapse: A molecular Machine controlling T cell activation. Science 285, 221–226. Green, C. E., Schaff, U. Y., Sarantos, M. R., Lum, A. F., Staunton, D. E., and Simon, S. I. (2006). Dynamic shifts in LFA‐1 affinity regulate neutrophil rolling, arrest, and transmigration on inflamed endothelium. Blood 107, 2101–2111. Griffiths, E. K., Krawczyk, C., Kong, Y. Y., Raab, M., Hyduk, S. J., Bouchard, D., Chan, V. S., Kozieradzki, I., Oliveira‐Dos‐Santos, A. J., Wakeham, A., Ohashi, P. S., Cybulsky, M. I., et al. (2001). Positive regulation of T cell activation and integrin adhesion by the adapter Fyb/Slap. Science 293, 2260–2263. Gu, Y., Filippi, M. D., Cancelas, J. A., Siefring, J. E., Williams, E. P., Jasti, A. C., Harris, C. E., Lee, A. W., Prabhakar, R., Atkinson, S. J., Kwiatkowski, D. J., and Williams, D. A. (2003). Hematopoietic cell regulation by Rac1 and Rac2 guanosine triphosphatases. Science 302, 445–449.
I N T E G R I N R E G U L AT I O N O F LY M P H O C Y T E T R A F F I C K I N G
219
Gu, Y., Jasti, A. C., Jansen, M., and Siefring, J. E. (2005). RhoH, a hematopoietic‐specific Rho GTPase, regulates proliferation, survival, migration, and engraftment of hematopoietic progenitor cells. Blood 105, 1467–1475. Gunzer, M., Schafer, A., Borgmann, S., Grabbe, S., Zanker, K. S., Broker, E.‐B. E. K., and Friedl, P. (2000). Antigen presentation in extracellular matrix: Interactions of T cells with dendritic cells are dynamic, short lived, and sequential. Immunity 13, 323–332. Han, J., Lim, C. J., Watanabe, N., Soriani, A., Ratnikov, B., Calderwood, D. A., Puzon‐McLaughlin, W., Lafuente, E. M., Boussiotis, V. A., Shattil, S. J., and Ginsberg, M. H. (2006). Reconstructing and deconstructing agonist‐induced activation of integrin aIIbb3. Curr. Biol. 16, 1796–1806. Hart, M. J., Jiang, X., Kozasa, T., Roscoe, W., Singer, W. D., Gilman, A. G., Sternweis, P. C., and Bollag, G. (1998). Direct stimulation of the guanine nucleotide exchange activity of p115 RhoGEF by Ga13. Science 280, 2112–2114. Hemler, M. E. (1990). VLA proteins in the integrin family: Structures, functions, and their role on leukocytes. Annu. Rev. Immunol. 8, 365–400. Hibbs, M. L., Jakes, S., Stacker, S. A., Wallace, R. W., and Springer, T. A. (1991). The cytoplasmic domain of the integrin lymphocyte‐function‐associated antigen 1 b subunit: Sites required for binding to intercellular adhesion molecules 1 and the phorbol ester‐stimulated phosphorylation site. J. Exp. Med. 174, 1227–1238. Hilpela, P., Oberbanscheidt, P., Hahne, P., Hund, M., Kalhammer, G., Small, J. V., and Bahler, M. (2003). SWAP‐70 identifies a transitional subset of actin filaments in motile cells. Mol. Biol. Cell 14, 3242–3253. Hirsch, E., Katanaev, V. L., Garlanda, C., Azzolino, O., Pirola, L., Silengo, L., Sozzani, S., Mantovani, A., Altruda, F., and Wymann, M. P. (2000). Central role for G protein‐coupled phosphoinositide 3‐kinase gamma in inflammation. Science 287, 1049–1053. Horwitz, A., Duggan, K., Buck, C., Beckerle, M. C., and Burridge, K. (1986). Interaction of plasma membrane fibronectin receptor with talin: A transmembrane linkage. Nature 320, 531–533. Hughes, P. E., Diaz‐Gonzalez, F., Leong, L., Wu, C., McDonald, J. A., Shattil, S. J., and Ginsberg, M. H. (1996). Breaking the integrin hinge. J. Biol. Chem. 271, 6571–6574. Humphries, M. J. (2004). Monoclonal antibodies as probes of integrin priming and activation. Biochem. Soc. Trans. 32, 407–411. Huth, J. R., Olejniczak, E. T., Mendoza, R., Liang, H., Harris, E. A., Lupher, M. L., Jr., Wilson, A. E., Fesik, S. W., and Staunton, D. E. (2000). NMR and mutagenesis evidence for an I domain allosteric site that regulates lymphocyte function‐associated antigen 1 ligand binding. Proc. Natl. Acad. Sci. USA 97, 5231–5236. Hynes, R. O. (2002). Integrins: Bidirectional, allosteric signalling machines. Cell 110, 673–687. Ihara, S., Oka, T., and Fukui, Y. (2006). Direct binding of SWAP‐70 to non‐muscle actin is required for membrane ruffling. J. Cell Sci. 119, 500–507. Inagaki, T., Suzuki, S., Miyamoto, T., Takeda, T., Yamashita, K., Komatsu, A., Yamauchi, K., and Hashizume, K. (2003). The retinoic acid‐responsive proline‐rich protein is identified in promyeloleukemic HL‐60 cells. J. Biol. Chem. 278, 51685–51692. Jenzora, A., Behrendt, B., Small, J. V., Wehland, J., and Stradal, T. E. (2005). PREL1 provides a link from Ras signalling to the actin cytoskeleton via Ena / VASP proteins. FEBS Lett. 579, 455–463. Johnson‐Leger, C., Aurrand‐Lions, M., and Imhof, B. A. (2000). The parting of the endothelium: Miracle, or simply a junctional affair? J. Cell Sci. 113(Pt. 6), 921–933. Jones, M. C., Caswell, P. T., and Norman, J. C. (2006). Endocytic recycling pathways: Emerging regulators of cell migration. Curr. Opin. Cell Biol. 18, 549–557. Katagiri, K., Hattori, M., Minato, N., Irie, S., Takatsu, K., and Kinashi, T. (2000). Rap1 is a potent activation signal for leukocyte function‐associated antigen 1 distinct from protein kinase C and phosphatidylinositol‐3‐OH kinase. Mol. Cell. Biol. 20, 1956–1969.
220
TAT S U O K I N A S H I
Katagiri, K., Hattori, M., Minato, N., and Kinashi, T. (2002). Rap1 functions as a key regulator of T‐cell and antigen‐presenting cell interactions and modulates T‐cell responses. Mol. Cell. Biol. 22, 1001–1015. Katagiri, K., Maeda, A., Shimonaka, M., and Kinashi, T. (2003). RAPL, a Rap1‐binding molecule that mediates Rap1‐induced adhesion through spatial regulation of LFA‐1. Nat. Immunol. 4, 741–748. Katagiri, K., Ohnishi, N., Kabashima, K., Iyoda, T., Takeda, N., Shinkai, Y., Inaba, K., and Kinashi, T. (2004a). Crucial roles of Rap1 effector molecule RAPL in lymphocyte and dendritic cell trafficking. Nat. Immunol. 5, 1045–1051. Katagiri, K., Shimonaka, M., and Kinashi, T. (2004b). Rap1‐mediated LFA‐1 activation by the T cell antigen receptor is dependent on PLC‐g1. J. Biol. Chem. 279, 11875–11881. Katagiri, K., Imamura, M., and Kinashi, T. (2006). Spatiotemporal regulation of the kinase Mst1 by binding protein RAPL is critical for lymphocyte polarity and adhesion. Nat. Immunol. 7, 919–928. Kellermann, S. A., Dell, C. L., Hunt, S. W., 3rd, and Shimizu, Y. (2002). Genetic analysis of integrin activation in T lymphocytes. Immunol. Rev. 186, 172–188. Kim, M., Carman, C. V., and Springer, T. A. (2003). Bidirectional transmembrane signaling by cytoplasmic domain separation in integrins. Science 301, 1720–1725. Kinashi, T., Escobedo, J. A., Williams, L. T., Takatsu, K., and Springer, T. A. (1995). Receptor tyrosine kinase stimulates cell‐matrix adhesion by phosphatidylinositol 3 kinase and phospholipase C‐g1 pathways. Blood 86, 2086–2090. Kinashi, T., Aker, M., Sokolovsky‐Eisenberg, M., Grabovsky, V., Tanaka, C., Shamri, R., Feigelson, S., Etzioni, A., and Alon, R. (2004). LAD‐III, a leukocyte adhesion deficiency syndrome associated with defective Rap1 activation and impaired stabilization of integrin bonds. Blood 103, 1033–1036. Kliche, S., Breitling, D., Togni, M., Pusch, R., Heuer, K., Wang, X., Freund, C., Kasirer‐Friede, A., Menasche, G., Koretzky, G. A., and Schraven, B. (2006). The ADAP/SKAP55 signaling module regulates T‐cell receptor‐mediated integrin activation through plasma membrane targeting of Rap1. Mol. Cell. Biol. 26, 7130–7144. Kolanus, W., Nagel, W., Schiller, B., Zeitlmann, L., Godar, S., Stockinger, H., and Seed, B. (1996). aLb2 integrin/LFA‐1 binding to ICAM‐1 induced by cytohesin‐1, a cytoplasmic regulatory molecule. Cell 86, 233–242. Kozasa, T., Jiang, X., Hart, M. J., Sternweis, P. M., Singer, W. D., Gilman, A. G., Bollag, G., and Sternweis, P. C. (1998). p115 RhoGEF, a GTPase activating protein for Galpha12 and Galpha13. Science 280, 2109–2111. Krawczyk, C., Oliveira‐dos‐Santos, A., Sasaki, T., Griffiths, E., Ohashi, P. S., Snapper, S., Alt, F., and Penninger, J. M. (2002). Vav1 controls integrin clustering and MHC/peptide‐specific cell adhesion to antigen‐presenting cells. Immunity 16, 331–343. Kucik, D. F., Dustin, M. L., Miller, J. M., and Brown, E. J. (1996). Adhesion‐activating phorbol ester increases the mobility of leukocyte integrin LFA‐1 in cultured lymphocytes. J. Clin. Invest. 97, 2139–2144. Kunisaki, Y., Nishikimi, A., Tanaka, Y., Takii, R., Noda, M., Inayoshi, A., Watanabe, K., Sanematsu, F., Sasazuki, T., Sasaki, T., and Fukui, Y. (2006). DOCK2 is a Rac activator that regulates motility and polarity during neutrophil chemotaxis. J. Cell Biol. 174, 647–652. Labno, C. M., Lewis, C. M., You, D., Leung, D. W., Takesono, A., Kamberos, N., Seth, A., Finkelstein, L. D., Rosen, M. K., Schwartzberg, P. L., and Burkhardt, J. K. (2003). Itk functions to control actin polymerization at the immune synapse through localized activation of Cdc42 and WASP. Curr. Biol. 13, 1619–1624.
I N T E G R I N R E G U L AT I O N O F LY M P H O C Y T E T R A F F I C K I N G
221
Lafuente, E. M., van Puijenbroek, A. A., Krause, M., Carman, C. V., Freeman, G. J., Berezovskaya, A., Constantine, E., Springer, T. A., Gertler, F. B., and Boussiotis, V. A. (2004). RIAM, an Ena/ VASP and Profilin ligand, interacts with Rap1‐GTP and mediates Rap1‐induced adhesion. Dev. Cell 7, 585–595. Larson, R. S., Davis, T., Bologa, C., Semenuk, G., Vijayan, S., Li, Y., Oprea, T., Chigaev, A., Buranda, T., Wagner, C. R., and Sklar, L. A. (2005). Dissociation of I domain and global conformational changes in LFA‐1: Refinement of small molecule‐I domain structure‐activity relationships. Biochemistry 44, 4322–4331. Laudanna, C., Campbell, J. J., and Butcher, E. C. (1996). Role of Rho in chemoattractant‐activated leukocyte adhesion through integrins. Science 271, 981–983. Lawson, M. A., and Maxfield, R. R. (1995). Ca2þ‐ and calcineurin‐dependent recycling of an integrin to the front of migrating neutrophils. Nature 377, 75–79. Legg, J. A., and Machesky, L. M. (2004). MRL proteins: Leading Ena/VASP to Ras GTPases. Nat. Cell Biol. 6, 1015–1017. Li, S., Kim, M., Hu, Y. L., Jalali, S., Schlaepfer, D. D., Hunter, T., Chien, S., and Shyy, J. Y. (1997). Fluid shear stress activation of focal adhesion kinase: Linking to mitogen‐activated protein kinases. J. Biol. Chem. 272, 30455–30462. Li, X., Bu, X., Lu, B., Avraham, H., Flavell, R. A., and Lim, B. (2002). The hematopoiesis‐specific GTP‐binding protein RhoH is GTPase deficient and modulates activities of other Rho GTPases by an inhibitory function. Mol. Cell. Biol. 22, 1158–1171. Li, Z., Jiang, H., Xie, W., Zhang, Z., Smrcka, A. V., and Wu, D. (2000). Roles of PLC‐b2 and ‐b3 and PI3Kg in chemoattractant‐mediated signal transduction. Science 287, 1046–1049. Liu, S., Calderwood, D. A., and Ginsberg, M. H. (2000). Integrin cytoplasmic domain‐binding proteins. J. Cell Sci. 113(Pt. 20), 3563–3571. Lo, C. G., Lu, T. T., and Cyster, J. G. (2003). Integrin‐dependence of lymphocyte entry into the splenic white pulp. J. Exp. Med. 197, 353–361. Lollo, B. A., Chan, K. W., Hanson, E. M., Moy, V. T., and Brian, A. A. (1993). Direct evidence for two affinity states for lymphocyte function‐associated antigen 1 on activated T cells. J. Biol. Chem. 268, 21693–21700. Lu, C., Ferzly, M., Takagi, J., and Springer, T. A. (2001a). Epitope mapping of antibodies to the C‐terminal region of the integrin beta 2 subunit reveals regions that become exposed upon receptor activation. J. Immunol. 166, 5629–5637. Lu, C., Shimaoka, M., Zang, Q., Takagi, J., and Springer, T. A. (2001b). Locking in alternate conformations of the integrin alphaLbeta2 I domain with disulfide bonds reveals functional relationships among integrin domains. Proc. Natl. Acad. Sci. USA 98, 2393–2398. Lu, C., Shimaoka, M., Salas, A., and Springer, T. A. (2004). The binding sites for competitive antagonistic, allosteric antagonistic, and agonistic antibodies to the I domain of integrin LFA‐1. J. Immunol. 173, 3972–3978. Lu, C.‐H., and Springer, T. A. (1997). The a subunit cytoplasmic domain regulates the assembly and adhesiveness of integrin lymphocyte‐function‐associated antigen‐1. J. Immunol. 159, 268–278. Lucas, J. A., Miller, A. T., Atherly, L. O., and Berg, L. J. (2003). The role of Tec family kinases in T cell development and function. Immunol. Rev. 191, 119–138. Luo, B. H., Takagi, J., and Springer, T. A. (2004). Locking the beta3 integrin I‐like domain into high and low affinity conformations with disulfides. J. Biol. Chem. 279, 10215–10221. McLeod, S. J., and Gold, M. R. (2001). Activation and function of the Rap1 GTPase in B lymphocytes. Int. Rev. Immunol. 20, 763–789. McLeod, S. J., Li, A. H., Lee, R. L., Burgess, A. E., and Gold, M. R. (2002). The Rap GTPases regulate B cell migration toward the chemokine stromal cell‐derived factor‐1 (CXCL12): Potential role for Rap2 in promoting B cell migration. J. Immunol. 169, 1365–1371.
222
TAT S U O K I N A S H I
Meacci, E., Tsai, S. C., Adamik, R., Moss, J., and Vaughan, M. (1997). Cytohesin‐1, a cytosolic guanine nucleotide‐exchange protein for ADP‐ribosylation factor. Proc. Natl. Acad. Sci. USA 94, 1745–1748. Medeiros, R. B., Dickey, D. M., Chung, H., Quale, A. C., Nagarajan, L. R., Billadeau, D. D., and Shimizu, Y. (2005). Protein kinase D1 and the beta 1 integrin cytoplasmic domain control beta 1 integrin function via regulation of Rap1 activation. Immunity 23, 213–226. Mempel, T. R., Henrickson, S. E., and Von Andrian, U. H. (2004). T‐cell priming by dendritic cells in lymph nodes occurs in three distinct phases. Nature 427, 154–159. Miller, M. J., Wei, S. H., Parker, I., and Cahalan, M. D. (2002). Two‐photon imaging of lymphocyte motility and antigen response in intact lymph node. Science 296, 1869–1873. Miller, M. J., Safrina, O., Parker, I., and Cahalan, M. D. (2004). Imaging the single cell dynamics of CD4þ T cell activation by dendritic cells in lymph nodes. J. Exp. Med. 200, 847–856. Miyasaka, M., and Tanaka, T. (2004). Lymphocyte trafficking across high endothelial venules: Dogmas and enigmas. Nat. Rev. Immunol. 4, 360–370. Monks, C. R., Freiberg, B. A., Kupfer, H., Sciaky, N., and Kufper, A. (1998). Three‐dimensional segregation of supramolecular activation clusters in T cells. Nature 395, 82–86. Moser, B., Wolf, M., Walz, A., and Loetscher, P. (2004). Chemokines: Multiple levels of leukocyte migration control. Trends Immunol. 25, 75–84. Mould, A. P., Askari, J. A., Barton, S., Kline, A. D., McEwan, P. A., Craig, S. E., and Humphries, M. J. (2002). Integrin activation involves a conformational change in the alpha 1 helix of the beta subunit A‐domain. J. Biol. Chem. 277, 19800–19805. Mould, A. P., Barton, S. J., Askari, J. A., Craig, S. E., and Humphries, M. J. (2003a). Role of ADMIDAS cation‐binding site in ligand recognition by integrin a5b1. J. Biol. Chem. 278, 51622–51629. Mould, A. P., Barton, S. J., Askari, J. A., McEwan, P. A., Buckley, P. A., Craig, S. E., and Humphries, M. J. (2003b). Conformational changes in the integrin beta A domain provide a mechanism for signal transduction via hybrid domain movement. J. Biol. Chem. 278, 17028– 17035. Muller, W. A. (2003). Leukocyte‐endothelial‐cell interactions in leukocyte transmigration and the inflammatory response. Trends Immunol. 24, 327–334. Nieminen, M., Henttinen, T., Merinen, M., Marttila‐Ichihara, F., Eriksson, J. E., and Jalkanen, S. (2006). Vimentin function in lymphocyte adhesion and transcellular migration. Nat. Cell Biol. 8, 156–162. Nishida, N., Xie, C., Shimaoka, M., Cheng, Y., Walz, T., and Springer, T. A. (2006). Three distinctive ectodomain conformations and their interconversion in leukocyte b2 integrins. Immunity. 25, 583–594. Nombela‐Arrieta, C., Lacalle, R. A., Montoya, M. C., Kunisaki, Y., Megias, D., Marques, M., Carrera, A. C., Manes, S., Fukui, Y., Martinez, A. C., and Stein, J. V. (2004). Differential requirements for DOCK2 and phosphoinositide‐3‐kinase gamma during T and B lymphocyte homing. Immunity 21, 429–441. Okada, T., Ngo, V. N., Ekland, E. H., Forster, R., Lipp, M., Littman, D. R., and Cyster, J. G. (2002). Chemokine requirements for B cell entry to lymph nodes and Peyer’s patches. J. Exp. Med. 196, 65–75. Okkenhaug, K., and Vanhaesebroeck, B. (2003). PI3K in lymphocyte development, differentiation and activation. Nat. Rev. Immunol. 3, 317–330. Pearce, G., Angeli, V., Randolph, G. J., Junt, T., von Andrian, U., Schnittler, H. J., and Jessberger, R. (2006). Signaling protein SWAP‐70 is required for efficient B cell homing to lymphoid organs. Nat. Immunol. 7, 827–834.
I N T E G R I N R E G U L AT I O N O F LY M P H O C Y T E T R A F F I C K I N G
223
Perez, O. D., Mitchell, D., Jager, G. C., South, S., Murriel, C., McBride, J., Herzenberg, L. A., Kinoshita, S., and Nolan, G. P. (2003). Leukocyte functional antigen 1 lowers T cell activation thresholds and signaling through cytohesin‐1 and Jun‐activating binding protein 1. Nat. Immunol. 4, 1083–1092. Peterson, E. J. (2003). The TCR ADAPts to integrin‐mediated cell adhesion. Immunol. Rev. 192, 113–121. Peterson, E. J., Woods, M. L., Dmowski, S. A., Derimanov, G., Jordan, M. S., Wu, J. N., Myung, P. S., Liu, Q. H., Pribila, J. T., Freedman, B. D., Shimizu, Y., and Koretzky, G. A. (2001). Coupling of the TCR to integrin activation by Slap‐130/Fyb. Science 293, 2263–2265. Petruzzelli, L., Maduzia, L., and Springer, T. A. (1995). Activation of lymphocyte function‐ associated molecule‐1 (CD11a/CD18) and Mac‐1 (CD11b/CD18) mimicked by an antibody directed against CD18. J. Immunol. 155, 854–866. Reedquist, K. A., Ross, E., Koop, E. A., Wolthuis, R. M., Zwartkruis, F. J., van Kooyk, Y., Salmon, M., Buckley, C. D., and Bos, J. L. (2000). The small GTPase, Rap1, mediates CD31‐induced integrin adhesion. J. Cell Biol. 148, 1151–1158. Regelmann, G. A., Danzi, N. M., Wanjalla, C., and Alexandropoulos, K. (2006). Chat‐H regulates T lymphocyte trafficking by acting upstream of Rap1 in chemokine‐induced inside‐out signaling. Immunity. 25, 907–918. Reif, K., Okkenhaug, K., Sasaki, T., Penninger, J. M., Vanhaesebroeck, B., and Cyster, J. G. (2004). Cutting edge: Differential roles for phosphoinositide 3‐kinases, p110gamma and p110delta, in lymphocyte chemotaxis and homing. J. Immunol. 173, 2236–2240. Reynolds, L. F., Smyth, L. A., Norton, T., Freshney, N., Downward, J., Kioussis, D., and Tybulewicz, V. L. (2002). Vav1 transduces T cell receptor signals to the activation of phospholipase C‐g1 via phosphoinositide 3‐kinase‐dependent and ‐independent pathways. J. Exp. Med. 195, 1103–1114. Roberts, A. W., Kim, C., Zhen, L., Lowe, J. B., Kapur, R., Petryniak, B., Spaetti, A., Pollock, J. D., Borneo, J. B., Bradford, G. B., Atkinson, S. J., Dinauer, M. C., et al. (1999). Deficiency of the hematopoietic cell‐specific Rho family GTPase Rac2 is characterized by abnormalities in neutrophil function and host defense. Immunity 10, 183–196. Robinson, M. K., Andrew, D., Rosen, H., Brown, D., Ortlepp, S., Stephens, P., and Butcher, E. C. (1992). Antibody against the Leu‐CAM beta‐chain (CD18) promotes both LFA‐1‐ and CR3‐ dependent adhesion events. J. Immunol. 148, 1080–1085. Rodriguez‐Fernandez, J. L., Sanchez‐Martin, L., Rey, M., Vicente‐Manzanares, M., Narumiya, S., Teixido, J., Sanchez‐Madrid, F., and Cabanas, C. (2001). Rho and Rho‐associated kinase modulate the tyrosine kinase PYK2 in T‐cells through regulation of the activity of the integrin LFA‐1. J. Biol. Chem. 276, 40518–40527. Romzek, N. C., Harris, E. S., Dell, C. L., Skronek, J., Hasse, E., Reynolds, P. J., Hunt, S. W., 3rd, and Shimizu, Y. (1998). Use of a beta1 integrin‐deficient human T cell to identify beta1 integrin cytoplasmic domain sequences critical for integrin function. Mol. Biol. Cell 9, 2715–2727. Rosen, H., and Goetzl, E. J. (2005). Sphingosine 1‐phosphate and its receptors: An autocrine and paracrine network. Nat. Rev. Immunol. 5, 560–570. Rozengurt, E., Rey, O., and Waldron, R. T. (2005). Protein kinase D signaling. J. Biol. Chem. 280, 13205–13208. Rubtsov, A., Strauch, P., Digiacomo, A., Hu, J., Pelanda, R., and Torres, R. M. (2005). Lsc regulates marginal‐zone B cell migration and adhesion and is required for the IgM T‐dependent antibody response. Immunity 23, 527–538. Sah, V. P., Seasholtz, T. M., Sagi, S. A., and Brown, J. H. (2000). The role of Rho in G protein‐ coupled receptor signal transduction. Annu. Rev. Pharmacol. Toxicol. 40, 459–489.
224
TAT S U O K I N A S H I
Sakakibara, A., Hattori, S., Nakamura, S., and Katagiri, T. (2003). A novel hematopoietic adaptor protein, Chat‐H, positively regulates T cell receptor‐mediated interleukin‐2 production by Jurkat cells. J. Biol. Chem. 278, 6012–6017. Salas, A., Shimaoka, M., Chen, S., Carman, C. V., and Springer, T. (2002). Transition from rolling to firm adhesion is regulated by the conformation of the I domain of the integrin lymphocyte function‐associated antigen‐1. J. Biol. Chem. 277, 50255–50262. Salas, A., Shimaoka, M., Kogan, A. N., Harwood, C., von Andrian, U. H., and Springer, T. A. (2004). Rolling adhesion through an extended conformation of integrin aLb2 and relation to alpha I and beta I‐like domain interaction. Immunity 20, 393–406. Salas, A., Shimaoka, M., Phan, U., Kim, M., and Springer, T. A. (2006). Transition from rolling to firm adhesion can be mimicked by extension of integrin aLb2 in an intermediate affinity state. J. Biol. Chem. 281, 10876–10882. Samelson, L. E. (2002). Signal transduction mediated by the T cell antigen receptor: The role of adapter proteins. Annu. Rev. Immunol. 20, 371–394. Sampath, R., Gallagher, P. J., and Pavalko, F. M. (1998). Cytoskeletal interactions with the leukocyte integrin beta2 cytoplasmic tail: Activation‐dependent regulation of associations with talin and a‐actinin. J. Biol. Chem. 273, 33588–33594. Sanchez‐Madrid, F., and del Pozo, M. A. (1999). Leukocyte polarization in cell migration and immune interactions. EMBO J. 18, 501–511. Sanui, T., Inayoshi, A., Noda, M., Iwata, E., Oike, M., Sasazuki, T., and Fukui, Y. (2003). DOCK2 is essential for antigen‐induced translocation of TCR and lipid rafts, but not PKC‐theta and LFA‐1, in T cells. Immunity 19, 119–129. Sastry, S. K., and Horwitz, A. F. (1993). Integrin cytoplasmic domains: Mediators of cytoskeletal linkages and extra‐ and intracellular initiated transmembrane signaling. Curr. Biol. 5, 819–831. Sebzda, E., Bracke, M., Tugal, T., Hogg, N., and Cantrell, D. A. (2002). Rap1A positively regulates T cells via integrin activation rather than inhibiting lymphocyte signaling. Nat. Immunol. 3, 251–258. Semmrich, M., Smith, A., Feterowski, C., Beer, S., Engelhardt, B., Busch, D. H., Bartsch, B., Laschinger, M., Hogg, N., Pfeffer, K., and Holzmann, B. (2005). Importance of integrin LFA‐1 deactivation for the generation of immune responses. J. Exp. Med. 201, 1987–1998. Shamri, R., Grabovsky, V., Gauguet, J. M., Feigelson, S., Manevich, E., Kolanus, W., Robinson, M. K., Staunton, D. E., von Andrian, U. H., and Alon, R. (2005). Lymphocyte arrest requires instantaneous induction of an extended LFA‐1 conformation mediated by endothelium‐bound chemokines. Nat. Immunol. 6, 497–506. Shimaoka, M., Takagi, J., and Springer, T. A. (2002). Conformational regulation of integrin structure and function. Annu. Rev. Biophys. Biomol. Struct. 485, 485–516. Shimonaka, M., Katagiri, K., Nakayama, T., Fujita, N., Tsuruo, T., Yoshie, O., and Kinashi, T. (2003). Rap1 translates chemokine signals to integrin activation, cell polarization, and motility across vascular endothelium under flow. J. Cell Biol. 161, 417–427. Shimaoka, M., Salas, A., Yang, W., Weitz‐Schmidt, G., and Springer, T. A. (2003a). Small molecule integrin antagonists that bind to the b2 subunit I‐like domain and activate signals in one direction and block them in the other. Immunity 19, 391–402. Shimaoka, M., Xiao, T., Liu, J. H., Yang, Y., Dong, Y., Jun, C. D., McCormack, A., Zhang, R., Joachimiak, A., Takagi, J., Wang, J. H., and Springer, T. A. (2003b). Structures of the alpha L I domain and its complex with ICAM‐1 reveal a shape‐shifting pathway for integrin regulation. Cell 112, 99–111. Shimaoka, M., Kim, M., Cohen, E. H., Yang, W., Astrof, N., Peer, D., Salas, A., Ferrand, A., and Springer, T. A. (2006). AL‐57, a ligand‐mimetic antibody to integrin LFA‐1, reveals chemokine‐ induced affinity up‐regulation in lymphocytes. Proc. Natl. Acad. Sci. USA 103, 13991–13996.
I N T E G R I N R E G U L AT I O N O F LY M P H O C Y T E T R A F F I C K I N G
225
Shimizu, Y., and Mobley, J. L. (1993). Distinct divalent cation requirements for integrin‐mediated CD4þ T lymphocyte adhesion to ICAM‐1, fibronectin, VCAM‐1, and invasin. J. Immunol. 151, 4106–4115. Shimizu, Y., Mobley, J. L., Finkelstein, L. D., and Chan, A. S. (1995). A role for phosphatidylinositol 3‐kinase in the regulation of beta 1 integrin activity by the CD2 antigen. J. Cell Biol. 131, 1867–1880. Shinohara, M., Terada, Y., Iwamatsu, A., Shinohara, A., Mochizuki, N., Higuchi, M., Gotoh, Y., Ihara, S., Nagata, S., Itoh, H., Fukui, Y., and Jessberger, R. (2002). SWAP‐70 is a guanine‐ nucleotide‐exchange factor that mediates signalling of membrane ruffling. Nature 416, 759–763. Shulman, Z., Pasvolsky, R., Woolf, E., Grabovsky, V., Feigelson, S. W., Erez, N., Fukui, Y., and Alon, R. (2006). DOCK2 regulates chemokine‐triggered lateral lymphocyte motility but not transendothelial migration. Blood 108, 2150–2158. Sims, T. N., and Dustin, M. L. (2002). The immunological synapse: Integrins take the stage. Immunol. Rev. 186, 100–117. Smith, A., Bracke, M., Leitinger, B., Porter, J. C., and Hogg, N. (2003). LFA‐1‐induced T cell migration on ICAM‐1 involves regulation of MLCK‐mediated attachment and ROCK‐dependent detachment. J. Cell Sci. 116, 3123–3133. Smith, A., Carrasco, Y. R., Stanley, P., Kieffer, N., Batista, F. D., and Hogg, N. (2005). A talin‐ dependent LFA‐1 focal zone is formed by rapidly migrating T lymphocytes. J. Cell Biol. 170, 141–151. Springer, T. A. (1990). Adhesion receptors of the immune system. Nature 346, 425–434. Springer, T. A. (1995). Traffic signals on endothelium for lymphocyte recirculation and leukocyte emigration. Annu. Rev. Physiol. 57, 827–872. Staunton, D. E., Lupher, M. L., Liddington, R., and Gallatin, W. M. (2006). Targeting integrin structure and function in disease. Adv. Immunol. 91, 111–157. Stein, J. V., Rot, A., Luo, Y., Narasimhaswamy, M., Nakano, H., Gunn, M. D., Matsuzawa, A., Quackenbush, E. J., Dorf, M. E., and von Andrian, U. H. (2000). The CC chemokine thymus‐ derived chemotactic agent 4 (TCA‐4, secondary lymphoid tissue chemokine, 6Ckine, exodus‐2) triggers lymphocyte function‐associated antigen 1‐mediated arrest of rolling T lymphocytes in peripheral lymph node high endothelial venules. J. Exp. Med. 191, 61–76. Stewart, M. P., McDowall, A., and Hogg, N. (1998). LFA‐1‐mediated adhesion is regulated by cytoskeletal restraint and by a Ca2þ‐dependent protease, calpain. J. Cell Biol. 140, 699–707. Tadokoro, S., Shattil, S. J., Eto, K., Tai, V., Liddington, R. C., de Pereda, J. M., Ginsberg, M. H., and Calderwood, D. A. (2003). Talin binding to integrin beta tails: A final common step in integrin activation. Science 302, 103–106. Takagi, J., and Springer, T. A. (2002). Integrin activation and structural rearrangement. Immunol. Rev. 186, 141–163. Takagi, J., Petre, B. M., Walz, T., and Springer, T. A. (2002). Global conformational rearrangements in integrin extracellular domains in outside‐in and inside‐out signaling. Cell 110, 599–611. Takesono, A., Horai, R., Mandai, M., Dombroski, D., and Schwartzberg, P. L. (2004). Requirement for Tec kinases in chemokine‐induced migration and activation of Cdc42 and Rac. Curr. Biol. 14, 917–922. Tamada, M., Sheetz, M. P., and Sawada, Y. (2004). Activation of a signaling cascade by cytoskeleton stretch. Dev. Cell 7, 709–718. Tohyama, Y., Katagiri, K., Pardi, R., Lu, C., Springer, T. A., and Kinashi, T. (2003). The critical cytoplasmic regions of the aL/b2 integrin in Rap1‐induced adhesion and migration. Mol. Biol. Cell 14, 2570–2582.
226
TAT S U O K I N A S H I
Tommasi, S., Dammann, R., Jin, S. G., Zhang, X. F., Avruch, J., and Pfeifer, G. P. (2002). RASSF3 and NORE1: Identification and cloning of two human homologues of the putative tumor suppressor gene RASSF1. Oncogene 21, 2713–2720. Tybulewicz, V. L., Ardouin, L., Prisco, A., and Reynolds, L. F. (2003). Vav1: A key signal transducer downstream of the TCR. Immunol. Rev. 192, 42–52. van Kooyk, Y., and Figdor, C. G. (2000). Avidity regulation of integrins: The driving force in leukocyte adhesion. Curr. Opin. Cell Biol. 12, 542–547. Vicente‐Manzanares, M., Cruz‐Adalia, A., Martin‐Cofreces, N. B., Cabrero, J. R., Dosil, M., Alvarado‐Sanchez, B., Bustelo, X. R., and Sanchez‐Madrid, F. (2005). Control of lymphocyte shape and the chemotactic response by the GTP exchange factor Vav. Blood 105, 3026–3034. Vielkind, S., Gallagher‐Gambarelli, M., Gomez, M., Hinton, H. J., and Cantrell, D. A. (2005). Integrin regulation by RhoA in thymocytes. J. Immunol. 175, 350–357. Vogel, V., and Sheetz, M. (2006). Local force and geometry sensing regulate cell functions. Nat. Rev. Mol. Cell. Biol. 7, 265–275. Wang, H., Moon, E. Y., Azouz, A., Wu, X., Smith, A., Schneider, H., Hogg, N., and Rudd, C. E. (2003). SKAP‐55 regulates integrin adhesion and formation of T cell‐APC conjugates. Nat. Immunol. 4, 366–374. Wang, H., McCann, F. E., Gordan, J. D., Wu, X., Raab, M., Malik, T. H., Davis, D. M., and Rudd, C. E. (2004). ADAP‐SLP‐76 binding differentially regulates supramolecular activation cluster (SMAC) formation relative to T cell‐APC conjugation. J. Exp. Med. 200, 1063–1074. Ward, S. G. (2004). Do phosphoinositide 3‐kinases direct lymphocyte navigation? Trends Immunol. 25, 67–74. Warnock, R. A., Campbell, J. J., Dorf, M. E., Matsuzawa, A., McEvoy, L. M., and Butcher, E. C. (2000). The role of chemokines in the microenvironmental control of T versus B cell arrest in Peyer’s patch high endothelial venules. J. Exp. Med. 191, 77–88. Weber, K. S., Weber, C., Ostermann, G., Dierks, H., Nagel, W., and Kolanus, W. (2001). Cytohesin‐1 is a dynamic regulator of distinct LFA‐1 functions in leukocyte arrest and transmigration triggered by chemokines. Curr. Biol. 11, 1969–1974. Windh, R. T., Lee, M. J., Hla, T., An, S., Barr, A. J., and Manning, D. R. (1999). Differential coupling of the sphingosine 1‐phosphate receptors Edg‐1, Edg‐3, and H218/Edg‐5 to the G(i), G(q), and G(12) families of heterotrimeric G proteins. J. Biol. Chem. 274, 27351–27358. Woods, A. J., White, D. P., Caswell, P. T., and Norman, J. C. (2004). PKD1/PKCmu promotes avb3 integrin recycling and delivery to nascent focal adhesions. EMBO J. 23, 2531–2543. Woods, M. L., Kivens, W. J., Adelsman, M. A., Qiu, Y., August, A., and Shimizu, Y. (2001). A novel function for the Tec family tyrosine kinase Itk in activation of beta 1 integrins by the T‐cell receptor. EMBO J. 20, 1232–1244. Worthylake, R. A., Lemoine, S., Watson, J. M., and Burridge, K. (2001). RhoA is required for monocyte tail retraction during transendothelial migration. J. Cell Biol. 154, 147–160. Xie, C., Shimaoka, M., Xiao, T., Schwab, P., Klickstein, L. B., and Springer, T. A. (2004). The integrin a‐subunit leg extends at a Ca2þ‐dependent epitope in the thigh/genu interface upon activation. Proc. Natl. Acad. Sci. USA 101, 15422–15427. Xiong, J. P., Stehle, T., Diefenbach, B., Zhang, R., Dunker, R., Scott, D. L., Joachimiak, A., Goodman, S. L., and Arnaout, M. A. (2001). Crystal structure of the extracellular segment of integrin aVb3. Science 294, 339–345. Xiong, J. P., Stehle, T., Zhang, R., Joachimiak, A., Frech, M., Goodman, S. L., and Arnaout, M. A. (2002). Crystal structure of the extracellular segment of integrin alpha Vbeta3 in complex with an Arg‐Gly‐Asp ligand. Science 296, 151–155. Yan, B., Calderwood, D. A., Yaspan, B., and Ginsberg, M. H. (2001). Calpain cleavage promotes talin binding to the beta 3 integrin cytoplasmic domain. J. Biol. Chem. 276, 28164–28170.
I N T E G R I N R E G U L AT I O N O F LY M P H O C Y T E T R A F F I C K I N G
227
Yang, W., Shimaoka, M., Chen, J., and Springer, T. A. (2004a). Activation of integrin beta‐subunit I‐like domains by one‐turn C‐terminal alpha‐helix deletions. Proc. Natl. Acad. Sci. USA 101, 2333–2338. Yang, W., Shimaoka, M., Salas, A., Takagi, J., and Springer, T. A. (2004b). Intersubunit signal transmission in integrins by a receptor‐like interaction with a pull spring. Proc. Natl. Acad. Sci. USA 101, 2906–2911. Zell, T., Hunt, S. W. R., Mobley, J. L., Finkelstein, L. D., and Shimizu, Y. (1996). CD28‐mediated up‐regulation of beta 1‐integrin adhesion involves phosphatidylinositol 3‐kinase. J. Immunol. 156, 883–886. Zhang, W., Shao, Y., Fang, D., Huang, J., Jeon, M. S., and Liu, Y. C. (2003). Negative regulation of T cell antigen receptor‐mediated Crk‐L‐C3G signaling and cell adhesion by Cbl‐b. J. Biol. Chem. 278, 23978–23983.
Regulation of Immune Responses and Hematopoiesis by the Rap1 Signal Nagahiro Minato, Kohei Kometani, and Masakazu Hattori Department of Immunology and Cell Biology, Graduate School of Biostudies, Kyoto University, Kyoto, Japan
1. 2. 3. 4. 5. 6.
Abstract............................................................................................................. Introduction ....................................................................................................... General Biology of the Rap1 Signal ........................................................................ Rap1 Signal in Lymphocyte Development and Immune Responses............................... Rap1 Signal in Hematopoiesis and Leukemia............................................................ Rap1 Signal in Malignancy: New Aspects in Cancer................................................... Conclusions and Perspectives ................................................................................ References .........................................................................................................
229 229 230 237 248 253 255 256
Abstract Rap1 (Ras‐proximity 1), a member of the Ras family of small guanine triphosphatases (GTPases), is activated by diverse extracellular stimuli. While Rap1 has been discovered originally as a potential Ras antagonist, accumulating evidence indicates that Rap1 per se mediates unique signals and exerts biological functions distinctly different from Ras. Rap1 plays a dominant role in the control of cell–cell and cell–matrix interactions by regulating the function of integrins and other adhesion molecules in various cell types. Rap1 also regulates MAP kinase (MAPK) activity in a manner highly dependent on the context of cell types. Recent studies (including gene‐targeting analysis) have uncovered that the Rap1 signal is integrated crucially and unpredictably in the diverse aspects of comprehensive biological systems. This review summarizes the role of the Rap1 signal in developments and functions of the immune and hematopoietic systems as well as in malignancy. Importantly, Rap1 activation is tightly regulated in tissue cells, and dysregulations of the Rap1 signal in specific tissues result in certain disorders, including myeloproliferative disorders and leukemia, platelet dysfunction with defective hemostasis, leukocyte adhesion‐deficiency syndrome, lupus‐like systemic autoimmune disease, and T cell anergy. Many of these disorders resemble human diseases, and the Rap1 signal with its regulators may provide rational molecular targets for controlling certain human diseases including malignancy. 1. Introduction Rap1 (Ras‐proximity 1), a member of the Ras family of small guanine triphosphatases (GTPases), displays high overall homology (50%) to the classical K‐, H‐, and N‐Ras with an identical effector domain (Pizon et al., 1988). Rap1
229 advances in immunology, vol. 93 # 2007 Elsevier Inc. All rights reserved.
0065-2776/07 $35.00 DOI: 10.1016/S0065-2776(06)93006-5
230
N A G A H I R O M I N AT O E T A L .
is conserved in eukaryocytes from yeasts through mammals. In budding yeasts, Rap1 (Rsr1) is essential for the proper determination of budding sites for mating (Bender and Pringle, 1989). Rap1 in Drosophila melanogaster (DRap1) is also an essential gene that plays crucial roles in various aspects of morphogenesis (Asha et al., 1999). The prototype, or the so‐called ‘‘roughened eyes,’’ is caused by a gain‐of‐function mutation of the Rap1 gene (Hariharan et al., 1991). In mammals, there are two Rap1 isoforms coded by distinct genes (Rap1A and Rap1B) with limited differences in constitutional amino acids and redundant activities (Bos et al., 2001). It was first reported that overexpression of Rap1 (originally called K‐rev) could revert the characteristic ‘‘malignant’’ contours of the fibroblasts transformed by oncogenic K‐Ras to a flat shape similar to normal fibroblasts (Kitayama et al., 1989). This raised the initial idea that Rap1 might act as a functional antagonist of oncogenic Ras. The exact roles of Rap1 in mammalian cells, however, have remained rather enigmatic for nearly a decade. In the late 1990s, two distinct biological activities mediated by the Rap1 signal (independent of Ras) emerged, viz., the activation of MAP kinases (MAPKs) and control of cell adhesion via integrins. Since then, numerous findings on the roles of Rap1 in many cell types of various tissues have accumulated, and it has become evident that the Rap1 signal mediates highly diverse cellular activities depending on the cellular contexts. In the present chapter, we first summarize recent advances on the general biology of Rap1, including regulation and function of the Rap1 signal, before proceeding to discuss how a ubiquitous molecular switch (Rap1) is integrated into the signaling pathways to control highly sophisticated and specified cellular functions, with particular emphasis on the immune/hematopoietic systems and malignancy. 2. General Biology of the Rap1 Signal One of the most intriguing features of Rap1 is that it is activated by an extensive variety of external stimuli delivered to the cell, including numerous growth factors, peptide hormones, neurotransmitters, cytokines, chemokines, antigens, cell‐adhesion molecules, and physical stimuli such as cell stretch/ contraction. 2.1. Regulation of Rap1 Activation Similar to many other small G‐proteins, Rap1 binds with guanine nucleotides to form Rap1GTP (an active form) or Rap1GDP (an inactive form) that interacts or dissociates with a number of downstream effector molecules, respectively. Due to its intrinsic GTPase activity, GTP bound to Rap1 is autonomously hydrolyzed to GDP. Therefore, activation of Rap1 requires specific enzymes
R A P 1 I N I M M U N E R E S P O N S E A N D H E M AT O P O I E S I S
231
that dissociate GDP from Rap1 to facilitate repetitive GTP loading, that is, the guanine nucleotide exchange factors (GEFs). A number of distinct Rap1 GEFs sharing a catalytic GEF domain have been identified, and they are coupled with various receptors or intracellular second messengers (Fig. 1; Bos et al., 2001; Hattori and Minato, 2003). C3G, which is a Rap1GEF ubiquitously expressed in most cell types, binds to the SH3 domain of Crk adaptor proteins, and is recruited to the plasma membrane and phosphorylated on activation of receptor‐ associated protein tyrosine kinases (PTKs; Gotoh et al., 1995; Ichiba et al., 1999). Phosphorylated C3G is a major Rap1 activator in the plasma membrane. CalDAG‐GEF harbor the Ca2þ ion‐ and diasylglycerol (DAG)‐binding sites. Activation of CalDAG‐GEF I is regulated by the Ca2þ ion, while CalDAG‐ GEF III is translocated to the membrane by binding DAG, and thus these GEFs may mediate Rap1 activation downstream of PLC activation (Kawasaki et al., 1998). On the other hand, the Epac family of Rap1GEFs has specific cyclic AMP (cAMP)‐binding domains at the N‐terminal region. Binding cAMP induces conformational changes in Epacs to release the inhibitory constraint covering the catalytic GEF domain, thus allowing interaction with the substrate
Extracellular stimuli GEFs GAPs
PTK
Crk (L)
C3G
A-cyclase
cAMP
Epac (1,2)
PLC
Ca2+ DAG
GTP
Rap1-GDP
GDP
Rap1-GTP
Pi
CD-GEF (I,III) PDZ-GEF
SPA-1 family (SPA-1, E6TP1, SPA-L2,3) RapGAs (1,2)
DOCK-4 Ras-GTP c-Raf-1
RapL
B-Raf
MEK1,2
AF-6
MEK3,6 Integrins Cadherins
ERK
p38MAPK
Proliferation, survival gene activation
RIAM Profillin Ena/VASP
RalGDS
Ral, Rac
F-actin Cell adhesion, migration polarity
Smg cross-talk
Figure 1 Regulation and functions of the Rap1 signal. Refer to the text for the details.
232
N A G A H I R O M I N AT O E T A L .
Rap1 (Bos, 2003; de Rooij et al., 1998). It has been demonstrated that certain cAMP‐induced biological activities, such as cell adhesion and insulin secretion, are mediated by the Epac/Rap1 rather than by cAMP‐dependent protein kinase pathway (Bos, 2003). Epacs may play a major role in the cytosolic Rap1 activation downstream of trimeric G‐protein–coupled receptors (GPCRs). Thus, distinct types of Rap1 GEFs are tightly coupled with the major signaling pathways to induce Rap1 activation at the different intracellular compartments via diverse extracellular stimuli (Fig. 1). Rap1 does not share a conserved catalytic residue with other small G‐proteins, such as Ras, Rho, or Cdc42, and displays much lower intrinsic GTPase activity. The swift inactivation of Rap1GTP to terminate the signal, therefore, is crucially dependent on Rap1 GTPase‐activating proteins (GAPs). Rap1GAPs specifically bind to GTP‐bound Rap1 to provide a catalytic residue (asparagine) for Rap1 thereby enhancing the GTPase activity by multiple orders (Daumke et al., 2004). In contrast to the diverse types of Rap1GEFs, there are only two groups of Rap1GAPs (i.e., RapGAs and SPA‐1 family) that share a catalytic domain called the GAP‐related domain (GRD). While RapGA1 is expressed rather ubiquitously (most prominently expressed in the brain), RapGA2 is distributed exclusively in platelets (Kurachi et al., 1997; Schultess et al., 2005). An isoform of RapGA1 binds to Ga via the N‐terminal region and may be translocated to the plasma membrane following the activation of GPCRs, thus attenuating Rap1 activation at the membrane (Mochizuki et al., 1999). The SPA‐1 family of Rap1GAPs consists of SPA‐1, SPA‐1‐like (SPA‐L) 1 (also called E6TP1 or SPAR), SPA‐L 2, and SPA‐L 3, all of which share a PDZ domain in addition to a GRD. SPA‐1 is most abundantly expressed in lymphohematopoietic tissues and certain cancer cells, while SPAR is distributed in epithelial tissues and the brain (Gao et al., 1999; Hattori et al., 1995; Pak et al., 2001). They are located in various intracellular compartments, such as the synaptic vesicles, actin cytoskeleton, plasma membranes, and possibly nuclei, depending on the cell type and specific protein interaction via the PDZ domain (Farina et al., 2004; Roy et al., 2002; Tsukamoto et al., 1999). All the Rap1GAPs are constitutively active without any protein modification. As such, the expression levels of Rap1GAPs per se may determine the threshold and degree of Rap1 activation at any given compartment (see below). Notably, E6TP1 is specifically degraded by human papillomavirus E6 oncoprotein via E6AP ubiquitin ligase similarly to p53 in a fashion closely correlated with E6‐mediated epithelial cell transformation (Gao et al., 2001, 2002). Rap1GAPs have no structural similarities to GAPs for other small G‐proteins, such as Ras, Rho, Arf, or Rab, and a study has indicated that the mode of GAP activity for Rap1 is also different from that of GAPs for other G‐proteins (Daumke et al., 2004).
R A P 1 I N I M M U N E R E S P O N S E A N D H E M AT O P O I E S I S
233
2.2. Biological Function of Rap1 2.2.1. Regulation of MAPK Activation Although it has been a matter of argument for almost a decade whether the Rap1 signal activates extracellular signal‐regulated protien kinase (ERK), accumulating evidence has indicated that the Rap1 signal does activate the MAPK kinase‐1 (MEK‐1), 2–ERK pathway selectively via B‐Raf (Vossler et al., 1997), which is expressed in only selected tissue cells (Barnier et al., 1995). This finding probably explains why Rap1‐mediated ERK activation has been observed only in certain selected cell types. While ubiquitous c‐Raf‐1 needs to be phosphorylated to activate MEK‐1, 2, B‐Raf is constitutively phosphorylated at the corresponding sites (Mason et al., 1999) and activates MEK‐1, 2 by being recruited to the plasma membrane by Rap1GTP. This was confirmed genetically in Drosophila melanogaster, which has only one Raf isoform (DRaf) corresponding to the mammalian B‐Raf. Thus, DRap1 that has been activated downstream of torso receptor tyrosine kinase binds to DRaf and induces ERK activation, which in turn incites activation of tailless and huckebein genes controlling the terminal structures in embryos (Mishra et al., 2005). Although Rap1GTP binds to c‐Raf‐1 with an affinity even higher than RasGTP in mammalian cells, it may not lead to the activation of MEK‐1, 2–ERK pathway, partly because Rap1GTP is incapable of inducing c‐Raf‐1 phosphorylation required for the activation of the kinase activity (Mishra et al., 2005). ERK activation by Rap1, however, shows a unique feature distinctly different from Ras‐mediated ERK activation. In PC12 neuronal cell line that strongly expresses B‐Raf, the epithelial growth factor (EGF) and nerve growth factor (NGF) specifically induce the proliferation and differentiation, respectively (Marshall, 1995; Qui and Green, 1992; Traverse et al., 1992). NGF rapidly elicits peak followed by sustained activation of ERK, while EGF induces only a transient ERK activation, suggesting that a persistent ERK activation is required for PC12 cell differentiations. Although Ras mediates the rapid and transient ERK activation elicited by both factors, Rap1 is responsible for the NGF‐induced sustained activation of ERK (Kao et al., 2001; York et al., 1998). Sophisticated analyses have suggested that different ERK activation kinetics might reflect the different regulatory mechanisms of Ras and Rap1 activations (Sasagawa et al., 2005). While Ras is activated rapidly by SOS recruited to the plasma membrane via Grb2 following stimulation before recruitment of phosphorylated RasGAP, activated ERK induces phosphorylation of SOS and the dissociation from Grb2. Because of the recruitment of RasGAP and the tight negative feedback by ERK, the activation dynamics of Ras may primarily depend on the temporal rate, rather than the magnitude, of stimuli. On the other hand, a negative feedback mechanism for Rap1 activation has not been
234
N A G A H I R O M I N AT O E T A L .
defined to date, and there is little evidence advocating that Rap1GAPs are specifically recruited following stimulation. Thus, Rap1 activation may continue as long as the stimuli persist potently enough to overcome the basal Rap1GAP activity, and the activation dynamics of Rap1 may directly reflect the duration and degree of stimuli. Ligand‐occupied EGF receptors (EGFRs) are internalized and rapidly degraded thereafter to likely induce only transient Ras activation with limited Rap1 activation, that is, the transient ERK activation. In contrast, NGF receptors (TrkAs) occupied with ligands are trapped and prevail in the endosomal membrane to induce sustained ERK activation via Rap1 activation. Thus, Rap1 and Ras may mediate and yield different biological effects due to their distinctly different kinetics in ERK activation. Another aspect of the Rap1 signal in ERK activation is its possible effect on Ras‐mediated ERK activation. As mentioned earlier, Rap1GTP may not contribute to ERK activation via ubiquitous c‐Raf‐1 but may rather competitively interfere with Ras‐mediated ERK activation at the level of c‐Raf‐1 when overexpressed (Boussiotis et al., 1997). While ambiguity of such an effect occurring under normal physiological conditions remains unresolved, recent reports have indicated its involvement under certain in vivo conditions (see below). In short, the Rap1 signal, depending on the cell contexts, may regulate ERK activation in different ways. Recent evidence has demonstrated that the Rap1 signal also activates the MEK‐3, 6–p38MAPK pathway. Rap1 is reportedly activated by cell‐stretch force to induce MEK‐3, 6‐mediated p38MAPK activation, while Ras‐signaling is inactivated (Sawada et al., 2001; Tamada et al., 2004). On the contrary, cell contraction force activates the Ras‐mediated MEK‐1, 2–ERK pathways with little Rap1 activation (Sawada et al., 2001). Similar complementary activations of Rap1‐ p38MAPK and Ras–ERK pathways have also been reported in other systems. In hippocampal neurons, for instance, Rap‐1‐mediated p38MAPK activation induces nonmetabolic glutamate receptor‐mediated removal of synaptic AMPA (alpha‐amino‐3‐hydroxy‐5‐methyl‐4‐isoxazolepropionic acid) receptors during long‐term depression (Zhu et al., 2002). On the other hand, delivery of AMPA receptors to the synaptic sites during long‐term potentiation is dependent on the Ras‐mediated ERK activation. Under such circumstances, it appears that the Rap1–MKK3, 6–p38MAPK and Ras–MKK1, 2–ERK pathways form parallel but opposing signaling modules. Since Rap1 shares the effector domain with Ras, Rap1GTP is expected to bind other Ras effectors such as RalGDS and PI3Kp110 subunit (Bos et al., 2001). The PI3K–AKT pathway is activated by receptor PTKs in a Ras‐dependent or Ras‐independent manner (Shaw and Cantley, 2006). For instance, the regulatory effect of cAMP on cell proliferation is in part mediated by the control of Rap1‐mediated activation of the PI3K–AKT pathway
R A P 1 I N I M M U N E R E S P O N S E A N D H E M AT O P O I E S I S
235
(Tsygankova et al., 2001; Wang et al., 2001). It has been shown that the proliferation and survival of hematopoietic cells induced by IL‐3 or B‐cell receptors (BCR)‐ABL oncoprotein are influenced by Rap1‐mediated activation of the PI3K–AKT pathway (Jin et al., 2006). 2.2.2. Control of Cell Adhesion SPA‐1 overexpression (abrogating the endogenous Rap1 activation) induced rounding and eventual detachment of inherently adherent cells from extracellular matrix, while overexpression of membrane‐targeted C3G (C3G‐F) enhanced cell‐spreading on extracellular matrix (Tsukamoto et al., 1999). This was one of the first indications to show involvement of the Rap1 signal in regulating cell adhesion. Since then, many reports have confirmed that the Rap1 signal regulates the integrin‐mediated cell adhesion induced by various stimuli in many cell types; viz., b1 (VLA‐4) and b2 (LFA‐1) integrin activations of lymphocytes by CD31 (Reedquist et al., 2000) and CD98 (Suga et al., 2001) stimulation; b2 (Mac‐1) integrin activation of macrophage for phagocytosis by LPS (Schmidt et al., 2001); LFA‐1 activation of lymphocytes by chemokine stimulation (Shimonaka et al., 2003); and aIIb b3 integrin activation of platelets by thrombin or ADP (Crittenden et al., 2004). Normal resting T cells initially express a low affinity or an ‘‘inactive’’ form of LFA‐1 before conversion to the high affinity or ‘‘active’’ form by stimulation with antigens via a process called ‘‘inside‐ out’’ activation (Carman and Springer, 2003). Expressing an active form of Rap1 in T cells rapidly increases the affinity of LFA‐1, while overexpression of SPA‐1 or a dominant‐negative Rap1 mutant completely inhibits LFA‐1 activation by antigen‐receptor stimulation (Katagiri et al., 2000). These findings clearly indicate that Rap1 is a major mediator of ‘‘inside‐out’’ activation of integrins in T cells (see below). These results have clarified that Rap1 serves as a major integrin‐activating signal, unveiling a novel and important functional aspect of Rap1. The overall cell adhesiveness induced by integrins is controlled by distinct elements such as the ‘‘affinity’’ of each monomeric integrin molecule, ‘‘valency’’ defined by the diffusivity or local density of integrins and ligands, and ‘‘adhesion strengthening’’ induced following integrin interaction with ligands (Carman and Springer, 2003). Crystal structure analyses have revealed that affinity regulation of integrins is based on their conformational changes (Xiong et al., 2001). Thus, the extracellular stork of a and b chains in a low‐affinity state is sharply bent so that the ligand‐binding head is juxtaposed to the membrane portion of the stork (closed posture), while the binding site is free from constraints and unfurls openly (open posture) in a high‐affinity state. The conformational change is regulated by proteins (such as talin), which bind to the cytoplasmic domain of integrins (Carman and Springer, 2003). In lymphoid cells, RapL (a specific effector of Rap1) associates directly with the cytoplasmic tail of LFA‐1
236
N A G A H I R O M I N AT O E T A L .
a‐chain on binding to Rap1GTP to likely induce an open posture of LFA‐1 (Katagiri et al., 2003). In addition, a study has indicated that activation of integrins by the Rap1 signal also induces redistribution and polarity of integrin expression (Shimonaka et al., 2003). Thus, the Rap1 signal may affect the overall integrin‐mediated cell adhesion through multiple mechanisms. In this aspect, Rap1GTP has been found to bind also with a new adaptor called the Rap1‐interacting adaptor molecule (RIAM), which displays high homology to lamellipodin (Lpd; Lafuente et al., 2004). Knockdown of RIAM displaces Rap1GTP from the plasma membrane and reverts integrin‐mediated cell adhesion induced by Rap1, while RIAM overexpression enhances integrin‐dependent cell adhesion and facilitates cell spreading. Interestingly, RIAM interacts directly with profillin and Ena/VASP family proteins to maintain the cellular content of F‐actin (Lafuente et al., 2004). Profillin and Ena/VASP are important regulators of the actin cytoskeleton, and thus Rap1 not only induces integrin activation but also may directly regulate actin dynamics required for cell spreading and migration, viz., lamellipodia formation (Bailly, 2004). These results may place Rap1 in a crucial position linking cell‐signaling and actin‐cytoskeleton changes. Cumulative evidence has further advocated that Rap1 plays an important role in the maintenance of integrity of intercellular adhesion in epithelial and endothelial cells. Convincing data on the role of the Rap1 signal in controlling adherence junctions have been derived again from a genetic study of Drosophila (Knox and Brown, 2002). During development of the wing, where mediation by even cell adhesion among adjacent cells via the circumferentially distributed DE‐ cadherin is involved, expanding epithelial cells of the related lineages normally stay in a coherent group. The epithelial cells with mutant Rap1, however, lose the circumferential expression of DE‐cadherin and selectively form an adherence junction to the adjacent cells ipsilaterally, resulting in disrupted epithelial cell behavior (Knox and Brown, 2002). This may, in part, explain the abnormal morphogenesis in Rap1‐mutant Drosophila (Hariharan et al., 1991). The roles of Rap1 in the formation and maintenance of E‐cadherin‐mediated adherence junctions in epithelial cells and VE‐cadherin‐mediated endothelial barrier function have been reported also in mammalian cells. For instance, the Rap1 signal plays an important role in protecting the endothelial cell barrier function against factors (e.g., thrombin and so on) that cause barrier dysfunctions (Cullere et al., 2005; Fukuhara et al., 2005). In epithelial cells, Rap1 regulates the endocytosis of E‐cadherin and controls the accumulation and distribution of E‐cadherin on cell surfaces by specific binding to a scaffold protein afadin (or AF‐6) (Hoshino et al., 2005). Interestingly, AF‐6 also binds SPA‐1 and regulates Rap1‐GAP activity at the adherence junction (Su et al., 2003). A component of tight junction (TJ), JAM1, has been found to constitutively deliver the Rap1 signal on intercellular epithelial cell adhesion, and disruption of the Rap1 signaling results in marked
R A P 1 I N I M M U N E R E S P O N S E A N D H E M AT O P O I E S I S
237
changes in epithelial cell morphology and impairment of b1‐integrin‐mediated adhesion to extracellular matrix (Mandell et al., 2005). These results imply that the Rap1 signal plays an important role in the functional cross talk between intercellular adhesion (adherence junction) and the adhesion to extracellular matrix in epithelial cells. 3. Rap1 Signal in Lymphocyte Development and Immune Responses Small G‐proteins of the Ras, Rho, and Rac families play crucial roles in various aspects of lymphocyte development and function (Cantrell, 2003). Recent studies, including those using gene‐engineered mice, have begun to unveil unique roles of the Rap1 signal in lymphocyte development and immune responses (Table 1). 3.1. Thymic T Cell Development: Distinct Roles of Rap1 and Ras Using transgenic mice expressing the RapV12 mutant gene under a human CD2 promoter, it was shown that excessive Rap1 signals barely affected overall thymic T cell development (Sebzda et al., 2002). However, we have recently found that mice conditionally expressing the RapE63 (another dominant active mutant of Rap1) transgene, driven by a more potent CAG promoter, exhibit significant decreases in double‐positive (DP) thymocytes (Kometani et al., manuscript in preparation). The discrepancy may reflect the fact that V12 mutation of Rap1 may not be an ideal dominant active form unlike in other small G‐proteins such as Ras, Rho, and Rac (Daumke et al., 2004). The expansion and subsequent positive selection of DP thymocytes is reportedly dependent on the Ras signal (Swan et al., 1995). Thus, it appears that Rap1 activation surpassing a certain level interferes with Ras‐dependent expansion or positive selection of DP thymocytes, although the physiological significance remains to be verified. A more important question of whether the endogenous Rap1 signal is required for the normal thymic T cell development warrants attention. To shed light on this ambiguity, we innovated an experimental model—the SPA‐1 transgenic mice— for further investigation. Since the mice expressing SPA‐1 transgene driven by a ubiquitous CAG promoter were embryonically lethal, we generated LoxP‐ franked SPA‐1 transgenic mice and then crossed them with lck‐Cre transgenic mice. The conditional transgenic mice revealed severe thymic hypoplasia in which thymic T cell development was arrested at the late double‐negative (DN) stage (Kometani et al., manuscript in preparation). Consistently, in fetal thymic organ cultures (FTOC), generation of DP thymocytes from the pro‐T cells of Rag2/ mice in the presence of anti‐CD3 antibody was suppressed by the
238
N A G A H I R O M I N AT O E T A L .
Table 1 Phenotypes of Gene‐Engineered Mice Related to the Rap1 Signal Mice C3G KO C3Ggt/gt mutanta
SPA‐1 KO
CalDAG‐GEF1 KO
Rap1A KO
RapV12 Tg (hCD2) RapE63 Tg (hCD2) RapGA1 Tg (hCD2) SPA‐1 Tg (CAG) SPA‐1 Tg (LoxP/lck‐Cre)b
Phenotypes Embryonic lethal (at E5) Embryonic lethal (at E15) Vascular defect Increased cerebral neural cells Myeloproliferative disorders of late onset Memory T cell anergy Lupus‐like autoimmune disease and B1 cell leukemia Diabetes insipidus Impaired platelet aggregation and adhesion Bleeding diathesis Reduced adhesiveness of T and B cells (probably redundant due to intact Rap1b) Enhanced T cell adhesion Reduced antibody response to TD‐antigens Compromised CTLA‐4‐mediated suppression of T cell activation Embryonic lethal Severe thymic hypoplasia (impaired b‐selection)
References Ohba et al., 2001 Voss et al., 2003 Voss et al., 2006 Ishida et al., 2003a Ishida et al., 2003b Ishida et al., 2006 Noda et al., 2004 Crittenden et al., 2004
Duchniewicz et al., 2006
Sebzda et al., 2002 Li et al., 2005b Dillon et al., 2005 Unpublished Unpublished
a Mice with mutant C3Ggt allele in which pGT1.8geo has been integrated in the first intron of C3G gene, producing less than 5% normal C3G protein. b Transgenic mice of SPA‐1 gene franked by LoxP under a CAG promoter were crossed with lck‐Cre transgenic mice. KO, knockout; Tg, transgenic; hCD2, human CD2 promoter; CAG, CMV early enhancer‐chicken b‐actin hybrid promoter.
retroviral transduction with SPA‐1 or RapA17 (a potent dominant‐negative mutant of Rap1; Dupuy et al., 2005). These results strongly suggested that the Rap1 signal was essential for transition from pre‐T cells to abTCR‐expressing DP‐T cells, that is, the b‐selection. While the Ras signal does not reportedly play a major role in b‐selection (Swan et al., 1995), a report has indicated that ERK activation is crucially involved in the process (Crompton et al., 1996; Fischer et al., 2005). Therefore, Rap1 may serve as a major signal that mediates ERK activation required for the thymic pre‐T cell proliferation and differentiation (Fig. 2).
R A P 1 I N I M M U N E R E S P O N S E A N D H E M AT O P O I E S I S
SPA-1 Tg
Thymus
239
RapE63 Tg Negative selection
MHC:peptides a b TCR Ras
Pre-TCR Rap1
b -Selection Rap1
ERK
pro-T
Positive selection
ERK
pre-T
SP
DP
Naive CD4 T
Memory (CD44high) ERK
LFA-1
Rap1
Rap1
Ras TCR
TCR/CD28
Anergy
APC SPA-1 KO Immunological synapse
Rap1 Ras
ERK
Figure 2 Involvement of the Rap1 signal in development and activation of T cells. The Rap1 signal is crucial for pre‐TCR‐mediated b‐selection, and conditional expression of SPA‐1 transgene in T cell lineage results in the arrest of thymic T cell development at the DN3 stage. On the contrary, excess Rap1 activation in RapE63 transgenic (Tg) mice results in compromised expansion of double‐positive (DP) thymocytes and this is most likely due to interference with Ras signaling, which is essential for proliferation and positive selection of DP thymocytes via abTCR. In peripheral T cells, Rap1 plays an important role in the initiation of immunological synapse formation with antigen‐loaded antigen‐presenting cells (APC) via TCR‐mediated inside‐out activation of LFA‐1. Such activated Rap1, however, has to be downregulated because persistent Rap1 activation may cause T cell anergy. In SPA‐1 knockout (KO) mice, a proportion of CD44high CD4þ memory T cells becomes progressively nonresponsive or anergic to TCR‐stimulation.
Pre‐T‐cell receptors (TCR)‐mediated b‐selection is distinctly different from abTCR‐mediated positive selection in a few aspects: (1) the pre‐TCR‐mediated signal is triggered by self‐polymerization of receptors without specific ligands (Irving et al., 1998; Yamasaki et al., 2006) and (2) the signal threshold in b‐selection is extremely low as compared with positive selection. The ‘‘hyperexcitability’’ is ascribed to the intrinsic feature of thymocytes at the DN stage rather than to
240
N A G A H I R O M I N AT O E T A L .
that of the pre‐TCR (Erman et al., 2004; Haks et al., 2003). It may be possible that the higher excitability of pre‐T cells than DP‐T cells partly reflects the feature of Rap1‐mediated (as opposed to Ras‐mediated) ERK activation in the former (Section 1.2.1). Expression profiles of c‐Raf‐1 and B‐Raf at different developmental stages may warrant further investigation. All in all, Rap1 plays significant roles in the thymic abTcell development. In contrast, development of gdT‐lineage cells was completely normal in the SPA‐1/lck‐Cre transgenic mice, suggesting that the Rap1 signal displays a nonessential role in thymic gdT cell development if any. 3.2. Immunological Synapse and T Cell Activation Interaction of T cells with antigen‐presenting cells (APCs) loaded by specific antigens results in the formation of three‐dimensional molecular clusters at the contact site, that is, supramolecular activation clusters (SMAC). In SMAC, while TCR and costimulatory molecules are clustered in the central region (cSMAC), LFA‐1 is located at the periphery (pSAMC), and CD45 is excluded from the clusters (dSMAC; Huppa and Davis, 2003). Being maintained by continuous TCR signaling, this synaptic structure is quite stable and may last more than 10 h (Huppa and Davis, 2003). Although the exact function of such a stable synaptic structure remains controversial, it may serve as a platform for molding architectural complexities to: (1) attain the cumulative TCR‐signaling effect for full development of the T cell effector function and (2) accommodate regulatory mechanisms for guiding T cell activities. A hallmark of synapse formation is the ring‐cluster formation of LFA‐1 with ICAM‐1 on the APC around TCR clusters, a process initiated by the initial contact of TCR with the specific peptide‐loaded MHC (Huppa and Davis, 2003). It has been indicated that the Rap1 signal delivered by TCR ligation plays a crucial role in clustering, reorganization, and activation of LFA‐1 for synapse formation. Thus, overexpression of SPA‐1 or RapN17 (another dominant‐ negative mutant of Rap1) in a T cell clone strongly suppresses TCR‐mediated LFA‐1 activation and synaptic conjugation with specific antigen‐loaded APCs, whereas that of Rap1 enhances the conjugate formation (Katagiri et al., 2002). These effects were not observed in the absence of relevant antigens, indicating that TCR‐mediated activation of endogenous Rap1 was crucial for clustering and activation of LFA‐1 at the contact sites (Dustin et al., 2004; Fig. 2). A report has demonstrated that Rap1GTP is almost exclusively detected at the plasma membrane of T cells in a manner dependent on endosomal recycling, while Rap1GDP is mostly associated with the cytoplasmic vesicular membrane (Bivona et al., 2004). Interestingly, in contrast to most of the TCR‐proximal signaling molecules, SLP‐76 rapidly dissociates from the TCR‐complex and moves to the cytoplasm on APC interaction (Dustin et al., 2004). Thus, an
R A P 1 I N I M M U N E R E S P O N S E A N D H E M AT O P O I E S I S
241
intriguing model may be proposed such that SLP‐76 associates with recycling endosomes containing Rap1GDP, LFA‐1, and RapL to subsequently expose them to the plasma membrane, where Rap1 is rapidly activated to Rap1GTP by membrane‐recruited GEFs (e.g., C3G, CalDAG‐GEF I, and so on). Rap1GTP then causes conformational activation of LFA‐1 by inducing RapL binding to the cytoplasmic portion of a chain of LFA‐1 (Section 1.1), thus leading to tight interaction with APCs via ICAM‐1 binding. 3.3. T Cell Nonresponsiveness and Anergy Full activation of T cells requires additional engagement of costimulatory receptors such as CD28 with CD80/CD86 ligands on the professional APC (Sharpe and Freeman, 2002). Although Ras is strongly activated by the concomitant stimulation of TCR/CD3 and CD28 receptors to induce ERK activation, it is poorly activated by TCR/CD3‐stimulation alone (Carey et al., 2000). In contrast to Ras, Rap1 is potently activated by TCR/CD3‐stimulation alone, while concomitant costimulation with anti‐CD28 markedly reduces Rap1 activation (Carey et al., 2000; Reedquist and Bos, 1998). The results imply that Rap1 activation may have to be downregulated after the initiation of synapse formation for optimal T cell activation. In fact, persistent activation of Rap1 in T cells results in marked decreases of IL‐2 production on interaction with antigen‐loaded APCs, albeit enhanced conjugate formation may occur (Katagiri et al., 2002). The reduced IL‐2 response is associated with compromised ERK activation, and this is consistent with the concept that persistent Rap1 activation interferes with Ras‐mediated ERK activation downstream of TCR (Boussiotis et al., 1997; Ishida et al., 2003b). It has further been confirmed that T cells harboring RapE63 transgene show significantly reduced cell proliferation and IL‐2 production via TCR‐stimulation in vitro, and the transgenic mice exhibit compromised antibody responses to TD antigens, but not to TI antigens, in vivo (Li et al., 2005b). We have observed that SPA‐1 in T cells is specifically recruited to synaptic sites with antigen‐loaded APCs (Harazaki et al., 2004), and thus SPA‐1 most likely plays a role in restraining Rap1 activation after establishing efficient conjugations with APCs to yield optimal T cell activation. CTLA‐4 has a higher affinity for CD80/86 than CD28 and exerts a negative signal for T cell activation, hence playing an important role in terminating T cell responses (Greenwald et al., 2005). Although CTLA‐4 expression is enhanced at the late stages following T cell activation, significant CTLA‐4 expression is observed in naive T cells (Schneider et al., 2005). A study has reported that CTLA‐4 stimulation on naive T cells results in strong Rap1 activation to induce potent activation of LFA‐1‐mediated cell adhesion (Schneider et al., 2005). Thus, CTLA‐4 may also contribute to synapse formation of T cells with APCs.
242
N A G A H I R O M I N AT O E T A L .
In contrast to CD28, however, concomitant stimulations of T cells with anti‐ CD3 and anti‐CTLA‐4 antibodies potently inhibit T cell activation by recruiting protein tyrosine phosphatases via ITIM motif in the cytoplasmic domain (Greenwald et al., 2001). A study has demonstrated that the T cells from RapGAP transgenic mice, which show compromised Rap1 activation, display significant ERK activation by CD3/CD28/CTLA‐4 coligation, while ERK activation is strongly suppressed in control T cells by the same stimuli (Dillon et al., 2005). Accordingly, T cells from the transgenic mice showed significantly lower inhibition of IL‐2 production than control T cells by CTLA‐4 coligation, although both exhibited comparable inhibition of PLC‐g1 phosphorylation (Dillon et al., 2005). The results clearly suggest that part of the negative effects on T cell activation by CTLA‐4 ligation, especially on ERK activation and IL‐2 production, is mediated by Rap1 activation. T cell anergy is a unique state, where T cells are incapable of producing IL‐2 and expanding clonally in response to antigens and is thus considered to play a role in peripheral T cell tolerance to self‐antigens (Schwartz, 1997). T cell anergy has originally been described as an in vitro phenomenon, where TCR occupancy in the absence of costimulatory signals renders the cell nonresponsive, even to properly presented antigens with costimulatory signals. The anergic state can be reversed at least partially by the addition of exogenous IL‐2, thus indicating that a major defect is in the TCR‐mediated IL‐2 production (Schwartz, 1997). Intensive analyses of anergic T cells have revealed two dominant biochemical features distinctly different from those of normal T cells. First, TCR‐mediated activation of the Ras–ERK pathway is severely impaired in anergic T cells, resulting in defective generation of the AP‐1 complex, while other pathways (e.g., PLC‐g1 activation and so on) remain largely intact. It is controversial whether Ras activation bypassing the TCR signal (e.g., PMA) would restore ERK activation (Schwartz, 1997). Second, there is evidence that IL‐2 gene transcription is strongly repressed by cis‐ acting elements in anergic T cells, although the exact nature of repression remains to be elucidated. Boussiotis et al. (1997) have first reported that in vitro anergized T cells reveal constitutive activation of Rap1, which in fact is responsible for the defective Ras activation and IL‐2 gene activation on CD3 and CD28 stimulations. They have further suggested that constitutive phosphorylation of Cbl by Fyn and its association with CrkL‐C3G may be involved in Rap1 activation of anergic T cells (Boussiotis et al., 1997). However, it has been documented that Cbl, which possesses an E3 ubiquitin ligase activity (Joazeiro et al., 1999), elicits ubiquitin modification of CrkL and negatively regulates C3G recruitment and Rap1 activation (Shao et al., 2003). Thus, the involvement of Cbl in constitutive Rap1 activation in anergic T cells remains to be verified. Nonetheless, constitutive
R A P 1 I N I M M U N E R E S P O N S E A N D H E M AT O P O I E S I S
243
Rap1 activation has also been observed in T cell populations in vivo with anergic features such as CD4þ CD25þ and CD4þ CD103þ regulatory Tcells (Li et al., 2005a,b). Although normal T cells barely express B‐Raf, T cells ectopically expressing B‐Raf apparently escape anergy induction in vitro by APC stimulation of low B7 expression in association with potent Rap1 and ERK activation (Dillon et al., 2005). In addition, CTLA‐4‐deficient T cells have been shown to resist anergy induction in vivo as well (Greenwald et al., 2001). Collectively, the sustained Rap1 signal downstream of TCR stimulation plays a role in inducing and maintaining an anergic state in T cells, which do not express B‐Raf. Downstream effects of Rap1 in maintaining the anergic state warrant further investigations. We have previously reported that the T cells with CD44high memory phenotype in aged SPA‐1/ mice selectively exhibit constitutive accumulation of Rap1GTP in vivo and manifest markedly compromised proliferation and IL‐2 production via TCR stimulation (Ishida et al., 2003b; Fig. 2). We have recently found that the anergic CD44high CD4þ T cells are in fact accumulated in normal mice as well with aging, albeit the extent is less than that observed in SPA‐1/ mice (our unpublished observation). The hyporesponsiveness of CD44high SPA‐1/ T cells is probably attributed to impaired ERK activation by TCR‐stimulation despite the induction of normal Ras activation (Ishida et al., 2003b). The results reinforce that downregulation of the Rap1 signal by SPA‐1 following antigen stimulation may be critical in preventing an anergic state from occurring in primed T cells. By bypassing TCR stimulation with PMA and Ca2þ ionophore, such anergic T cells still show compromised proliferation and IL‐2 production, and thus, Rap1‐mediated interference with the Ras–ERK pathway alone may not be able to fully account for the anergic state. A report has suggested that the specifically expressed Tob (an antiproliferative protein family member gene) in anergic T cells may be responsible for IL‐2 gene repression by acting as a cofactor of Smad2/4 (Tzachanis et al., 2001). Therefore, the involvement of persistent Rap1 activation in the constitutive repression of IL‐2 gene warrants further studies. Importantly, the anergic Tcells in SPA‐1/ and normal aged mice are confined to a specific subset of CD44high T cells, and the proportions are drastically increased in SPA‐1/ mice that have developed frank leukemia (our unpublished observation). Studies have demonstrated that tumor‐specific T cells are anergized in hosts bearing experimental tumors with potent immunogenicity, albeit they may be efficiently generated (Willimsky and Blankenstein, 2005). Understanding the mechanisms of T cell anergy in tumor‐bearing hosts may be crucial for controlling malignancy, and SPA‐1/ mice should provide a reliable model to investigate the interaction between the immune system and the naturally occurring tumor factors in vivo.
244
N A G A H I R O M I N AT O E T A L .
3.4. B Cell Development and Self‐Tolerance Rap1 is activated by BCR stimulation in B cells as well (McLeod et al., 1998). While it has been reported that BCR‐induced Rap1 activation inhibits PI3K‐ dependent AKT activation without affecting ERK activation in a B cell line (Christian et al., 2003), the physiological role of the effect remains unknown. A unique role of the Rap1 signal in development and function of B‐lineage cells in vivo has again been uncovered using SPA‐1 knockout (KO) mice. SPA‐1 KO mice show preferential increases in peritoneal B1a cells (CD5þ Mac‐1þ B220þ IgMhigh) with aging, accompanied by development of antinuclear antibodies such as anti‐dsDNA antibody (Ishida et al., 2006). While autoantibodies are of the IgM class in young SPA‐1 KO mice, significant IgG and IgA autoantibodies develop in elder mice to eventuate characteristic lupus‐like immune complex glomerulonephritis (Ishida et al., 2006). It has been documented that B1a cells are responsible for the production of anti‐dsDNA antibodies. Peritoneal B1a cells of SPA‐1/ mice displayed marked accumulation of Rap1GTP and were actively cycling, indicating that the cells were activated by constitutive self‐antigens in vivo. Rather surprisingly, however, the SPA‐1/ peritoneal B1a cells did not show enhanced proliferation via BCR stimulation, instead a rather compromised response was manifested. Thus, unlike hitherto reported many mutant mice that developed lupus‐like autoimmune diseases, autoimmunity in SPA‐1/ mice is not attributed to intrinsic BCR‐hyperreactivity of B cells. B cells of SPA‐1/ mice, however, revealed significantly altered BCR repertoire of the Vk genes as compared to those of control mice (Fig. 3). Studies have indicated that unexpectedly high proportions of the newly emerged immature B cells (>50%) in BM are autoreactive (Wardemann et al., 2003) and receptor‐ editing plays a major role in negating the autoreactivity (Casellas et al., 2001). Receptor‐editing primarily involves Ig light (L)‐chain genes taking advantage of the fact that Vk/Jk gene rearrangements may occur repetitively unlike Ig heavy chain genes because of the absence of D gene segments. OcaB, which controls the recombination and expression of selected Vk genes as a transcriptional cofactor of Oct1,2, plays a crucial role in receptor editing (Casellas et al., 2001, 2002). It has been revealed that the Rap1 signal induces transcriptional activation of OcaB via p38MAPK‐dependent Creb activation in B cells, and in fact immature BM B cells of SPA‐1/ mice with excessively enhanced Rap1GTP levels exhibit augmented OcaB gene expression (Ishida et al., 2006). The results suggest that the Rap1 signal generated by the ligation of BCR with self‐antigens in self‐reactive immature BM B cells may play a role in receptor editing via OcaB gene activation. The expected consequences of excessive Rap1 activation in SPA‐1/ immature B cells might be twofold: (1) it may cause skewing of the Vk gene usage toward
R A P 1 I N I M M U N E R E S P O N S E A N D H E M AT O P O I E S I S
245
Pro-B Transitional B
Immature B
Follicular B
Non-selfreactive
B2
Pre-B
Selfreactive Self-antigens
Rap1 p38MAPK OcaB
Complete receptor editing Partial receptor editing
B1a
Class switch affinity maturation Self-antigens
Apoptosis
Pathogenic autoantibodies (Anti-dsDNA IgG) Hemolytic autoantibody
Genetic hit?
Igk Igl
B1a
IgL allelic inclusion
B1a cells peritoneal cavity marginal zone
B-CLL
Figure 3 Rap1 signal may function as a ‘‘self‐sensing’’ signal in immature bone marrow B cells and control the editing of self‐reactive BCR. Self‐reactive immature B cells in BM are tolerated by several distinct mechanisms including clonal deletion and receptor editing. On stimulation with self‐antigens, they may undergo repetitive rounds of Vk‐gene expression and rearrangement until the self‐reactivity of BCR is negated by a new Igk chain (editor Vk), viz., complete receptor editing. Rap1‐mediated p38MAPK‐dependent OcaB gene activation plays an important role in the expression and rearrangement of selective Vk gene. With excess Rap1 activation in the absence of SPA‐1, repetitive Vk‐gene rearrangement may proceed to Vl‐gene rearrangement, leading to allelic inclusion of Ig light chain genes. Such partial receptor editing may generate B cells with significantly reduced yet potential self‐reactivity. Such partially receptor‐edited B cells are delivered preferentially to certain privileged sites, such as the peritoneal cavity, to become B1a (CD5þ CD11aþ) cells. Since these B1a cells retain potential self‐reactivity, they may progress to produce pathogenic autoantibodies (such as anti‐dsDNA IgG) following class switching and affinity maturation once triggered in the periphery. Repetitive stimulations of the B1a cells by constitutive self‐antigens may also predispose them to B1‐cell leukemia resembling human B cell chronic lymphocytic leukemia (B‐CLL) associated with autoantibody production.
the Vk genes with higher OcaB dependency (such as the most frequently utilized Vk4 gene in mouse anti‐dsDNA antibodies; Liang et al., 2003), a finding which in fact has been demonstrated in SPA‐1/ mice (Ishida et al., 2006); and (2) excessive Rap1 signals may abnormally accelerate Vk gene recombination and expression in SPA‐1/ self‐reactive immature B cells. Normally, receptor editing is completed by rearrangement and expression of rare editor Vk genes to replace
246
N A G A H I R O M I N AT O E T A L .
the Vk genes involved in self‐reactive BCR. Excessive Rap1 signals and sustained OcaB overexpression, however, may result in incessant Vk gene rearrangements with ineffective editing (due to the preference for particular Vk genes), eventually leading to Vl gene rearrangement and expression. In fact, significant proportions of the peritoneal B1 cells in the SPA‐1 KO mice revealed an allelic inclusion (Ishida et al., 2006), expressing both the Vk‐IgL and Vl‐IgL‐chains indicative of ‘‘partial editing’’ (Fig. 3). The results suggest the important role of Rap1 in mediating the ‘‘self‐sensing’’ signal downstream of BCR in the newly derived immature BM B cells. The origin of B1 cells has long been a matter of argument. In mice, the polyspecific B1 cells are supposed to have originated at the embryonic stage and subsequently segregated in the peritoneal cavity, where they can be self‐ renewed (Hayakawa and Hardy, 1988). Such B1 cells play important roles in innate immunity against bacterial infections by producing natural IgM antibodies broadly reactive to the various bacterial antigens (Coutinho et al., 1995). Although it has been known that pathogenic autoantibodies in systemic autoimmune diseases are also derived preferentially from B1 cells, their exact origin remains largely unresolved. B cells expressing transgenic anti‐dsDNA BCR, for instance, are segregated and distributed in marginal zones rather than in the follicles of spleen (Li et al., 2002). Previous report also suggested that VH gene usage might primarily determine the B1/B2 fates of the B cell development using VH gene transgenic models (Lam and Rajewsky, 1999). Thus, the unique features of pathogenic autoreactive B cells being defined as B1 cells may be primarily attributed to BCR‐specificity per se rather than to distinct lineage. B1 cells in SPA‐1/ mice exhibit remarkably high expression levels of b1‐integrin (unpublished results), and the Rap1 signal may as well control the unique distribution pattern of B1 cells having potentially pathogenic autoreactivities. Notably, a minor portion of SPA‐1/ mice (ca. 10%) eventually developed characteristic leukemia of CD5þ Mac‐1þ B220þ phenotypes corresponding to B1a cells with hemolytic autoantibodies (Ishida et al., 2006). Marked increases in CD5þ B cells with high frequencies of autoimmunity (such as hemolytic anemia and autoimmune thrombocytopenia) are a hallmark of human B cell chronic lymphocytic leukemia (B‐CLL), and thus B cell leukemia in SPA‐1/ mice is highly reminiscent of human B‐CLL. Furthermore, leukemic B cells in some SPA‐1/ mice revealed chromosomal translocation involving the Igl‐ chain gene, t(2;6), and Igk‐chain gene, t(2;16) (Ishida et al., 2006). We therefore propose that enhanced receptor editing and persistent stimulations by constitutive self‐antigens of self‐reactive B1 cells may have predisposed them to the eventual leukemic transformation. Dysregulated Rap1 signals in the B‐lineage cells may provide a link between autoimmunity and B‐CLL (Fig. 3).
R A P 1 I N I M M U N E R E S P O N S E A N D H E M AT O P O I E S I S
247
3.5. Lymphocyte Migration and Homing Lymphocytes generated and maturated in primary lymphoid organs continuously emigrate via the blood circulation to specific secondary lymphoid tissues. Homing of naive lymphocytes to particular areas in the secondary lymphoid tissues and migration of primed or effector lymphocytes to local tissues where antigens exist are crucial events in immunosurveillance. Attraction of lymphocytes by specific chemokines and transendothelial migration plays a major role in the lymphocyte migration and homing to secondary lymphoid organs. The first step of chemokine‐induced transendothelial migration is the rolling of lymphocytes via selection followed by firm adhesion to endothelial cells against shear flow in response to specific chemokines (Butcher and Picker, 1996; Springer, 1995). The latter depends on integrin (LFA‐1, VLA‐4) activation and strong adhesion to their ligands (ICAM‐1, VCAM‐1) expressed on endothelial cells (Wittchen et al., 2005). Chemokine gradient induces the polarized accumulation of integrins at the leading edge, while CD44 is mobilized to the uropod (Katagiri et al., 2003; Shimonaka et al., 2003). This polarity is vital for subsequent lymphocyte migrations across the endothelial cells (diapedesis). The direct interaction of LFA‐1 with JAM‐1, another Ig superfamily (IgSF) protein located at the apical part of the endothelial adherence junction near the TJ, is also involved in diapedesis and may ‘‘unlock’’ the homotypic intercellular junction to guide the lymphocytes during transmigration (Ostermann et al., 2002). Stimulation of the lymphocytes with specific chemokines (e.g., SLC and SDF‐1) causes rapid Rap1 activation, and all the events required for transendothelial migration (including adhesion, polarization, and diapedesis) are potently inhibited by overexpression of SPA‐1 or a dominant‐negative Rap1 mutant, indicating the essential role of Rap1 signals (Shimonaka et al., 2003). Recent reports have indicated that a Rap1 effector (RapL) plays a major role in lymphocyte migration (Section 1.2.2). RapL/ mice show significant atrophies of the secondary lymphoid organs associated with increased circulating lymphocytes, indicating their impaired homing to lymphoid organs (Katagiri et al., 2004). Furthermore, RapL/ mice have indicated reductions of maturated T cell migration from the thymus as well as impaired migration of the skin DCs to regional LNs by inflammatory stimuli (Katagiri et al., 2004). These results thus clarify the essential roles of the Rap1 signal in constitutive and inflammation‐induced lymphocyte migrations and trafficking. In a human‐inherited disease called leukocyte adhesion deficiency (LAD) syndrome, affected patients show persistent leukocytosis and life‐threatening bacterial infections due to defective leukocyte adhesion to blood vessels and transmigration. Of the various subtype LAD patients, a majority (type‐I LAD) indicates germline mutations with impaired expression and function in the
248
N A G A H I R O M I N AT O E T A L .
b2‐integrin (CD18) gene (Anderson and Springer, 1987). A clinical encounter with a rare autosomal recessive LAD syndrome (type‐III LAD), where b2‐integrin expression and intrinsic adhesive activities of lymphocytes are apparently normal, has added an intriguing dimension to the complexity of LAD syndrome (Alon and Etzioni, 2003). The lymphocytes from type‐III LAD patients display severely compromised Rap1‐mediated integrin activation in response to chemokines, although chemokine receptor signaling per se as well as PMA‐induced Rap1 activation remains normal (Kinashi et al., 2004). While the reasons for impaired Rap1 activation in response to chemokines and the relevant causative gene remain to be identified, the results strongly suggest that functional defects in chemokine receptor‐coupled Rap1 activation are responsible for type‐III LAD syndrome in humans. 4. Rap1 Signal in Hematopoiesis and Leukemia SPA‐1 is most prominently expressed in the BM, in particular in the immature hematopoietic cell population, implicating a requirement of tight control of Rap1 signal in them. Analysis of SPA‐1 KO mice disclosed unexpected yet important role of the Rap1 signal in regulating normal hematopoiesis (Table 1). 4.1. Hematopoietic Stem Cells and the Niche Hematopoietic stem cells (HSCs) fulfill two opposing features: viz., per se self‐ renewal without differentiation and the ability of differentiating to all lineages of mature blood cells. Constitutive hematopoiesis depends on the homeostatic balance of HSCs between self‐renewal and differentiation. Accumulating evidence indicates that HSCs homeostasis is maintained by intimate interactions of HSCs with a specific hematopoietic microenvironment called the niche (Calvi et al., 2003; Whetton and Graham, 1999; Zhang et al., 2003). The role of Rap1 in maintaining stem cells in the niche has been well illustrated by the male germ stem cells (GSCs) of Drosophila. In testes of the fruit fly, a cluster of 10–12 cells (or ‘‘hub’’) forms the niche for GSCs (Fuchs et al., 2004). When a GSC divides, one daughter cell remains anchored to the hub cells, while the other drifts away from the hub and differentiates to form a gonialblast. Hub cells produce growth factors, such as Upd (unpaired) and Gbb (glass bottom boat), to regulate self‐renewal of GSCs, which have previously anchored to the hub through DE‐cadherin‐mediated cell adhesion to receive these signals (Yamashita et al., 2003). A genetic study has revealed that the defect of Rap1 GEF (Gef26) or Rap1 causes the reduced formation of adherens junctions at the hub–GSC interface, resulting in GSC loss due to exhaustive differentiation (Wang et al., 2006). Thus, the Rap1 signal plays a major role in maintaining GSCs in the niche.
R A P 1 I N I M M U N E R E S P O N S E A N D H E M AT O P O I E S I S
249
In mouse BM, spindle‐shaped N‐cadherinþ osteoblastic cells on the surface of cancellous or trabecular bone are the primary candidates of niche stroma for HSCs (Zhang et al., 2003). A previous study has demonstrated that c‐Myc‐ deficient HSCs with enhanced expression of N‐cadherin and integrins are markedly accumulated in the niche with reduced differentiation. On the contrary, c‐Myc overexpression accelerates the HSC release from the niche and thereby promotes their differentiation to eventuate stem cell exhaustion (Wilson et al., 2004). Thus, the control of HSC adhesive molecules may play a crucial role in maintaining HSCs in a niche microenvironment to regulate the signals for homeostatic balance between self‐renewal and differentiation of HSCs (Fig. 4). SPA‐1/ mice consistently display gradual increases of HSC counts in BM with aging to eventually suffer overt myeloproliferative disorders (MPDs; see below). Furthermore, the diseased SPA‐1/ mice have revealed marked increases in the HSC population excessively expressing LFA‐1, resulting in premature HSC mobilization out of BM to subsequently induce massive extramedullary hematopoiesis (Kometani et al., 2006). These results indicate that control of the Rap1 signal by SPA‐1 is crucially involved in the regulation of HSC interaction with the niche. SDF‐1 produced by BM stroma cells is a major chemotactic factor involved in HSC migration and homing to a hematopoietic microenvironment (Nagasawa et al., 1996). The expression of SDF‐1 receptor (CXCR4) on human CD34þ hematopoietic progenitors is reportedly enhanced by the cAMP‐induced Rap1signal (Goichberg et al., 2006). The Rap1 signal also plays a major role in SDF‐1‐ mediated activation of b1‐integrins (Shimonaka et al., 2003), which is essential for migration and homing of HSCs to the hematopoietic microenvironment (Potocnik et al., 2000). We recently found that HSCs overexpressing SPA‐1 or dominant‐negative Rap17A mutant showed reduced engulfment when transplanted into irradiated mice compared with control cells (our unpublished data). Therefore, Rap1 is most likely involved in HSC migration and homing to BM microenvironments or the niche, which is essential for the successful human BM transplantation. 4.2. Dysregulated Rap1 Signal and Myeloproliferative Disorders A vast majority of SPA‐1/ mice eventually developed marked peripheral leukocytosis and massive splenomegaly with extensive extramedullary hematopoiesis in their second year (Ishida et al., 2003a; Kometani et al., 2004; Fig. 4). Although well‐differentiated granulocytes usually predominated in the blood of these mice, CFU‐C assays have revealed increases in hematopoietic cells of all lineages, suggesting inductions of dysregulated expansion and differentiation of multipotent hematopoietic progenitors. A significant proportion of SPA‐1/ mice additionally
250
N A G A H I R O M I N AT O E T A L .
A Mature blood cells
Growth factors
Niche stroma
CHP
MHP
HSC N-Cad
BM
LFA-1
Normal medullary hematopoiesis B BCR-ABL MHP
CHP
Rap1
Chronic phase
HSC N-Cad
LFA-1
CML
BM
Rap1 Premature immobilization
Rap1 Blast
Blast crisis
LFA-1 Rap1 Spleen
Second hit? Rap1 Extramedullary hematopoiesis Tissue invasion metastasis
Figure 4 Control of homeostatic hematopoiesis by Rap1 and myeloid leukemia in SPA‐1 deficiency. Self‐renewal and differentiation of hematopoietic stem cells (HSCs) are controlled by the intimate interaction with niche stroma cells in BM via coordinated balance of adhesion molecules, including N‐cadherin (N‐Cad) and migratory integrins such as LFA‐1 (A). SPA‐1 is a principal Rap1GAP expressed in HSCs and multipotent hematopoietic progenitors (MHPs), and persistent Rap1 activation in SPA‐1/ HSCs and MHPs results in their accelerated expansion and differentiation. In addition, SPA‐1/ MHPs show strong expression of LFA‐1, and prematurely abandon the bone marrow to initiate extensive extramedullary hematopoiesis in the spleen. SPA‐1/ mice eventually develop myeloproliferative disorders (MPD) that resemble chronic myelogenous leukemia (CML) in the chronic phase. During the process, blast crisis may occur at any committed hematopoietic progenitors (CHP) to cause either myeloid or lymphoid acute leukemia. Rap1 is constitutively activated in such blast cells as well and may play a significant role in their aggressive
R A P 1 I N I M M U N E R E S P O N S E A N D H E M AT O P O I E S I S
251
accommodated variable extents of blastic cells of either myeloid or lymphoid lineages, which infiltrated in vital tissues (Ishida et al., 2003a). These features highly resemble human CML in the chronic phase and acute crisis. In addition, a minor portion of mice developed severe anemia and pancytopenia often associated with dysplastic or blastic leukocytes, and the phenotypes coincided well with the human myelodysplastic syndrome (MDS). The latent periods of MPD were usually long (ca. 12 months), and secondary genetic events might affect the final disease phenotypes, especially in blast crisis. Despite the apparent diversity of MPD, diseased SPA‐1/ mice share common features, including accumulation of Rap1GTP in the HSC‐enriched BM cell fraction, selective increase in HSC population with excessive LFA‐1 expression in BM, and marked HSC mobilization to the spleen (Kometani et al., 2006). Altogether, these findings strongly suggest that HSC disorders are the causative factors underlying MPD (Fig. 4). CML represents leukemia of HSCs, and leukemic stem cells generate increasing numbers of various types of mature blood cells (Ren, 2005). Similarities and differences between normal and leukemic HSCs are the fundamental issue in CML pathogenesis. Although it has been reported that enhanced self‐renewing capacity of HSCs in several mutant (such as Lnk/, c‐Myc/, and p18INK4C/) mice yields marked increases in the HSC population, these mice do not develop overt MPD (Takaki et al., 2002; Wilson et al., 2004; Yuan et al., 2004). On the other hand, a report has indicated that conditional deletion of Pten gene in HSCs result in the development of acute MPD (Yilmaz et al., 2006; Zhang et al., 2006a). Pten is a phosphatase that converts PIP3 to PIP2 and negatively regulates the PI3K‐signaling pathway (Cully et al., 2006). Pten/ mice indicate progressive reductions in self‐renewing HSCs due to their accelerated differentiation and peripheral mobilization, resulting first in massive extramedullary hematopoiesis rapidly followed by blast crisis in association with frequent chromosomal translocations (Yilmaz et al., 2006; Zhang et al., 2006a). The overall features of MPD in conditional Pten/ mice resemble those of SPA‐1/ mice, except for more acute development in the former. Thus, the accelerated drive of HSCs in differentiation and premature mobilization (with or without the reduced self‐ renewing HSCs) seems to be the common features of CML‐like MPD, and it would be of interest to investigate whether SPA‐1/ and Pten/ mice, in part, share the dysregulation of signaling pathways in HSCs, particularly the PI3K–AKT pathway. invasion into many vital tissues. In humans, the BCR‐ABL fusion gene from the Philadelphia chromosome is a major cause of CML and constitutive Rap1 activation downstream of BCR‐ABL oncoprotein may participate in molding phenotypes of human CML.
252
N A G A H I R O M I N AT O E T A L .
In humans, the vast majority of CML is caused by BCR‐ABL oncoprotein generated by chromosomal translocation t(9;22). All lineages of maturated peripheral leukocytes have an identical chromosomal anomaly, indicating that MPD is due to the leukemic transformation of an HSC clone (Wong and Witte, 2004). BCR‐ABL protein delivers a diverse array of signals via constitutive ABL tyrosine kinase activity, including the Ras–ERK, PI3K–AKT, and Stat5–Bcl2 pathways, as well as integrin activation (Jin et al., 2006; Sonoyama et al., 2002; Wong and Witte, 2004). Although all these signals may contribute to various aspects of leukemic features, the PI3K pathway apparently plays a prominent role in terms of leukemogenesis in vivo because the BCR‐ABL mutant gene (lacking a domain responsible for PI3K activation) then loses the leukemogenic activity (Sattler et al., 2002). Evidence has indicated that Rap1 is activated constitutively by BCR‐ABL via recruitment and phosphorylation of C3G (Cho et al., 2005), or partial repression of SPA‐1 gene expression (Kometani et al., 2006), or both. Most notably, SPA‐1 overexpression has significantly inhibited PI3K/AKT activation in BCR‐ABLþ cells (Jin et al., 2006). To directly examine the role of Rap1 signals in BCR‐ABL‐induced CML, we compared the leukemic phenotypes between the normal and SPA‐1/ progenitors transduced with BCR‐ABL oncogene in a mouse model. The findings demonstrated that, while both progenitors caused CML in the primary recipients, SPA‐1/ leukemic progenitors persisted longer than the control in vivo when judged by the serial transfer experiment (Kometani et al., 2006). In addition, significant proportions of the former showed blastic crisis, supporting a role of the endogenous Rap1 signal in BCR‐ABL‐induced CML genesis in the recipients. In some juvenile CML patients, loss of heterozygosity in NF1 gene encoding a RasGAP has been observed (Shannon et al., 1994) and in fact NF1þ/ mice have developed CML with a long latency of over a year (Jacks et al., 1994). Due to enhanced activation of the Ras–ERK pathway, NF1/ cells consequently develop hyperresponsiveness to GM‐CSF (Bollag et al., 1996; Largaespada et al., 1996). In contrast, SPA‐1/ CML cells show unchanged responsiveness to hematopoietic growth factors such as GM‐CSF (Ishida et al., 2003a), and thus deficiencies of SPA‐1 (Rap1GAP) and NF‐1 (RasGAP) induce CML‐like via distinctly different mechanisms. Current literature advocates the dependence of CML‐genic potential of BCR‐ ABL on complex interactions with the intrinsic self‐renewing potential of HSCs (Huntly et al., 2004). This is of particular clinical significance because imatinib mesylate (Gleevec; a potent inhibitor of ABL kinase activity) that can rapidly reduce the massive burden of leukemic leukocytes fails to eradicate the CML stem cells, so‐called residual diseases (Michor et al., 2005). Under such circumstances, most of the patients eventually develop recurrence of lethal aggressive leukemia. SPA‐1 is among the gene set of the murine self‐renewal‐associated
R A P 1 I N I M M U N E R E S P O N S E A N D H E M AT O P O I E S I S
253
signature and highly enriched in human leukemic stem cells as well (Krivtsov et al., 2006), and thus it seems likely that BCR‐ABL connects with the intrinsic Rap1 signal in HSC, at least in part, to cause CML. The crucial target cells for controlling CML are the leukemic stem cells (Huntly and Gilliland, 2005), and Rap1 may provide a rational molecular target for the eradication of CML in humans. 4.3. Role of Rap1 in Generation and Function of Platelets Among the various blood cells, the role of Rap1 signals in generation and function of platelets has been most extensively studied (Stork and Dillon, 2005). Maturation of megakaryocytes depends on thrombopoietin acting on the Mpl receptor to induce sustained ERK activation (Garcia et al., 2001). However, erythropoietin and GM‐CSF induce proliferation, but not maturation, of megakaryocytes, and such an action is associated with transient ERK activation (Stork and Dillon, 2005). This represents another event where the Rap1 and Ras signals mediate the distinct modes of ERK activation to induce different effects (Section 1). BM stroma cells inhibit differentiation of megakaryocyte progenitors by direct contact, an effect which has been elicited by inhibition of Rap1‐mediated persistent ERK activation (Delehanty et al., 2003). A specific type of b3‐integrin (aIIbb3), which is expressed selectively by platelets, plays essential roles in platelet function (e.g., aggregation and adhesion) related with homeostasis and thrombus formation. The abundantly expressed Rap1 in platelets is activated by many stimuli (e.g., turbulence, epinephrine, ADP, thrombin, thromboxane A2, and platelet‐activating factors) to cause platelet activation via aIIbb3 activation. CalDAG‐GEF I (RasGRP2) is responsible for Rap1 activation in platelets, and a report has revealed defective aIIbb3‐mediated platelet aggregation in CalDAG‐GEF I/ mice to induce markedly impaired haemostasis (Crittenden et al., 2004). 5. Rap1 Signal in Malignancy: New Aspects in Cancer In spite of the highly convergent homology with classical Ras, there have been limited experimental findings implicating Rap1 to function as an oncoprotein. In 1998, however, Altschuler and Ribeiro‐Neto (1998) have revealed certain unique roles of the Rap1 signal in cell transformation; Rap1‐transfected Swiss 3T3 fibroblasts are flatter and spread more with a higher saturation density than control cells. Although cell growth could be strongly enhanced by cAMP or EGF, the Rap1‐transfected cells showed no anchorage‐independent growth, and thus the cells revealed no evidence of transformation in vitro when viewed under a classical criterion. Surprisingly, however, the cells formed tumors in nude mice
254
N A G A H I R O M I N AT O E T A L .
(Altschuler and Ribeiro‐Neto, 1998). This presents a very unusual phenomenon, where cells are anchorage‐dependent in vitro and yet tumorigenic in vivo. The results suggest that Rap1 caused tumors in vivo by constitutive interaction with, rather than bypassing, the intrinsic growth pathways of host cells. In principle, the event may be coincidental with BCR‐ABL‐induced CML‐genesis, whereby BCR‐ABL oncoprotein promotes the dysregulated expansion of HSCs by interacting with the intrinsic self‐renewal feature of HSCs (Huntly et al., 2004). According to a recent study, certain human squamous cell carcinoma cells show high levels of Rap1GTP. Rap1GAP transduction reportedly represses tumorigenesis of such cancer cells in nude mice (Zhang et al., 2006b). These results suggest that Rap1 may act as a ‘‘conditional’’ oncoprotein. Hitherto, the Rap1 signal has been documented to affect the invasiveness and metastasis of tumors in vivo. Mutations of DOCK4 gene encoding a Rap1 activator have been reported in certain human cancer cells (Yajnik et al., 2003). The mutant DOCK4 protein exhibits a dominant‐negative effect to incite defective Rap1 activation in such cancer cells, resulting in the loss of intercellular adhesion among these abnormal cells. As a result, these cancers would manifest highly invasive behavior in vivo. Intriguingly, introduction of a wild‐ type DOCK4 gene restores the adherence junction among the cancer cells, and concomitantly represses the invasive tendency as the basal Rap1GTP is restored (Yajnik et al., 2003). It has also been reported that the Rap1 signal in cancer cells may play a critical role in metastasis. Employing the model of spontaneous development of mammary tumors in transgenic mice of polyoma middle T‐antigens under an MMTV promoter, Hunter and the colleagues have indicated that genetic polymorphism of the SPA‐1 (also called SIPA‐1) gene in the host is a major determinant for lung metastasis of primary mammary tumors (Park et al., 2005). Thus, mouse strains with SPA‐1/741A alleles display extensive lung metastases, whereas far less lung metastases are observed in those with SPA‐1/741T alleles. Interestingly, no significant differences in growth of the primary tumors are established between mice with a different allele. The single amino acid polymorphism at position 741 in the PDZ domain of SPA‐1 protein affects Rap1GAP activity in cancer cells, with SPA‐1/741A being more active than SPA‐1/741T (Park et al., 2005). On the basis of these findings, the reduced Rap1 signal in cancer cells might favor metastasis in addition to local invasiveness. In fact, these findings serve as the first direct indication that the host genetic background can affect the metastatic behavior of cancers (Threadgill, 2005). A report confirmed that certain SPA‐1 gene haplotypes are significantly associated with the presence of lymph node metastasis and poor prognosis in human mammary cancers (Crawford et al., 2006). Recently, we have also confirmed that prostate cancer cells in primary
R A P 1 I N I M M U N E R E S P O N S E A N D H E M AT O P O I E S I S
255
sites of patients with metastases exhibit expression of SPA‐1 protein significantly higher than those without metastasis (our unpublished observation). In other words, the Rap1 signal in cancer cells may partially control malignant invasiveness and remote metastasis by regulating intercellular adhesion among the cancer cells. 6. Conclusions and Perspectives Extensive and intensive studies in recent years have unveiled unique biological activities of Rap1. Two major activities of the Rap1 signal have been established: (1) control of cell–matrix and cell–cell adhesions via activation of integrins and other cell adhesion molecules and (2) regulation of the activation of various MAPKs. Rap1 is activated by an extensive spectrum of extracellular stimuli via many types of specific GEFs coupled with certain specific receptor systems, and the activation status is tightly controlled by GAPs at different intracellular compartments. Through such activities, Rap1 is involved in a range of diverse cellular functions far more than originally anticipated. Unique and unanticipated roles of the Rap1 signal in vivo have recently been uncovered by extensive analyses of gene‐targeted mice for Rap1 regulatory molecules. The Rap1 signal has been demonstrated to play crucial roles in diverse aspects of the developments and functions of immune and hematopoietic cells. Furthermore, Rap1 dysregulation causes characteristically specific diseases, with highly resembling human conditions. We anticipate that further analyses will reveal more as of yet undocumented important roles of the Rap1 signal in other biological systems such as the nervous and endocrine systems and malignant cells. While Rap1 is expressed ubiquitously in most tissue cells in the body, predominant roles of the Rap1 signal can be highly variable—depending on the contexts of specific cell types and functions. This signaling molecule with multifaceted functional variability provides a typical example, where a ubiquitous molecule may be crucially integrated into the highly specified and sophisticated functions of many biological events in a complex living system. Regulatory molecules of the Rap1 signal may also serve as potentially reliable and rational molecular targets for controlling various human diseases including malignancy. Acknowledgments The authors are grateful to all personnel in the Department of Immunology and Cell Biology, Graduate School of Medicine and Graduate School of Biostudies, Kyoto University. In particular, we would like to thank Drs. D. Ishida, Li Su, Hailin Yang, Y. Hamazaki, Y. Shinozuka, M. Moriyama, M. Aoki, F. Wang, K. Shimatani, Y. Nakajima, and Y. Katayama for their kind cooperation in carrying out the study. This study was supported by Grants‐in‐Aid for Scientific Research from the Ministry of Education, Science, Culture, Sport, and Technology of Japan.
256
N A G A H I R O M I N AT O E T A L .
References Alon, R., and Etzioni, A. (2003). LAD‐III, a novel group of leukocyte integrin activation deficiencies. Trends Immunol. 24, 561–566. Altschuler, D. L., and Ribeiro‐Neto, F. (1998). Mitogenic and oncogenic properties of the small G protein Rap1b. Proc. Natl. Acad. Sci. USA 95, 7475–7479. Anderson, D. C., and Springer, T. A. (1987). Leukocyte adhesion deficiency: An inherited defect in the Mac‐1, LFA‐1, and p150,95 glycoproteins. Annu. Rev. Med. 38, 175–194. Asha, H., de Ruiter, N. D., Wang, M. G., and Hariharan, I. K. (1999). The Rap1 GTPase functions as a regulator of morphogenesis in vivo. EMBO J. 18, 605–615. Bailly, M. (2004). Ena/VASP family: New partners, bigger enigma. Dev. Cell 7, 462–463. Barnier, J. V., Papin, C., Eychene, A., Lecoq, O., and Calothy, G. (1995). The mouse B‐raf gene encodes multiple protein isoforms with tissue‐specific expression. J. Biol. Chem. 270, 23381–23389. Bender, A., and Pringle, J. R. (1989). Multicopy suppression of the cdc24 budding defect in yeast by CDC42 and three newly identified genes including the ras‐related gene RSR1. Proc. Natl. Acad. Sci. USA 86, 9976–9980. Bivona, T. G., Wiener, H. H., Ahearn, I. M., Silletti, J., Chiu, V. K., and Philips, M. R. (2004). Rap1 up‐regulation and activation on plasma membrane regulates T cell adhesion. J. Cell Biol. 164, 461–470. Bollag, G., Clapp, D. W., Shih, S., Adler, F., Zhang, Y. Y., Thompson, P., Lange, B. J., Freedman, M. H., McCormick, F., Jacks, T., and Shannon, K. (1996). Loss of NF1 results in activation of the Ras signaling pathway and leads to aberrant growth in haematopoietic cells. Nat. Genet. 12, 144–148. Bos, J. L. (2003). Epac: A new cAMP target and new avenues in cAMP research. Nat. Rev. Mol. Cell Biol. 4, 733–738. Bos, J. L., de Rooij, J., and Reedquist, K. A. (2001). Rap1 signalling: Adhering to new models. Nat. Rev. Mol. Cell Biol. 2, 369–377. Boussiotis, V. A., Freeman, G. J., Berezovskaya, A., Barber, D. L., and Nadler, L. M. (1997). Maintenance of human T cell anergy: Blocking of IL‐2 gene transcription by activated Rap1. Science 278, 124–128. Butcher, E. C., and Picker, L. J. (1996). Lymphocyte homing and homeostasis. Science 272, 60–66. Calvi, L. M., Adams, G. B., Weibrecht, K. W., Weber, J. M., Olson, D. P., Knight, M. C., Martin, R. P., Schipani, E., Divieti, P., Bringhurst, F. R., Milner, L. A., Kronenberg, H. M., et al. (2003). Osteoblastic cells regulate the haematopoietic stem cell niche. Nature 425, 841–846. Cantrell, D. A. (2003). GTPases and T cell activation. Immunol. Rev. 192, 122–130. Carey, K. D., Dillon, T. J., Schmitt, J. M., Baird, A. M., Holdorf, A. D., Straus, D. B., Shaw, A. S., and Stork, P. J. (2000). CD28 and the tyrosine kinase lck stimulate mitogen‐activated protein kinase activity in T cells via inhibition of the small G protein Rap1. Mol. Cell. Biol. 20, 8409–8419. Carman, C. V., and Springer, T. A. (2003). Integrin avidity regulation: Are changes in affinity and conformation underemphasized? Curr. Opin. Cell Biol. 15, 547–556. Casellas, R., Shih, T. A., Kleinewietfeld, M., Rakonjac, J., Nemazee, D., Rajewsky, K., and Nussenzweig, M. C. (2001). Contribution of receptor editing to the antibody repertoire. Science 291, 1541–1544. Casellas, R., Jankovic, M., Meyer, G., Gazumyan, A., Luo, Y., Roeder, R., and Nussenzweig, M. (2002). OcaB is required for normal transcription and V(D)J recombination of a subset of immunoglobulin kappa genes. Cell 110, 575–585.
R A P 1 I N I M M U N E R E S P O N S E A N D H E M AT O P O I E S I S
257
Cho, Y. J., Hemmeryckx, B., Groffen, J., and Heisterkamp, N. (2005). Interaction of Bcr/Abl with C3G, an exchange factor for the small GTPase Rap1, through the adapter protein Crkl. Biochem. Biophys. Res. Commun. 333, 1276–1283. Christian, S. L., Lee, R. L., McLeod, S. J., Burgess, A. E., Li, A. H., Dang‐Lawson, M., Lin, K. B., and Gold, M. R. (2003). Activation of the Rap GTPases in B lymphocytes modulates B cell antigen receptor‐induced activation of Akt but has no effect on MAPK activation. J. Biol. Chem. 278, 41756–41767. Coutinho, A., Kazatchkine, M. D., and Avrameas, S. (1995). Natural autoantibodies. Curr. Opin. Immunol. 7, 812–818. Crawford, N. P., Ziogas, A., Peel, D. J., Hess, J., Anton‐Culver, H., and Hunter, K. W. (2006). Germline polymorphisms in SIPA1 are associated with metastasis and other indicators of poor prognosis in breast cancer. Breast Cancer. Res. 8, R16. Crittenden, J. R., Bergmeier, W., Zhang, Y., Piffath, C. L., Liang, Y., Wagner, D. D., Housman, D. E., and Graybiel, A. M. (2004). CalDAG‐GEFI integrates signaling for platelet aggregation and thrombus formation. Nat. Med. 10, 982–986. Crompton, T., Gilmour, K. C., and Owen, M. J. (1996). The MAP kinase pathway controls differentiation from double‐negative to double‐positive thymocyte. Cell 86, 243–251. Cullere, X., Shaw, S. K., Andersson, L., Hirahashi, J., Luscinskas, F. W., and Mayadas, T. N. (2005). Regulation of vascular endothelial barrier function by Epac, a cAMP‐activated exchange factor for Rap GTPase. Blood 105, 1950–1955. Cully, M., You, H., Levine, A. J., and Mak, T. W. (2006). Beyond PTEN mutations: The PI3K pathway as an integrator of multiple inputs during tumorigenesis. Nat. Rev. Cancer 6, 184–192. Daumke, O., Weyand, M., Chakrabarti, P. P., Vetter, I. R., and Wittinghofer, A. (2004). The GTPase‐activating protein Rap1GAP uses a catalytic asparagine. Nature 429, 197–201. de Rooij, J., Zwartkruis, F. J., Verheijen, M. H., Cool, R. H., Nijman, S. M., Wittinghofer, A., and Bos, J. L. (1998). Epac is a Rap1 guanine‐nucleotide‐exchange factor directly activated by cyclic AMP. Nature 396, 474–477. Delehanty, L. L., Mogass, M., Gonias, S. L., Racke, F. K., Johnstone, B., and Goldfarb, A. N. (2003). Stromal inhibition of megakaryocytic differentiation is associated with blockade of sustained Rap1 activation. Blood 101, 1744–1751. Dillon, T. J., Carey, K. D., Wetzel, S. A., Parker, D. C., and Stork, P. J. (2005). Regulation of the small GTPase Rap1 and extracellular signal‐regulated kinases by the costimulatory molecule CTLA‐4. Mol. Cell. Biol. 25, 4117–4128. Duchniewicz, M., Zemojtel, T., Kolanczyk, M., Grossmann, S., Scheele, J. S., and Zwartkruis, F. J. (2006). Rap1A‐deficient T and B cells show impaired integrin‐mediated cell adhesion. Mol. Cell. Biol. 26, 643–653. Dupuy, A. G., L’Hoste, S., Cherfils, J., Camonis, J., Gaudriault, G., and de Gunzburg, J. (2005). Novel Rap1 dominant‐negative mutants interfere selectively with C3G and Epac. Oncogene 24, 4509–4520. Dustin, M. L., Bivona, T. G., and Philips, M. R. (2004). Membranes as messengers in T cell adhesion signaling. Nat. Immunol. 5, 363–372. Erman, B., Guinter, T. I., and Singer, A. (2004). Defined alphabeta T cell receptors with distinct ligand specificities do not require those ligands to signal double negative thymocyte differentiation. J. Exp. Med. 199, 1719–1724. Farina, A., Hattori, M., Qin, J., Nakatani, Y., Minato, N., and Ozato, K. (2004). Bromodomain protein Brd4 binds to GTPase‐activating SPA‐1, modulating its activity and subcellular localization. Mol. Cell. Biol. 24, 9059–9069. Fischer, A. M., Katayama, C. D., Pages, G., Pouyssegur, J., and Hedrick, S. M. (2005). The role of erk1 and erk2 in multiple stages of T cell development. Immunity 23, 431–443.
258
N A G A H I R O M I N AT O E T A L .
Fuchs, E., Tumbar, T., and Guasch, G. (2004). Socializing with the neighbors: Stem cells and their niche. Cell 116, 769–778. Fukuhara, S., Sakurai, A., Sano, H., Yamagishi, A., Somekawa, S., Takakura, N., Saito, Y., Kangawa, K., and Mochizuki, N. (2005). Cyclic AMP potentiates vascular endothelial cadherin‐mediated cell‐ cell contact to enhance endothelial barrier function through an Epac‐Rap1 signaling pathway. Mol. Cell. Biol. 25, 136–146. Gao, Q., Srinivasan, S., Boyer, S. N., Wazer, D. E., and Band, V. (1999). The E6 oncoproteins of high‐risk papillomaviruses bind to a novel putative GAP protein, E6TP1, and target it for degradation. Mol. Cell. Biol. 19, 733–744. Gao, Q., Singh, L., Kumar, A., Srinivasan, S., Wazer, D. E., and Band, V. (2001). Human papillomavirus type 16 E6‐induced degradation of E6TP1 correlates with its ability to immortalize human mammary epithelial cells. J. Virol. 75, 4459–4466. Gao, Q., Kumar, A., Singh, L., Huibregtse, J. M., Beaudenon, S., Srinivasan, S., Wazer, D. E., Band, H., and Band, V. (2002). Human papillomavirus E6‐induced degradation of E6TP1 is mediated by E6AP ubiquitin ligase. Cancer Res. 62, 3315–3321. Garcia, J., de Gunzburg, J., Eychene, A., Gisselbrecht, S., and Porteu, F. (2001). Thrombopoietin‐ mediated sustained activation of extracellular signal‐regulated kinase in UT7‐Mpl cells requires both Ras‐Raf‐1‐ and Rap1‐B‐Raf‐dependent pathways. Mol. Cell. Biol. 21, 2659–2670. Goichberg, P., Kalinkovich, A., Borodovsky, N., Tesio, M., Petit, I., Nagler, A., Hardan, I., and Lapidot, T. (2006). cAMP‐induced PKCzeta activation increases functional CXCR4 expression on human CD34þ hematopoietic progenitors. Blood 107, 870–879. Gotoh, T., Hattori, S., Nakamura, S., Kitayama, H., Noda, M., Takai, Y., Kaibuchi, K., Matsui, H., Hatase, O., Takahashi, H., Kurata, T., and Matsuda, M. (1995). Identification of Rap1 as a target for the Crk SH3 domain‐binding guanine nucleotide‐releasing factor C3G. Mol. Cell. Biol. 15, 6746–6753. Greenwald, R. J., Boussiotis, V. A., Lorsbach, R. B., Abbas, A. K., and Sharpe, A. H. (2001). CTLA‐4 regulates induction of anergy in vivo. Immunity 14, 145–155. Greenwald, R. J., Freeman, G. J., and Sharpe, A. H. (2005). The B7 family revisited. Annu. Rev. Immunol. 23, 515–548. Haks, M. C., Belkowski, S. M., Ciofani, M., Rhodes, M., Lefebvre, J. M., Trop, S., Hugo, P., Zuniga‐Pflucker, J. C., and Wiest, D. L. (2003). Low activation threshold as a mechanism for ligand‐independent signaling in pre‐T cells. J. Immunol. 170, 2853–2861. Harazaki, M., Kawai, Y., Su, L., Hamazaki, Y., Nakahata, T., Minato, N., and Hattori, M. (2004). Specific recruitment of SPA‐1 to the immunological synapse: Involvement of actin‐bundling protein actinin. Immunol. Lett. 92, 221–226. Hariharan, I. K., Carthew, R. W., and Rubin, G. M. (1991). The Drosophila roughened mutation: Activation of a rap homolog disrupts eye development and interferes with cell determination. Cell 67, 717–722. Hattori, M., and Minato, N. (2003). Rap1 GTPase: Functions, regulation, and malignancy. J. Biochem. (Tokyo) 134, 479–484. Hattori, M., Tsukamoto, N., Nur‐e‐Kamal, M. S., Rubinfeld, B., Iwai, K., Kubota, H., Maruta, H., and Minato, N. (1995). Molecular cloning of a novel mitogen‐inducible nuclear protein with a Ran GTPase‐activating domain that affects cell cycle progression. Mol. Cell. Biol. 15, 552–560. Hayakawa, K., and Hardy, R. R. (1988). Normal, autoimmune, and malignant CD5 þ B cells: The Ly‐1 B lineage? Annu. Rev. Immunol. 6, 197–218. Hoshino, T., Sakisaka, T., Baba, T., Yamada, T., Kimura, T., and Takai, Y. (2005). Regulation of E‐cadherin endocytosis by nectin through afadin, Rap1, and p120ctn. J. Biol. Chem. 280, 24095–24103.
R A P 1 I N I M M U N E R E S P O N S E A N D H E M AT O P O I E S I S
259
Huntly, B. J., and Gilliland, D. G. (2005). Cancer biology: Summing up cancer stem cells. Nature 435, 1169–1170. Huntly, B. J., Shigematsu, H., Deguchi, K., Lee, B. H., Mizuno, S., Duclos, N., Rowan, R., Amaral, S., Curley, D., Williams, I. R., Akashi, K., and Gilliland, D. G. (2004). MOZ‐TIF2, but not BCR‐ ABL, confers properties of leukemic stem cells to committed murine hematopoietic progenitors. Cancer Cell 6, 587–596. Huppa, J. B., and Davis, M. M. (2003). T‐cell‐antigen recognition and the immunological synapse. Nat. Rev. Immunol. 3, 973–983. Ichiba, T., Hashimoto, Y., Nakaya, M., Kuraishi, Y., Tanaka, S., Kurata, T., Mochizuki, N., and Matsuda, M. (1999). Activation of C3G guanine nucleotide exchange factor for Rap1 by phosphorylation of tyrosine 504. J. Biol. Chem. 274, 14376–14381. Irving, B. A., Alt, F. W., and Killeen, N. (1998). Thymocyte development in the absence of pre‐T cell receptor extracellular immunoglobulin domains. Science 280, 905–908. Ishida, D., Kometani, K., Yang, H., Kakugawa, K., Masuda, K., Iwai, K., Suzuki, M., Itohara, S., Nakahata, T., Hiai, H., Kawamoto, H., Hattori, M., et al. (2003a). Myeloproliferative stem cell disorders by deregulated Rap1 activation in SPA‐1‐deficient mice. Cancer Cell 4, 55–65. Ishida, D., Yang, H., Masuda, K., Uesugi, K., Kawamoto, H., Hattori, M., and Minato, N. (2003b). Antigen‐driven T cell anergy and defective memory T cell response via deregulated Rap1 activation in SPA‐1‐deficient mice. Proc. Natl. Acad. Sci. USA 100, 10919–10924. Ishida, D., Su, L., Tamura, A., Katayama, Y., Kawai, Y., Wang, S. F., Taniwaki, M., Hamazaki, Y., Hattori, M., and Minato, N. (2006). Rap1 signal controls B cell receptor repertoire and generation of self‐reactive B1a cells. Immunity 24, 417–427. Jacks, T., Shih, T. S., Schmitt, E. M., Bronson, R. T., Bernards, A., and Weinberg, R. A. (1994). Tumour predisposition in mice heterozygous for a targeted mutation in Nf1. Nat. Genet. 7, 353–361. Jin, A., Kurosu, T., Tsuji, K., Mizuchi, D., Arai, A., Fujita, H., Hattori, M., Minato, N., and Miura, O. (2006). BCR/ABL and IL‐3 activate Rap1 to stimulate the B‐Raf/MEK/Erk and Akt signaling pathways and to regulate proliferation, apoptosis, and adhesion. Oncogene. 20, 4332–4340. Joazeiro, C. A., Wing, S. S., Huang, H., Leverson, J. D., Hunter, T., and Liu, Y. C. (1999). The tyrosine kinase negative regulator c‐Cbl as a RING‐type, E2‐dependent ubiquitin‐protein ligase. Science 286, 309–312. Kao, S., Jaiswal, R. K., Kolch, W., and Landreth, G. E. (2001). Identification of the mechanisms regulating the differential activation of the mapk cascade by epidermal growth factor and nerve growth factor in PC12 cells. J. Biol. Chem. 276, 18169–18177. Katagiri, K., Hattori, M., Minato, N., Irie, S., Takatsu, K., and Kinashi, T. (2000). Rap1 is a potent activation signal for leukocyte function‐associated antigen 1 distinct from protein kinase C and phosphatidylinositol‐3‐OH kinase. Mol. Cell. Biol. 20, 1956–1969. Katagiri, K., Hattori, M., Minato, N., and Kinashi, T. (2002). Rap1 functions as a key regulator of T‐cell and antigen‐presenting cell interactions and modulates T‐cell responses. Mol. Cell. Biol. 22, 1001–1015. Katagiri, K., Maeda, A., Shimonaka, M., and Kinashi, T. (2003). RAPL, a Rap1‐binding molecule that mediates Rap1‐induced adhesion through spatial regulation of LFA‐1. Nat. Immunol. 4, 741–748. Katagiri, K., Ohnishi, N., Kabashima, K., Iyoda, T., Takeda, N., Shinkai, Y., Inaba, K., and Kinashi, T. (2004). Crucial functions of the Rap1 effector molecule RAPL in lymphocyte and dendritic cell trafficking. Nat. Immunol. 5, 1045–1051. Kawasaki, H., Spingett, G. M., Toki, S., Canales, J. J., Harlan, P., Blumenstiel, J. P., Chen, E. J., Bany, I. A., Mochizuki, N., Ashbacher, A., Matsuda, M., Housman, D. E., et al. (1998). A Rap guanine nucleotide exchange factor enriched highly in the basal ganglia. Proc. Natl. Acad. Sci. USA 95, 13278–13283.
260
N A G A H I R O M I N AT O E T A L .
Kinashi, T., Aker, M., Sokolovsky‐Eisenberg, M., Grabovsky, V., Tanaka, C., Shamri, R., Feigelson, S., Etzioni, A., and Alon, R. (2004). LAD‐III, a leukocyte adhesion deficiency syndrome associated with defective Rap1 activation and impaired stabilization of integrin bonds. Blood 103, 1033–1036. Kitayama, H., Sugimoto, Y., Matsuzaki, T., Ikawa, Y., and Noda, M. (1989). A ras‐related gene with transformation suppressor activity. Cell 56, 77–84. Knox, A. L., and Brown, N. H. (2002). Rap1 GTPase regulation of adherens junction positioning and cell adhesion. Science 295, 1285–1288. Kometani, K., Ishida, D., Hattori, M., and Minato, N. (2004). Rap1 and SPA‐1 in hematologic malignancy. Trends Mol. Med. 10, 401–408. Kometani, K., Aoki, M., Kawamata, S., Shinozuka, Y., Era, T., Taniwaki, M., Hattori, M., and Minato, N. (2006). Role of SPA‐1 in phenotypes of CML induced by BCR‐ABL‐expressing hematopoietic progentiors in mouse model. Cancer Res. 66, 9967–9976. Krivtsov, A. V., Twomey, D., Feng, Z., Stubbs, M. C., Wang, Y., Faber, J., Levine, J. E., Wang, J., Hahn, W. C., Gilliland, D. G., Golub, T. R., and Armstrong, S. A. (2006). Transformation from committed progenitor to leukaemia stem cell initiated by MLL‐AF9. Nature 442, 818–822. Kurachi, H., Wada, Y., Tsukamoto, N., Maeda, M., Kubota, H., Hattori, M., Iwai, K., and Minato, N. (1997). Human SPA‐1 gene product selectively expressed in lymphoid tissues is a specific GTPase‐activating protein for Rap1 and Rap2. Segregate expression profiles from a rap1GAP gene product. J. Biol. Chem. 272, 28081–28088. Lafuente, E. M., van Puijenbroek, A. A., Krause, M., Carman, C. V., Freeman, G. J., Berezovskaya, A., Constantine, E., Springer, T. A., Gertler, F. B., and Boussiotis, V. A. (2004). RIAM, an Ena/VASP and Profilin ligand, interacts with Rap1‐GTP and mediates Rap1‐induced adhesion. Dev. Cell 7, 585–595. Lam, K. P., and Rajewsky, K. (1999). B cell antigen receptor specificity and surface density together determine B‐1 versus B‐2 cell development. J. Exp. Med. 190, 471–477. Largaespada, D. A., Brannan, C. I., Jenkins, N. A., and Copeland, N. G. (1996). Nf1 deficiency causes Ras‐mediated granulocyte/macrophage colony stimulating factor hypersensitivity and chronic myeloid leukaemia. Nat. Genet. 12, 137–143. Li, L., Godfrey, W. R., Porter, S. B., Ge, Y., June, C. H., Blazar, B. R., and Boussiotis, V. A. (2005a). CD4þCD25þ regulatory T‐cell lines from human cord blood have functional and molecular properties of T‐cell anergy. Blood 106, 3068–3073. Li, L., Greenwald, R. J., Lafuente, E. M., Tzachanis, D., Berezovskaya, A., Freeman, G. J., Sharpe, A. H., and Boussiotis, V. A. (2005b). Rap1‐GTP is a negative regulator of Th cell function and promotes the generation of CD4þCD103þ regulatory T cells in vivo. J. Immunol. 175, 3133–3139. Li, Y., Li, H., and Weigert, M. (2002). Autoreactive B cells in the marginal zone that express dual receptors. J. Exp. Med. 195, 181–188. Liang, Z., Chen, C., and Mohan, C. (2003). Molecular signatures of anti‐nuclear antibodies: Contributions of specific light chain residues and a novel New Zealand Black V kappa 1 germline gene. J. Immunol. 171, 3886–3894. Mandell, K. J., Babbin, B. A., Nusrat, A., and Parkos, C. A. (2005). Junctional adhesion molecule 1 regulates epithelial cell morphology through effects on beta1 integrins and Rap1 activity. J. Biol. Chem. 280, 11665–11674. Marshall, C. J. (1995). Specificity of receptor tyrosine kinase signaling: Transient versus sustained extracellular signal‐regulated kinase activation. Cell 80, 179–185. Mason, C. S., Springer, C. J., Cooper, R. G., Superti‐Furga, G., Marshall, C. J., and Marais, R. (1999). Serine and tyrosine phosphorylations cooperate in Raf‐1, but not B‐Raf activation. EMBO J. 18, 2137–2148. McLeod, S. J., Ingham, R. J., Bos, J. L., Kurosaki, T., and Gold, M. R. (1998). Activation of the Rap1 GTPase by the B cell antigen receptor. J. Biol. Chem. 273, 29218–29223.
R A P 1 I N I M M U N E R E S P O N S E A N D H E M AT O P O I E S I S
261
Michor, F., Hughes, T. P., Iwasa, Y., Branford, S., Shah, N. P., Sawyers, C. L., and Nowak, M. A. (2005). Dynamics of chronic myeloid leukaemia. Nature 435, 1267–1270. Mishra, S., Smolik, S. M., Forte, M. A., and Stork, P. J. (2005). Ras‐independent activation of ERK signaling via the torso receptor tyrosine kinase is mediated by Rap1. Curr. Biol. 15, 366–370. Mochizuki, N., Ohba, Y., Kiyokawa, E., Kurata, T., Murakami, T., Ozaki, T., Kitabatake, A., Nagashima, K., and Matsuda, M. (1999). Activation of the ERK/MAPK pathway by an isoform of rap1GAP associated with G alpha(i). Nature 400, 891–894. Nagasawa, T., Hirota, S., Tachibana, K., Takakura, N., Nishikawa, S., Kitamura, Y., Yoshida, N., Kikutani, H., and Kishimoto, T. (1996). Defects of B‐cell lymphopoiesis and bone‐marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF‐1. Nature 382, 635–638. Noda, Y., Horikawa, S., Furukawa, T., Hirai, K., Katayama, Y., Asai, T., Kuwahara, M., Katagiri, K., Kinashi, T., Hattori, M., Minato, N., and Sasaki, S. (2004). Aquaporin‐2 trafficking is regulated by PDZ‐domain containing protein SPA‐1. FEBS Lett. 568, 139–145. Ohba, Y., Ikuta, K., Ogura, A., Matsuda, J., Mochizuki, N., Nagashima, K., Kurokawa, K., Mayer, B. J., Maki, K., Miyazaki, J., and Matsuda, M. (2001). Requirement for C3G‐dependent Rap1 activation for cell adhesion and embryogenesis. EMBO J. 20, 3333–3341. Ostermann, G., Weber, K. S., Zernecke, A., Schroder, A., and Weber, C. (2002). JAM‐1 is a ligand of the beta(2) integrin LFA‐1 involved in transendothelial migration of leukocytes. Nat. Immunol. 3, 151–158. Pak, D. T., Yang, S., Rudolph‐Correia, S., Kim, E., and Sheng, M. (2001). Regulation of dendritic spine morphology by SPAR, a PSD‐95‐associated RapGAP. Neuron 31, 289–303. Park, Y. G., Zhao, X., Lesueur, F., Lowy, D. R., Lancaster, M., Pharoah, P., Qian, X., and Hunter, K. W. (2005). Sipa1 is a candidate for underlying the metastasis efficiency modifier locus Mtes1. Nat. Genet. 37, 1055–1062. Pizon, V., Chardin, P., Lerosey, I., Olofsson, B., and Tavitian, A. (1988). Human cDNAs rap1 and rap2 homologous to the Drosophila gene Dras3 encode proteins closely related to ras in the ‘effector’ region. Oncogene 3, 201–204. Potocnik, A. J., Brakebusch, C., and Fassler, R. (2000). Fetal and adult hematopoietic stem cells require beta1 integrin function for colonizing fetal liver, spleen, and bone marrow. Immunity 12, 653–663. Qui, M. S., and Green, S. H. (1992). PC12 cell neuronal differentiation is associated with prolonged p21ras activity and consequent prolonged ERK activity. Neuron 9, 705–717. Reedquist, K. A., and Bos, J. L. (1998). Costimulation through CD28 suppresses T cell receptor‐ dependent activation of the Ras‐like small GTPase Rap1 in human T lymphocytes. J. Biol. Chem. 273, 4944–4949. Reedquist, K. A., Ross, E., Koop, E. A., Wolthuis, R. M., Zwartkruis, F. J., van Kooyk, Y., Salmon, M., Buckley, C. D., and Bos, J. L. (2000). The small GTPase, Rap1, mediates CD31‐induced integrin adhesion. J. Cell Biol. 148, 1151–1158. Ren, R. (2005). Mechanisms of BCR‐ABL in the pathogenesis of chronic myelogenous leukaemia. Nat. Rev. Cancer 5, 172–183. Roy, B. C., Kohu, K., Matsuura, K., Yanai, H., and Akiyama, T. (2002). SPAL, a Rap‐specific GTPase activating protein, is present in the NMDA receptor‐PSD‐95 complex in the hippocampus. Genes Cells 7, 607–617. Sasagawa, S., Ozaki, Y., Fujita, K., and Kuroda, S. (2005). Prediction and validation of the distinct dynamics of transient and sustained ERK activation. Nat. Cell Biol. 7, 365–373. Sattler, M., Mohi, M. G., Pride, Y. B., Quinnan, L. R., Malouf, N. A., Podar, K., Gesbert, F., Iwasaki, H., Li, S., Van Etten, R. A., Gu, H., Griffin, J. D., et al. (2002). Critical role for Gab2 in transformation by BCR/ABL. Cancer Cell 1, 479–492.
262
N A G A H I R O M I N AT O E T A L .
Sawada, Y., Nakamura, K., Doi, K., Takeda, K., Tobiume, K., Saitoh, M., Morita, K., Komuro, I., De Vos, K., Sheetz, M., and Ichijo, H. (2001). Rap1 is involved in cell stretching modulation of p38 but not ERK or JNK MAP kinase. J. Cell Sci. 114, 1221–1227. Schmidt, A., Caron, E., and Hall, A. (2001). Lipopolysaccharide‐induced activation of beta2‐ integrin function in macrophages requires Irak kinase activity, p38 mitogen‐activated protein kinase, and the Rap1 GTPase. Mol. Cell. Biol. 21, 438–448. Schneider, H., Valk, E., da Rocha Dias, S., Wei, B., and Rudd, C. E. (2005). CTLA‐4 up‐regulation of lymphocyte function‐associated antigen 1 adhesion and clustering as an alternate basis for coreceptor function. Proc. Natl. Acad. Sci. USA 102, 12861–12866. Schultess, J., Danielewski, O., and Smolenski, A. P. (2005). Rap1GAP2 is a new GTPase‐activating protein of Rap1 expressed in human platelets. Blood 105, 3185–3192. Schwartz, R. H. (1997). T cell clonal anergy. Curr. Opin. Immunol. 9, 351–357. Sebzda, E., Bracke, M., Tugal, T., Hogg, N., and Cantrell, D. A. (2002). Rap1A positively regulates Tcells via integrin activation rather than inhibiting lymphocyte signaling. Nat. Immunol. 3, 251–258. Shannon, K. M., O’Connell, P., Martin, G. A., Paderanga, D., Olson, K., Dinndorf, P., and McCormick, F. (1994). Loss of the normal NF1 allele from the bone marrow of children with type 1 neurofibromatosis and malignant myeloid disorders. N. Engl. J. Med. 330, 597–601. Shao, Y., Elly, C., and Liu, Y. C. (2003). Negative regulation of Rap1 activation by the Cbl E3 ubiquitin ligase. EMBO Rep. 4, 425–431. Sharpe, A. H., and Freeman, G. J. (2002). The B7‐CD28 superfamily. Nat. Rev. Immunol. 2, 116–126. Shaw, R. J., and Cantley, L. C. (2006). Ras, PI(3)K and mTOR signalling controls tumour cell growth. Nature 441, 424–430. Shimonaka, M., Katagiri, K., Nakayama, T., Fujita, N., Tsuruo, T., Yoshie, O., and Kinashi, T. (2003). Rap1 translates chemokine signals to integrin activation, cell polarization, and motility across vascular endothelium under flow. J. Cell Biol. 161, 417–427. Sonoyama, J., Matsumura, I., Ezoe, S., Satoh, Y., Zhang, X., Kataoka, Y., Takai, E., Mizuki, M., Machii, T., Wakao, H., and Kanakura, Y. (2002). Functional cooperation among Ras, STAT5, and phosphatidylinositol 3‐kinase is required for full oncogenic activities of BCR/ABL in K562 cells. J. Biol. Chem. 277, 8076–8082. Springer, T. A. (1995). Traffic signals on endothelium for lymphocyte recirculation and leukocyte emigration. Annu. Rev. Physiol. 57, 827–872. Stork, P. J., and Dillon, T. J. (2005). Multiple roles of Rap1 in hematopoietic cells: Complementary versus antagonistic functions. Blood 106, 2952–2961. Su, L., Hattori, M., Moriyama, M., Murata, N., Harazaki, M., Kaibuchi, K., and Minato, N. (2003). AF‐6 controls integrin‐mediated cell adhesion by regulating Rap1 activation through the specific recruitment of Rap1GTP and SPA‐1. J. Biol. Chem. 278, 15232–15238. Suga, K., Katagiri, K., Kinashi, T., Harazaki, M., Iizuka, T., Hattori, M., and Minato, N. (2001). CD98 induces LFA‐1‐mediated cell adhesion in lymphoid cells via activation of Rap1. FEBS Lett. 489, 249–253. Swan, K. A., Alberola‐Ila, J., Gross, J. A., Appleby, M. W., Forbush, K. A., Thomas, J. F., and Perlmutter, R. M. (1995). Involvement of p21ras distinguishes positive and negative selection in thymocytes. EMBO J. 14, 276–285. Takaki, S., Morita, H., Tezuka, Y., and Takatsu, K. (2002). Enhanced hematopoiesis by hematopoietic progenitor cells lacking intracellular adaptor protein, Lnk. J. Exp. Med. 195, 151–160. Tamada, M., Sheetz, M. P., and Sawada, Y. (2004). Activation of a signaling cascade by cytoskeleton stretch. Dev. Cell 7, 709–718. Threadgill, D. W. (2005). Metastatic potential as a heritable trait. Nat. Genet. 37, 1026–1027.
R A P 1 I N I M M U N E R E S P O N S E A N D H E M AT O P O I E S I S
263
Traverse, S., Gomez, N., Paterson, H., Marshall, C., and Cohen, P. (1992). Sustained activation of the mitogen‐activated protein (MAP) kinase cascade may be required for differentiation of PC12 cells. Comparison of the effects of nerve growth factor and epidermal growth factor. Biochem. J. 288(Pt. 2), 351–355. Tsukamoto, N., Hattori, M., Yang, H., Bos, J. L., and Minato, N. (1999). Rap1 GTPase‐activating protein SPA‐1 negatively regulates cell adhesion. J. Biol. Chem. 274, 18463–18469. Tsygankova, O. M., Saavedra, A., Rebhun, J. F., Quilliam, L. A., and Meinkoth, J. L. (2001). Coordinated regulation of Rap1 and thyroid differentiation by cyclic AMP and protein kinase A. Mol. Cell. Biol. 21, 1921–1929. Tzachanis, D., Freeman, G. J., Hirano, N., van Puijenbroek, A. A., Delfs, M. W., Berezovskaya, A., Nadler, L. M., and Boussiotis, V. A. (2001). Tob is a negative regulator of activation that is expressed in anergic and quiescent T cells. Nat. Immunol. 2, 1174–1182. Voss, A. K., Gruss, P., and Thomas, T. (2003). The guanine nucleotide exchange factor C3G is necessary for the formation of focal adhesions and vascular maturation. Development 130, 355–367. Voss, A. K., Krebs, D. L., and Thomas, T. (2006). C3G regulates the size of the cerebral cortex neural precursor population. EMBO J. 25, 3652–3663. Vossler, M. R., Yao, H., York, R. D., Pan, M. G., Rim, C. S., and Stork, P. J. (1997). cAMP activates MAP kinase and Elk‐1 through a B‐Raf‐ and Rap1‐dependent pathway. Cell 89, 73–82. Wang, H., Singh, S. R., Zheng, Z., Oh, S. W., Chen, X., Edwards, K., and Hou, S. X. (2006). Rap‐ GEF signaling controls stem cell anchoring to their niche through regulating DE‐cadherin‐ mediated cell adhesion in the Drosophila testis. Dev. Cell 10, 117–126. Wang, L., Liu, F., and Adamo, M. L. (2001). Cyclic AMP inhibits extracellular signal‐regulated kinase and phosphatidylinositol 3‐kinase/Akt pathways by inhibiting Rap1. J. Biol. Chem. 276, 37242–37249. Wardemann, H., Yurasov, S., Schaefer, A., Young, J. W., Meffre, E., and Nussenzweig, M. C. (2003). Predominant autoantibody production by early human B cell precursors. Science 301, 1374–1377. Whetton, A. D., and Graham, G. J. (1999). Homing and mobilization in the stem cell niche. Trends Cell Biol. 9, 233–238. Willimsky, G., and Blankenstein, T. (2005). Sporadic immunogenic tumours avoid destruction by inducing T‐cell tolerance. Nature 437, 141–146. Wilson, A., Murphy, M. J., Oskarsson, T., Kaloulis, K., Bettess, M. D., Oser, G. M., Pasche, A. C., Knabenhans, C., Macdonald, H. R., and Trumpp, A. (2004). c‐Myc controls the balance between hematopoietic stem cell self‐renewal and differentiation. Genes Dev. 18, 2747–2763. Wittchen, E. S., van Buul, J. D., Burridge, K., and Worthylake, R. A. (2005). Trading spaces: Rap, Rac, and Rho as architects of transendothelial migration. Curr. Opin. Hematol. 12, 14–21. Wong, S., and Witte, O. N. (2004). The BCR‐ABL story: Bench to bedside and back. Annu. Rev. Immunol. 22, 247–306. Xiong, J. P., Stehle, T., Diefenbach, B., Zhang, R., Dunker, R., Scott, D. L., Joachimiak, A., Goodman, S. L., and Arnaout, M. A. (2001). Crystal structure of the extracellular segment of integrin alpha Vbeta3. Science 294, 339–345. Yajnik, V., Paulding, C., Sordella, R., McClatchey, A. I., Saito, M., Wahrer, D. C., Reynolds, P., Bell, D. W., Lake, R., van den Heuvel, S., Settleman, J., and Haber, D. A. (2003). DOCK4, a GTPase activator, is disrupted during tumorigenesis. Cell 112, 673–684. Yamasaki, S., Ishikawa, E., Sakuma, M., Ogata, K., Sakata‐Sogawa, K., Hiroshima, M., Wiest, D. L., Tokunaga, M., and Saito, T. (2006). Mechanistic basis of pre‐T cell receptor‐mediated autonomous signaling critical for thymocyte development. Nat. Immunol. 7, 67–75.
264
N A G A H I R O M I N AT O E T A L .
Yamashita, Y. M., Jones, D. L., and Fuller, M. T. (2003). Orientation of asymmetric stem cell division by the APC tumor suppressor and centrosome. Science 301, 1547–1550. Yilmaz, O. H., Valdez, R., Theisen, B. K., Guo, W., Ferguson, D. O., Wu, H., and Morrison, S. J. (2006). Pten dependence distinguishes haematopoietic stem cells from leukaemia‐initiating cells. Nature 441, 475–482. York, R. D., Yao, H., Dillon, T., Ellig, C. L., Eckert, S. P., McCleskey, E. W., and Stork, P. J. (1998). Rap1 mediates sustained MAP kinase activation induced by nerve growth factor. Nature 392, 622–626. Yuan, Y., Shen, H., Franklin, D. S., Scadden, D. T., and Cheng, T. (2004). In vivo self‐renewing divisions of haematopoietic stem cells are increased in the absence of the early G1‐phase inhibitor, p18INK4C. Nat. Cell Biol. 6, 436–442. Zhang, J., Niu, C., Ye, L., Huang, H., He, X., Tong, W. G., Ross, J., Haug, J., Johnson, T., Feng, J. Q., Harris, S., Wiedemann, L. M., et al. (2003). Identification of the haematopoietic stem cell niche and control of the niche size. Nature 425, 836–841. Zhang, J., Grindley, J. C., Yin, T., Jayasinghe, S., He, X. C., Ross, J. T., Haug, J. S., Rupp, D., Porter‐Westpfahl, K. S., Wiedemann, L. M., Wu, H., and Li, L. (2006a). PTEN maintains haematopoietic stem cells and acts in lineage choice and leukaemia prevention. Nature 441, 518–522. Zhang, Z., Mitra, R. S., Henson, B. S., Datta, N. S., McCauley, L. K., Kumar, P., Lee, J. S., Carey, T. E., and D’Silva, N. J. (2006b). Rap1GAP inhibits tumor growth in oropharyngeal squamous cell carcinoma. Am. J. Pathol. 168, 585–596. Zhu, J. J., Qin, Y., Zhao, M., Van Aelst, L., and Malinow, R. (2002). Ras and Rap control AMPA receptor trafficking during synaptic plasticity. Cell 110, 443–455.
Lung Dendritic Cell Migration Hamida Hammad and Bart N. Lambrecht Department of Pulmonary Medicine, Erasmus Medical Center, Dr Molewaterplein 50, 3015 GE Rotterdam, The Netherlands
1. 2. 3. 4. 5. 6.
Abstract............................................................................................................. Introduction ....................................................................................................... Airway DC Subsets: Localization and Phenotype....................................................... Recruitment of DCs to the Lung............................................................................ Migration of Airway DCs to the LNs ...................................................................... Recruitment of pDCs to the Sites of Inflammation .................................................... Conclusions........................................................................................................ References .........................................................................................................
265 265 266 267 269 272 272 273
Abstract Dendritic cells (DCs) are crucial in regulating the immune response by bridging innate and adaptive immunity. DCs are constantly migrating from the blood to the lungs and from the lungs to the draining lymph nodes. How DCs populate the lung in the absence of inflammation and how they are recruited there during inflammation remain unclear. Since DCs play a central role in immune responses, both under steady‐state and inflammatory conditions, detailed characterization of their migratory behavior may be essential for the development of future therapeutic strategies. 1. Introduction Numerous environmental pathogens, particulate matter, allergens, and harmless antigens are present in the air we breathe. Although most of these particles will be held up in the upper airways, the lung is one of the most challenged organs of the body. The usual functional outcome of harmless antigen encounter in the lung is ignorance or tolerance. Yet, when faced with pathogens, the immune defense mechanisms of the lung can generate a protective immune response. Many cells of the innate and adaptive immune system play an important role in the induction of inhalation tolerance or immunity. Dendritic cells (DCs) are crucial in regulating the immune response by bridging innate and adaptive immunity. At least two subsets of DCs have been described in both human and mice, namely myeloid and plasmacytoid DCs (pDCs). Whereas mDCs are the classical T cell priming subset (Lambrecht et al., 2000), the function of pDCs is less clear, although they might play an important role in the maintenance of tolerance to inhaled antigens (de Heer et al., 2005).
265 advances in immunology, vol. 93 # 2007 Elsevier Inc. All rights reserved.
0065-2776/07 $35.00 DOI: 10.1016/S0065-2776(06)93007-7
266
HAMIDA HAMMAD AND BART N. LAMBRECHT
In the airways, DCs are strategically located to sample inhaled antigens and exist in an immature form, efficient at taking up and processing antigens (Mellman and Steinman, 2001). Once activated by ‘‘danger’’ signals, such as contact with microbial products or proinflammatory cytokines, DCs undergo maturation into competent antigen‐presenting cells, expressing high levels of MHCII and costimulatory molecules (Banchereau and Steinman, 1998). An important question for the understanding of airway DC biology is how DCs populate the lung in the absence of inflammation, and how they are recruited there during inflammation. It is known that myeloid DCs enter the bloodstream from bone marrow and circulate as precursor/immature DC (Nikolic et al., 2003). Under inflammatory conditions, adhesion molecules at the surface of endothelial cells as well as chemokines are upregulated, facilitating efficient recruitment of circulating DC to the inflamed site (Robert et al., 1999). On maturation, DCs reprogram their repertoire of chemokine receptors (Sallusto et al., 1999; Sozzani et al., 1999) and migrate to lymph nodes (LNs), where they will activate naive T cells (Steinman, 1991). The migratory pathways of pDC are less well understood. pDCs circulate in peripheral blood in precursor form and represent a significant population in most secondary lymphoid organs (Asselin‐Paturel et al., 2001, 2003; Colonna et al., 2002). Since DCs play a central role in immune responses, both under steady‐state and inflammatory conditions, detailed characterization of their migratory properties may be essential for the development of future therapeutic strategies. Here, we discuss the different mechanisms used in the migration of airway DCs. 2. Airway DC Subsets: Localization and Phenotype Immature DCs are distributed throughout the lung and are at the focal control point determining the induction of pulmonary immunity or tolerance (Akbari et al., 2001, 2002; Lambrecht and Hammad, 2003). Airway DCs form a dense network in the lung ideally placed to sample inhaled antigens, and these cells migrate to draining mediastinal LNs to stimulate naive T cells (Lambrecht et al., 1998; Vermaelen et al., 2001). Several populations of DCs can be found in every compartment, including the conducting airways, lung parenchyma, alveolar space, visceral pleura, and the pulmonary vascular bed (Gong et al., 1992; Holt et al., 1994; Pollard and Lipscomb, 1990; Sertl et al., 1986; Suda et al., 1998). However, the different subsets of lung DCs are differentially distributed. In the conducting airways, CD11chigh DCs form a dense network underneath and within the epithelium with dendrite projections toward the lumen to
L U N G D E N D R I T I C C E L L M I G R AT I O N
267
sample for environmental antigens. In mice and rats, these cells are mainly of the myeloid origin and show a high turnover of about 2–3 days under steady‐ state conditions (Holt et al., 1994; Lambrecht et al., 1998). DCs in the lung interstitium are predominantly CD11cþ myeloid and are immature as assessed by the low expression of the costimulatory molecules CD40, CD80, CD86 (de Heer et al., 2005; Huh et al., 2003; Stumbles et al., 1998; van Rijt et al., 2005; Vermaelen and Pauwels, 2003) and by the high expression of several receptors for inflammatory chemokines and endocytic receptors (Cochand et al., 1999). We and others have been able to identify a population of pDCs in enzymatic lung digests of mice and humans, respectively (Demedts et al., 2005). The anatomical location of human pDCs in the lung has not yet been characterized. In the mouse, pDCs have been identified in the interalveolar interstitium of the lung (De Heer et al., 2004) and within the alveolar lavage fluid of mice with allergy (unpublished observations). 3. Recruitment of DCs to the Lung DCs are often referred to as ‘‘sentinels’’ of the immune system. The role of DCs is the continuous surveillance of peripheral sites highly exposed to antigens, such as the lung. In the absence of inflammatory signals, DCs and their precursors are recruited from the bloodstream into the lung where they have a very rapid turnover of about 2–3 days compared to skin DCs (Holt et al., 1994). In the presence of inflammatory signals, DCs can be recruited very rapidly to the lungs as a response to the increased requirement for surveillance at the local site. McWilliams et al. (1994) showed that the earliest detectable cellular response after inhalation of bacteria by naive mice is the recruitment of MHCIIþ DC precursors into the airway epithelium. Because the wave of DCs arrives in the airways before the neutrophils and other mononuclear cells, DCs contribute to the very early phase of the immune responses in the airways. DCs are also found in increased numbers in the lung during secondary immune responses. Indeed, the number of airway CD11cþ CD11bþ myeloid DCs is strongly increased within the airway epithelium following allergen challenge in sensitized animals (van Rijt et al., 2005). This increase in the number of airway DCs is accompanied with an increase in CD11c– CD11bþ MHCIIþ monocytes that could be recruited to the airways and probably further differentiate to DCs (van Rijt et al., 2002). Like for other leukocytes, the recruitment of DCs and their precursors from the bloodstream to peripheral tissues first involves a cascade of cellular interactions between the circulating cells and the endothelium (Springer, 1994) Molecules such as E‐ and P‐selectin, VCAM‐1, and L‐selectin ligands can mediate leukocyte tethering and rolling (Carlos and Harlan, 1994) and are
268
HAMIDA HAMMAD AND BART N. LAMBRECHT
upregulated on endothelial cells on inflammation. However, whereas these molecules have been extensively described in the transendothelial migration of skin DCs, their involvement in the recruitment of precursors or DCs to the lung has never been proven. Once in the lung, chemokine expression within tissue may direct DC localization after extravasation. Chemokine concentration gradients elicit a directed movement called chemotaxis. In vitro studies show that many cells in the lung produce many chemokines known to have an effect on DCs (Godiska et al., 1997; Gonzalo et al., 2000; Hieshima et al., 1997; Schall, 1997; Thorley et al., 2005). However, only a few have been studied in detail with respect to pulmonary DCs. In vivo, different chemokines orchestrate the recruitment of DCs into the lung depending on the inflammatory stimulus present. Isolated lung DCs express several chemokine receptors, including CCR1, CCR2, CCR5, CXCR4, and CCR6 (Chiu et al., 2004; Power et al., 1997). In a mouse model of infection with Mycobacterium tuberculosis, it was shown that the recruitment of DCs and T cells to the lungs of CCR2/ mice was reduced compared to wild‐type animals, and resulted in the premature death of the animals (Peters et al., 2001, 2004). One crucial receptor in the recruitment of DCs to the lung is CCR6. CCR6 is the receptor for MIP‐3a or CCL20, a chemokine abundantly released by bronchial epithelial cells and primary alveolar type 2 cells (Reibman et al., 2003; Starner et al., 2003). Pichavant et al. (2005) have shown that bronchial epithelial cells of asthmatic patients stimulated with the house dust mite allergen Der p 1 showed an increased production of CCL20. CCR6 involvement in the recruitment of DCs to the lung has been shown using CCR6/ mice in which the accumulation of DCs in the airways was impaired (Osterholzer et al., 2005). Interestingly, several features of asthma, a disease mediated by airway DCs (our references), were reduced in mice lacking CCR6 expression (Lukacs et al., 2001; Lundy et al., 2005). DC and monocyte chemokine‐like protein (DMC), a new chemokine constitutively expressed in the lung has been characterized (Pisabarro et al., 2006). This chemokine specifically attracts monocytes and DCs in vitro; however, whether it has the same role in vivo remains to be elucidated. In addition to chemokines, the airway epithelium can attract DCs by means of defensins, cationic peptides with bactericidal activity engaging CCR6 on immature DCs (Cole and Waring, 2002; Yang et al., 1999). In this way, defensins may promote adaptive immune responses by recruiting DCs to the site of microbial invasion. Besides chemokines, other molecules can also favor the migration of DCs into the lungs. During inflammation, matrix metalloproteinase (MMP)‐9/ mice have been shown to have an impaired recruitment
L U N G D E N D R I T I C C E L L M I G R AT I O N
269
of DCs into the airways, whereas the migration of DCs to the draining LNs was unaffected (Vermaelen et al., 2003). In summary, DCs are recruited to the lungs via different mechanisms, and it seems very likely that these chemotactic agents may act sequentially to attract recently transmigrated DC, and position them at the inflamed site. One unclear point remains, however, whether lung DCs are recruited from the blood in a differentiated form or as early precursors. It is possible that DC precursors, possibly monocytes, could first be attracted from the bloodstream into the lung and subsequently differentiate into DCs (van Rijt et al., 2005). 4. Migration of Airway DCs to the LNs 4.1. Migration of DCs Under Steady‐State Conditions DCs constantly migrate from peripheral tissues to the draining LNs. It has been proposed that under steady‐state conditions, mDCs continuously migrate to draining LNs and present either (self)‐auto antigens or harmless antigen in a tolerogenic form (Steinman and Nussenzweig, 2002). Airway DCs extend long dendrites to the lumen of the airways, forming bud‐like extensions at the border of the air interface (Brokaw et al., 1998). Most of our knowledge on how DCs migrate from the lung to the mediastinal draining lymph nodes (MLNs) involves the intratracheal inoculation of fluorescently labeled antigen. Within a few hours after inhalation of FITC‐labeled ovalbumin (OVA), airway myeloid DCs and plasmacytoid DCs loaded with fluorescently labeled antigen could be detected within the draining mediastinal LNs (De Heer et al., 2004; Hammad et al., 2003; Vermaelen et al., 2001). After 24 h, both mDCs and pDCs in the mediastinal LNs contain antigen inside vesicles of the cytoplasm. What is unclear at present is whether pDCs take up antigen in the periphery of the lung and subsequently migrate to the nodes, or whether antigen is being transported to them by migratory mDCs. The phenotype of antigen‐ transporting DCs is still uncertain since Holt’s group showed that these cells were expressing low levels of CD8a (Wikstrom et al., 2006), whereas Belz et al. (2004a,b) have found that Ag‐loaded DCs were CD8a CD11b. Transport of antigenic material from one nonmigratory DC to another is certainly a possibility, as we and others saw that CD8aþ DCs injected into the lung or skin induce an immune response in the draining node without migrating into it (Hammad et al., 2004; Smith and Fazekas De St Groth, 1999). In another system, we also found that the intratracheal administration of bone marrow‐derived DCs results in the accumulation of the transferred cells in the MLNs of the mice (Havenith et al., 1993; Lambrecht et al., 2000). The mechanisms involved in the steady‐state migration of airway DCs to the MLNs
270
HAMIDA HAMMAD AND BART N. LAMBRECHT
are unclear. It has been suggested that semimature DCs, which are immature DCs with an intermediate phenotype, might use CCR7 to continuously migrate to the LNs in the absence of inflammatory signals (Ohl et al., 2004; Sanchez‐Sanchez et al., 2006); however, these studies have been performed on skin DCs. It is not clear whether this would also happen in the lung as some studies have reported the absence of functional CCR7 expression by DCs at mucosal surfaces (Kobayashi et al., 2004). 4.2. Migration of DCs Under Inflammatory Conditions The presence of ‘‘danger’’ signals in organs exposed to antigens is a strong stimulus for the migration of antigen‐bearing DCs toward LNs. In a mouse model of allergic inflammation, ongoing airway inflammation was shown to cause a massive and accelerated flux of allergen‐loaded DCs from the airway mucosa to the MLNs (Huh et al., 2003; Vermaelen and Pauwels, 2003). The same observations were made after the intranasal administration of influenza virus (Legge and Braciale, 2003). The mechanisms behind this increased migration to the LNs are unknown, but some likely mechanisms are described in Section 4.2.1 to 4.2.5. 4.2.1. Involvement of Chemokine Receptors The most important factor driving DC migration from peripheral tissues to the T cell area of LNs under inflammatory conditions is CCR7 (Saeki et al., 1999). Although the involvement of CCR7 is well documented in skin DC migration, very little is known regarding the involvement of this molecule in the trafficking of lung DCs. CCR7 has been described on a subset of lung DCs (Swanson et al., 2004) and is regulated by the transcription factor RunX3 (Fainaru et al., 2005). In RunX3‐deficient animals, CCR7 expression was upregulated and the migration of DCs to the MLNs was increased (Fainaru et al., 2005). We have previously shown that in vivo neutralization of CCL21 could prevent human DC migration to MLNs of humanized severe combined immunodeficient (SCID) mice and the subsequent development of asthma features (Hammad et al., 2002). Moreover, the intranasal injection of latex beads into mice led to a CCR7‐dependent accumulation of DCs in the MLNs (Jakubzick et al., 2006). Interestingly, this phenomenon was not only CCR7‐dependent but also involved another chemokine receptor, namely CCR8. The authors have demonstrated that CCR8‐deficient mice manifested a decreased accumulation of beadþ DCs to MLNs, reminiscent of the reduced emigration of DCs from skin (Qu et al., 2004), suggesting that lung and skin DCs use similar mechanisms for their migration to the LNs.
L U N G D E N D R I T I C C E L L M I G R AT I O N
271
4.2.2. Involvement of Cysteiny l Leukotrienes In addition to chemokines, lipid metabolites such as leukotrienes and prostaglandins are emerging as important upstream controllers of DC migration toward LNs. Cysteinyl leukotriens are important inflammatory mediators in asthma (Busse, 1998) and can affect DC functions (Okunishi et al., 2004). Molecules like LTC4 and its transporter, multidrug resistance‐related protein 1 (MRP1, also called ABCC1) participate in DC migration from skin to LNs because they contribute to the sensitization of CCR7 to its ligands (Hopken and Lipp, 2004; Robbiani et al., 2000). However, it appears that LTC4 is not needed for lung DCs accumulation in the MLNs (Jakubzick et al., 2006), most likely because in the lung other lipid mediators might be able to take over the function of LTC4. Future studies will be required to address this possibility, as additional mediators of DC migration from lung to MLNs are described. 4.2.3. Involvement of Prostaglandins Several studies have implicated PGE2 in the chemotactic response of DCs to CCR7 ligands, the latter response being dependent on the EP4 receptor (Bertho et al., 2005; Kabashima et al., 2003; Luft et al., 2002; Scandella et al., 2004). In contrast, PGD2 exerts an opposite effect: we showed that PGD2, through the ligation of DP1, one of its two receptors, could inhibit the emigration of airway DCs toward MLNs and consequently prevent the induction of a primary immune response and of eosinophilic airway inflammation (Hammad et al. (2003); our unpublished observations). More recently, we have looked at the role of PGI2 on DC migration to the MLNs, and showed that a stable analogue of PGI2, Iloprost, could inhibit the migration of lung DCs to the MLNs, thereby abolishing the induction of an allergen specific Th2 response in these nodes (Idzko, 2007). The same effect was obtained with pharmacological agonists of the peroxisome proliferator‐activated receptor‐g (PPAR‐g), an important intracellular mediator of prostaglandin signaling (Angeli et al., 2003). 4.2.4. Involvement of Sphingosine‐1‐Phosphate Sphingosine‐1‐phosphate (S1P) is predominantly generated by stimulated platelets and leukocytes. In immune cells, S1P can modulate many different functions including migration, cytokine, and chemokine release (Graeler and Goetzl, 2002; Spiegel and Milstien, 2003). We have recently shown that the inhalation of FTY720, a structural homologue of S1P, reduced the number of migrating mDCs in MLNs of naive and allergen challenged mice and reduced asthma features (Idzko et al., 2006).
272
HAMIDA HAMMAD AND BART N. LAMBRECHT
4.2.5. Involvement of CD38 Generation of cyclic adensine diphosphate ribose from NADþ by the action of CD38 initiates calcium mobilization that is required for chemotaxis of DCs to a variety of chemokines, including CCR7 ligands (Partida‐Sanchez et al., 2004). CD38 has been shown to regulate the migration of DC precursors from the blood to peripheral sites and to control the migration of mature DCs from inflamed skin to LNs (Partida‐Sanchez et al., 2004). We also have evidence that CD38 is used by lung DCs to migrate to the MLNs. The intratracheal administration of the cADPR antagonist 8‐Br‐cADPR, which renders DCs unable to flux Ca2þ in response to chemokine stimulation, strongly decreased the number of migrating lung DCs to the MLNs (Hammad H., unpublished observations). Since the extracellular NADþ levels have been shown to rise significantly in serum and at local sites of tissue damage due to release of NADþ from necrotic cells (Okamoto et al., 1998), extracellular NADþ could be thought of as an inflammatory modulator, similar to other extracellular nucleotides such as adenosine (Ohta and Sitkovsky, 2001) and ATP (Di Virgilio et al., 2001), and compounds that alter NADþ levels or CD38 enzyme activity could potentially be used to block DC‐ mediated inflammation by altering their migration to the MLNs and the subsequent T cell activation. 5. Recruitment of pDCs to the Sites of Inflammation pDCs can be recruited to nonlymphoid organs in inflammatory conditions. Indeed, for instance, the number of pDCs was increased in the nasal mucosal of patients suffering from allergic rhinitis (Jahnsen et al., 2000). We have also found an increased number of pDCs in the lung and in the bronchoalveolar lavage of asthmatic mice (M. Kool, unpublished observations). In nasal allergy and in asthma, there is an increased expression of PNAd, ICAM‐1, and VCAM on the vessels of affected tissues. Interactions with these adhesion molecules are likely to be involved in DC migration into this site, as circulating pDCs express the appropriate ligands, namely CD62L, b2, and a4 integrins, respectively (Cella et al., 1999; Olweus et al., 1997). Moreover, pDCs express CXCR3, the receptor for CXCL10, which is upregulated under inflammatory conditions in the lung (Medoff et al., 2002). 6. Conclusions DCs play a central role in the induction of immune responses against foreign antigens, but DCs are also involved in the maintenance of inflammation and tolerance in the periphery. A critical factor for the DC role in both immunity and tolerance may be their migratory capacity. As inflammation induces DC
L U N G D E N D R I T I C C E L L M I G R AT I O N
273
maturation and migration, DCs reach the LNs fully activated so that T cell priming can occur. In the absence of inflammation, smaller numbers of DC migrate to LNs carrying self‐antigens, and therefore might induce T cell tolerance. Although a lot is known about DC migration in the skin, many open questions still remain especially regarding lung DCs. For example, DC migrate to many different peripheral tissues; however, little is known about the specific molecular mechanisms involved. Moreover, the constant migration of DC from various tissues such as the lung to LNs may be important for tolerance induction. Understanding the mechanisms by which this occurs, and the exact subset of DC that migrates, may be critical for the design of future therapeutic strategies. References Akbari, O., DeKruyff, R. H., and Umetsu, D. T. (2001). Pulmonary dendritic cells producing IL‐10 mediate tolerance induced by respiratory exposure to antigen. Nat. Immunol. 2, 725–731. Akbari, O., Freeman, G. J., Meyer, E. H., Greenfield, E. A., Chang, T. T., Sharpe, A. H., Berry, G., DeKruyff, R. H., and Umetsu, D. T. (2002). Antigen‐specific regulatory T cells develop via the ICOS‐ICOS‐ligand pathway and inhibit allergen‐induced airway hyperreactivity. Nat. Med. 8, 1024–1032. Angeli, V., Hammad, H., Staels, B., Capron, M., Lambrecht, B. N., and Trottein, F. (2003). Peroxisome proliferator‐activated receptor gamma inhibits the migration of dendritic cells: Consequences for the immune response. J. Immunol. 170, 5295–5301. Asselin‐Paturel, C., Boonstra, A., Dalod, M., Durand, I., Yessaad, N., Dezutter‐Dambuyant, C., Vicari, A., O’Garra, A., Biron, C., Briere, F., and Trinchieri, G. (2001). Mouse type I IFN‐ producing cells are immature APCs with plasmacytoid morphology. Nat. Immunol. 2, 1144–1150. Asselin‐Paturel, C., Brizard, G., Pin, J. J., Briere, F., and Trinchieri, G. (2003). Mouse strain differences in plasmacytoid dendritic cell frequency and function revealed by a novel monoclonal antibody. J. Immunol. 171, 6466–6477. Banchereau, J., and Steinman, R. M. (1998). Dendritic cells and the control of immunity. Nature 392, 245–252. Belz, G. T., Smith, C. M., Eichner, D., Shortman, K., Karupiah, G., Carbone, F. R., and Heath, W. R. (2004a). Cutting edge: Conventional CD8 alphaþ dendritic cells are generally involved in priming CTL immunity to viruses. J. Immunol. 172, 1996–2000. Belz, G. T., Smith, C. M., Kleinert, L., Reading, P., Brooks, A., Shortman, K., Carbone, F. R., and Heath, W. R. (2004b). Distinct migrating and nonmigrating dendritic cell populations are involved in MHC class I‐restricted antigen presentation after lung infection with virus. Proc. Natl. Acad. Sci. USA 101, 8670–8675. Bertho, N., Adamski, H., Toujas, L., Debove, M., Davoust, J., and Quillien, V. (2005). Efficient migration of dendritic cells toward lymph node chemokines and induction of T(H)1 responses require maturation stimulus and apoptotic cell interaction. Blood 106, 1734–1741. Brokaw, J. J., White, G. W., Baluk, P., Anderson, G. P., Umemoto, E. Y., and McDonald, D. M. (1998). Glucocorticoid‐induced apoptosis of dendritic cells in the rat tracheal mucosa. Am. J. Respir. Cell Mol. Biol. 19, 598–605. Busse, W. W. (1998). Leukotrienes and inflammation. Am. J. Respir. Crit. Care Med. 157, S210–S213; discussion S247–S218.
274
HAMIDA HAMMAD AND BART N. LAMBRECHT
Carlos, T. M., and Harlan, J. M. (1994). Leukocyte‐endothelial adhesion molecules. Blood 84, 2068–2101. Cella, M., Jarrossay, D., Facchetti, F., Alebardi, O., Nakajima, H, Lanzavecchia, A., and Colonna, M. (1999). Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon. Nat. Med. 5, 919–923. Chiu, B. C., Freeman, C. M., Stolberg, V. R., Hu, J. S., Zeibecoglou, K., Lu, B., Gerard, C., Charo, I. F., Lira, S. A., and Chensue, S. W. (2004). Impaired lung dendritic cell activation in CCR2 knockout mice. Am. J. Pathol. 165, 1199–1209. Cochand, L., Isler, P., Songeon, F., and Nicod, L. P. (1999). Human lung dendritic cells have an immature phenotype with efficient mannose receptors. Am. J. Respir. Cell Mol. Biol. 21, 547–554. Cole, A. M., and Waring, A. J. (2002). The role of defensins in lung biology and therapy. Am. J. Respir. Med. 1, 249–259. Colonna, M., Krug, A., and Cella, M. (2002). Interferon‐producing cells: On the front line in immune responses against pathogens. Curr. Opin. Immunol. 14, 373–379. De Heer, H. J., Hammad, H., Soullie, T., Hijdra, D., Vos, N., Willart, M. A., Hoogsteden, H. C., and Lambrecht, B. N. (2004). Essential role of lung plasmacytoid dendritic cells in preventing asthmatic reactions to harmless inhaled antigen. J. Exp. Med. 200, 89–98. De Heer, H. J., Hammad, H., Kool, M., and Lambrecht, B. N. (2005). Dendritic cell subsets and immune regulation in the lung. Semin. Immunol. 17, 295–303. Demedts, I. K., Brusselle, G. G., Vermaelen, K. Y., and Pauwels, R. A. (2005). Identification and characterization of human pulmonary dendritic cells. Am. J. Respir. Cell Mol. Biol. 32, 177–184. Di Virgilio, F., Chiozzi, P., Ferrari, D., Falzoni, S., Sanz, J. M., Morelli, A, Torboli, M., Bolognesi, G., and Baricordi, O. R. (2001). Nucleotide receptors: An emerging family of regulatory molecules in blood cells. Blood 97, 587–600. Fainaru, O., Shseyov, D., Hantisteanu, S., and Groner, Y. (2005). Accelerated chemokine receptor 7‐mediated dendritic cell migration in Runx3 knockout mice and the spontaneous development of asthma‐like disease. Proc. Natl. Acad. Sci. USA 102, 10598–10603. Godiska, R., Chantry, D., Raport, C. J., Schweickart, V. L., Trong, H. L., and Gray, P. W. (1997). Monocyte chemotactic protein‐4: Tissue‐specific expression and signaling through CC chemokine receptor‐2. J. Leukoc. Biol. 61, 353–360. Gong, J. L., Mc Carthy, K. M., Telford, J., Tamatani, T., Miyasaka, M., and Schneeberger, E. (1992). Intraepithelial airway dendritic cells: A distinct subset of pulmonary dendritic cells obtained by microdissection. J. Exp. Med. 175, 797–807. Gonzalo, J. A., Lloyd, C. M., Peled, A., Delaney, T., Coyle, A. J., and Gutierrez‐Ramos, J. C. (2000). Critical involvement of the chemotactic axis CXCR4/stromal cell‐derived factor‐1 alpha in the inflammatory component of allergic airway disease. J. Immunol. 165, 499–508. Graeler, M., and Goetzl, E. J. (2002). Activation‐regulated expression and chemotactic function of sphingosine 1‐phosphate receptors in mouse splenic T cells. FASEB J. 16, 1874–1878. Hammad, H., Lambrecht, B. N., Pochard, P., Gosset, P., Marquillies, P., Tonnel, A. B., and Pestel, J. (2002). Monocyte‐derived dendritic cells induce a house dust mite‐specific Th2 allergic inflammation in the lung of humanized SCID mice: Involvement of CCR7. J. Immunol. 169, 1524–1534. Hammad, H., de Heer, H. J., Souillie, T., Hoogsteden, H. C., Trottein, F., and Lambrecht, B. N. (2003). Prostaglandin D2 modifies airway dendritic cell migration and function in steady state conditions by selective activation of the DP‐receptor. J. Immunol. 171, 3936–3940. Hammad, H., de Vries, V. C., Maldonado‐Lopez, R., Moser, M., Maliszewski, C., Hoogsteden, H. C., and Lambrecht, B. N. (2004). Differential capacity of CD8 þ alpha or CD8‐ alpha dendritic cell subsets to prime for eosinophilic airway inflammation in the T‐helper type 2‐prone milieu of the lung. Clin. Exp. Allergy 34, 1834–1840.
L U N G D E N D R I T I C C E L L M I G R AT I O N
275
Havenith, C. E. G., Van Miert, P. P. M. C., Breedijk, A. J., Beelen, R. H. J., and Hoefsmit, E. C. M. (1993). Migration of dendritic cells into the draining lymph nodes of the lung after intratracheal instillation. Am. J. Respir. Cell Mol. Biol. 9, 484–488. Hieshima, K., Imai, T., Baba, M., Shoudai, K., Ishizuka, K., Nakagawa, T., Tsuruta, J., Takeya, M., Sakaki, Y., Takatsuki, K., Miura, R., Opdenakker, G., et al. (1997). A novel human CC chemokine PARC that is most homologous to macrophage‐inflammatory protein‐1 alpha/LD78 alpha and chemotactic for T lymphocytes, but not for monocytes. J. Immunol. 159, 1140–1149. Holt, P. G., Haining, S., Nelson, D. J., and Sedgwick, J. D. (1994). Origin and steady‐state turnover of class II MHC‐bearing dendritic cells in the epithelium of the conducting airways. J. Immunol. 153, 256–261. Hopken, U. E., and Lipp, M. (2004). All roads lead to Rome: Triggering dendritic cell migration. Immunity 20, 244–246. Huh, J. C., Strickland, D. H., Jahnsen, F. L., Turner, D. J., Thomas, J. A., Napoli, S., Tobagus, I., Stumbles, P. A., Sly, P. D., and Holt, P. G. (2003). Bidirectional interactions between antigen‐ bearing respiratory tract dendritic cells (DCs) and T cells precede the late phase reaction in experimental Asthma: DC activation occurs in the airway mucosa but not in the lung parenchyma. J. Exp. Med. 198, 19–30. Idzko, M., Hammad, H., van Nimwegen, M., Kool, M., Muller, T., Soullie´, T., Willart, A. M., Hijdra, D., Hoogsteden, H. C., and Lambrecht, B. N. (2006). Local application of FTY720 to the lung abrogates experimental asthma by altering dendritic cell function. J. Clin. Invest. 116, 2935–2944. Idzko, M., Hammad, H., van Nimwegen, M., Kool, M., Hoogsteden, H. C., and Lambrecht, B. N. (2007). Inhaled iloprost suppresses the cardinal features of asthma via inhibition of airway dendritic cell function. J. Clin. Invest. (in press). Jahnsen, F. L., Lund‐Johansen, F., Dunne, J. F., Farkas, L., Haye, R., and Brandtzaeg, P. (2000). Experimentally induced recruitment of plasmacytoid (CD123high) dendritic cells in human nasal allergy. J. Immunol. 165, 4062–4068. Jakubzick, C., Tacke, F., Llodra, J., van Rooijen, N., and Randolph, G. J. (2006). Modulation of dendritic cell trafficking to and from the airways. J. Immunol. 176, 3578–3584. Kabashima, K., Sakata, D., Nagamachi, M., Miyachi, Y., Inaba, K., and Narumiya, S. (2003). Prostaglandin E2‐EP4 signaling initiates skin immune responses by promoting migration and maturation of Langerhans cells. Nat. Med. 9, 744–749. Kobayashi, H., Miura, S., Nagata, H., Tsuzuki, Y., Hokari, R., Ogino, T., Watanabe, C., Azuma, T., and Ishii, H. (2004). In situ demonstration of dendritic cell migration from rat intestine to mesenteric lymph nodes: Relationships to maturation and role of chemokines. J. Leukoc. Biol. 75, 434–442. Lambrecht, B. N., and Hammad, H. (2003). Taking our breath away: Dendritic cells in the pathogenesis of asthma. Nat. Rev. Immunol. 3, 994–1003. Lambrecht, B. N., Salomon, B., Klatzmann, D., and Pauwels, R. A. (1998). Dendritic cells are required for the development of chronic eosinophilic airway inflammation in response to inhaled antigen in sensitized mice. J. Immunol. 160, 4090–4097. Lambrecht, B. N., De Veerman, M., Coyle, A. J., Gutierrez‐Ramos, J. C., Thielemans, K., and Pauwels, R. A. (2000). Myeloid dendritic cells induce Th2 responses to inhaled antigen, leading to eosinophilic airway inflammation. J. Clin. Invest. 106, 551–559. Legge, K. L., and Braciale, T. J. (2003). Accelerated migration of respiratory dendritic cells to the regional lymph nodes is limited to the early phase of pulmonary infection. Immunity 18, 265–277. Luft, T., Jefford, M., Luetjens, P., Toy, T., Hochrein, H., Masterman, K. A., Maliszewski, C., Shortman, K., Cebon, J., and Maraskovsky, E. (2002). Functionally distinct dendritic cell (DC)
276
HAMIDA HAMMAD AND BART N. LAMBRECHT
populations induced by physiologic stimuli: Prostaglandin E(2) regulates the migratory capacity of specific DC subsets. Blood 100, 1362–1372. Lukacs, N. W., Tekkanat, K. K., Berlin, A., Hogaboam, C. M., Miller, A., Evanoff, H., Lincoln, P., and Maassab, H. (2001). Respiratory syncytial virus predisposes mice to augmented allergic airway responses via IL‐13‐mediated mechanisms. J. Immunol. 167, 1060–1065. Lundy, S. K., Lira, S. A., Smit, J. J., Cook, D. N., Berlin, A. A., and Lukacs, N. W. (2005). Attenuation of allergen‐induced responses in CCR6‐/‐ mice is dependent upon altered pulmonary T lymphocyte activation. J. Immunol. 174, 2054–2060. McWilliam, A. S., Nelson, D. J., Thomas, J. A., and Holt, P. G. (1994). Rapid dendritic cell recruitment is a hallmark of the acute inflammatory response at mucosal surfaces. J. Exp. Med. 179, 1331–1336. Medoff, B. D., Sauty, A., Tager, A. M., Maclean, J. A., Smith, R. N., Mathew, A., Dufour, J. H., and Luster, A. D. (2002). IFN‐gamma‐inducible protein 10 (CXCL10) contributes to airway hyperreactivity and airway inflammation in a mouse model of asthma. J. Immunol. 168, 5278–5286. Mellman, I., and Steinman, R. M. (2001). Dendritic cells: Specialized and regulated antigen processing machines. Cell 106, 255–258. Nikolic, T., de Bruijn, M. F., Lutz, M. B., and Leenen, P. J. (2003). Developmental stages of myeloid dendritic cells in mouse bone marrow. Int. Immunol. 15, 515–524. Ohl, L., Mohaupt, M., Czeloth, N., Hintzen, G., Kiafard, Z., Zwirner, J., Blankenstein, T., Henning, G., and Forster, R. (2004). CCR7 governs skin dendritic cell migration under inflammatory and steady‐state conditions. Immunity 21, 279–288. Ohta, A., and Sitkovsky, M. (2001). Role of G‐protein‐coupled adenosine receptors in downregulation of inflammation and protection from tissue damage. Nature 414, 916–920. Okamoto, S., Azhipa, O., Yu, Y., Russo, E., and Dennert, G. (1998). Expression of ADP‐ribosyltransferase on normal T lymphocytes and effects of nicotinamide adenine dinucleotide on their function. J. Immunol. 160, 4190–4198. Okunishi, K., Dohi, M., Nakagome, K., Tanaka, R., and Yamamoto, K. (2004). A novel role of cysteinyl leukotrienes to promote dendritic cell activation in the antigen‐induced immune responses in the lung. J. Immunol. 173, 6393–6402. Olweus, J., BitMansour, A., Warnke, R., Thompson, P. A., Carballido, J., Picker, L. J., and Lund‐ Johansen, F. (1997). Dendritic cell ontogeny: A human dendritic cell lineage of myeloid origin. Proc. Natl. Acad. Sci. USA 94, 12551–12556. Osterholzer, J. J., Ames, T., Polak, T., Sonstein, J., Moore, B. B., Chensue, S. W., Toews, G. B., and Curtis, J. L. (2005). CCR2 and CCR6, but not endothelial selectins, mediate the accumulation of immature dendritic cells within the lungs of mice in response to particulate antigen. J. Immunol. 175, 874–883. Partida‐Sanchez, S., Goodrich, S., Kusser, K., Oppenheimer, N., Randall, T. D., and Lund, F. E. (2004). Regulation of dendritic cell trafficking by the ADP‐ribosyl cyclase CD38: Impact on the development of humoral immunity. Immunity 20, 279–291. Peters, W., Scott, H. M., Chambers, H. F., Flynn, J. L., Charo, I. F., and Ernst, J. D. (2001). Chemokine receptor 2 serves an early and essential role in resistance to Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. USA 98, 7958–7963. Peters, W., Cyster, J. G., Mack, M., Schlondorff, D., Wolf, A. J., Ernst, J. D., and Charo, I. F. (2004). CCR2‐dependent trafficking of F4/80dim macrophages and CD11cdim/intermediate dendritic cells is crucial for T cell recruitment to lungs infected with Mycobacterium tuberculosis. J. Immunol. 172, 7647–7653. Pichavant, M., Charbonnier, A. S., Taront, S., Brichet, A., Wallaert, B., Pestel, J., Tonnel, A. B., and Gosset, P. (2005). Asthmatic bronchial epithelium activated by the proteolytic allergen
L U N G D E N D R I T I C C E L L M I G R AT I O N
277
Der p 1 increases selective dendritic cell recruitment. J. Allergy Clin. Immunol. 115, 771–778. Pisabarro, M. T., Leung, B., Kwong, M., Corpuz, R., Frantz, G. D., Chiang, N., Vandlen, R., Diehl, L. J., Skelton, N., Kim, H. S., Eaton, D, and Schmidt, K. N. (2006). Cutting edge: Novel human dendritic cell‐ and monocyte‐attracting chemokine‐like protein identified by fold recognition methods. J. Immunol. 176, 2069–2073. Pollard, A. M., and Lipscomb, M. F. (1990). Characterisation of murine lung dendritic cells: Similarities to Langerhans cells and thymic dendritic cells. J. Exp. Med. 172, 159. Power, C. A., Church, D. J., Meyer, A., Alouani, S., Proudfoot, A. E. I., ClarkLewis, I., Sozzani, S., Mantovani, A., and Wells, T. N. C. (1997). Cloning and characterization of a specific receptor for the novel CC chemokine MIP‐3 alpha from lung dendritic cells. J. Exp. Med. 186, 825–835. Qu, C., Edwards, E. W., Tacke, F., Angeli, V., Llodra, J., Sanchez‐Schmitz, G., Garin, A., Haque, N. S., Peters, W., van Rooijen, N., Sanchez‐Torres, C., Bromberg, J., et al. (2004). Role of CCR8 and other chemokine pathways in the migration of monocyte‐derived dendritic cells to lymph nodes. J. Exp. Med. 200, 1231–1241. Reibman, J., Hsu, Y., Chen, L. C., Bleck, B., and Gordon, T. (2003). Airway epithelial cells release MIP‐3alpha/CCL20 in response to cytokines and ambient particulate matter. Am. J. Respir. Cell Mol. Biol. 28, 648–654. Robbiani, F., Finch, R. A., Jager, D., Muller, W. A., Sartorelli, A. C., and Randolph, G. J. (2000). The leukotriene C4 transporter MRP1 regulates CCL19 (MIP‐3b, ELC)‐dependent mobilization of dendritic cells to lymph nodes. Cell 103, 757–768. Robert, C., Fuhlbrigge, R. C., Kieffer, J. D., Ayehunie, S., Hynes, R. O., Cheng, G., Grabbe, S., von Andrian, U. H., and Kupper, T. S. (1999). Interaction of dendritic cells with skin endothelium: A new perspective on immunosurveillance. J. Exp. Med. 189, 627–636. Saeki, H., Moore, A. M., Brown, M. J., and Hwang, S. T. (1999). Cutting edge: Secondary lymphoid‐tissue chemokine (SLC) and CC chemokine receptor 7 (CCR7) participate in the emigration pathway of mature dendritic cells from the skin to regional lymph nodes. J. Immunol. 162, 2472–2475. Sallusto, F., Kremmer, E., Palermo, B., Hoy, A., Ponath, P., Qin, S., Forster, R., Lipp, M., and Lanzavecchia, A. (1999). Switch in chemokine receptor expression upon TCR stimulation reveals novel homing potential for recently activated T cells. Eur. J. Immunol. 29, 2037–2045. Sanchez‐Sanchez, N., Riol‐Blanco, L., and Rodriguez‐Fernandez, J. L. (2006). The multiple personalities of the chemokine receptor CCR7 in dendritic cells. J. Immunol. 176, 5153–5159. Scandella, E., Men, Y., Legler, D. F., Gillessen, S., Prikler, L., Ludewig, B., and Groettrup, M. (2004). CCL19/CCL21‐triggered signal transduction and migration of dendritic cells requires prostaglandin E2. Blood 103, 1595–1601. Schall, T. (1997). Fractalkine: A strange attractor in the chemokine landscape. Immunol. Today 18, 147. Sertl, K., Takemura, T., Tschachler, E., Ferrans, V. J., Kaliner, M. A., and Shevach, E. M. (1986). Dendritic cells with antigen‐presenting capability reside in airway epithelium, lung parenchyma, and visceral pleura. J. Exp. Med. 163, 436–451. Smith, A. L., and Fazekas De St Groth, B. (1999). Antigen‐pulsed CD8aþ dendritic cells generate an immune response after subcutaneous injection without homing to the draining lymph node. J. Exp. Med. 189, 593–598. Sozzani, S., Allavena, P., Vecchi, A., and Mantovani, A. (1999). The role of chemokines in the regulation of dendritic cell trafficking. J. Leukoc. Biol. 66, 1–9. Spiegel, S., and Milstien, S. (2003). Sphingosine‐1‐phosphate: An enigmatic signalling lipid. Nat. Rev. Mol. Cell Biol. 4, 397–407.
278
HAMIDA HAMMAD AND BART N. LAMBRECHT
Springer, T. A. (1994). Traffic signals for lymphocyte recirculation and leukocyte emigration: The multistep paradigm. Cell 76, 301–314. Starner, T. D., Barker, C. K., Jia, H. P., Kang, Y., and McCray, P. B., Jr. (2003). CCL20 is an inducible product of human airway epithelia with innate immune properties. Am. J. Respir. Cell Mol. Biol. 29, 627–633. Steinman, R. M. (1991). The dendritic cell system and its role in immunogenicity. Annu. Rev. Immunol. 9, 271–296. Steinman, R. M., and Nussenzweig, M. C. (2002). Avoiding horror autotoxicus: The importance of dendritic cells in peripheral T cell tolerance. Proc. Natl. Acad. Sci. USA 99, 351–358. Stumbles, P. A., Thomas, J. A., Pimm, C. L., Lee, P. T., Venaille, T. J., Proksch, S., and Holt, P. G. (1998). Resting respiratory tract dendritic cells preferentially stimulate T helper cell type 2 (Th2) responses and require obligatory cytokine signals for induction of Th1 immunity. J. Exp. Med. 188, 2019–2031. Suda, T., McCarthy, K., Vu, Q., McCormack, J., and Schneeberger, E. E. (1998). Dendritic cell precursors are enriched in the vascular compartment of the lung. Am. J. Respir. Cell Mol. Biol. 19, 728–737. Swanson, K. A., Zheng, Y., Heidler, K. M., Zhang, Z. D., Webb, T. J., and Wilkes, D. S. (2004). Flt3‐ ligand, IL‐4, GM‐CSF, and adherence‐mediated isolation of murine lung dendritic cells: Assessment of isolation technique on phenotype and function. J. Immunol. 173, 4875–4881. Thorley, A. J., Goldstraw, P., Young, A., and Tetley, T. D. (2005). Primary human alveolar type II epithelial cell CCL20 (macrophage inflammatory protein‐3alpha)‐induced dendritic cell migration. Am. J. Respir. Cell Mol. Biol. 32, 262–267. van Rijt, L. S., Prins, J. B., deVries, V. C., Leenen, P. J., Thielemans, K., Hoogsteden, H. C., and Lambrecht, B. N. (2002). Allergen‐induced accumulation of airway dendritic cells is supported by an increase in CD31hi Ly‐6Cneg hematopoietic precursors. Blood 100, 3663–3671. van Rijt, L. S., Jung, S., Kleinjan, A., Vos, N., Willart, M., Duez, C., Hoogsteden, H. C., and Lambrecht, B. N. (2005). In vivo depletion of lung CD11c þ dendritic cells during allergen challenge abrogates the characteristic features of asthma. J. Exp. Med. 201, 981–991. Vermaelen, K., and Pauwels, R. (2003). Accelerated airway dendritic cell maturation, trafficking, and elimination in a mouse model of asthma. Am. J. Respir. Cell Mol. Biol. 29, 405–409. Vermaelen, K. Y., Carro‐Muino, I., Lambrecht, B. N., and Pauwels, R. A. (2001). Specific migratory dendritic cells rapidly transport antigen from the airways to the thoracic lymph nodes. J. Exp. Med. 193, 51–60. Vermaelen, K. Y., Cataldo, D., Tournoy, K., Maes, T., Dhulst, A., Louis, R., Foidart, J. M., Noel, A., and Pauwels, R. (2003). Matrix metalloproteinase‐9‐mediated dendritic cell recruitment into the airways is a critical step in a mouse model of asthma. J. Immunol. 171, 1016–1022. Wikstrom, M. E., Batanero, E., Smith, M., Thomas, J. A., von Garnier, C., Holt, P. G., and Stumbles, P. A. (2006). Influence of mucosal adjuvants on antigen passage and CD4 þ T cell activation during the primary response to airborne allergen. J. Immunol. 177, 913–924. Yang, D., Chertov, O., Bykovskaia, S. N., Chen, Q., Buffo, M. J., Shogan, J., Anderson, M., Schroder, J. M., Wang, J. M., Howard, O. M., and Oppenheim, J. J. (1999). Beta‐defensins: Linking innate and adaptive immunity through dendritic and T cell CCR6. Science 286, 525–528.
INDEX
A A proliferation-inducing ligand (APRIL), 14–15, 32–33 A-T. See Ataxia-telangiectasia ABC. See Activated B cells Actin cytoskeleton, 134–135, 156–157, 194, 201–202, 208, 210–213, 215, 232 Actin regulating enabled (Ena), 207 Activated B cells (ABC), 2, 5–6, 13 Activation-induced deaminase (AID), 3 CD40 signaling, 25 expression, regulation in CSR AICDA gene, 13 B cell-specific enhancer, 12 NF-kB p50, 13 Pax5, 12–13 PKA, 13 Smad proteins, 13 Sp1, 12–13 Sp3, 12–13 STAT6, 13 in human and mouse, 25–26 IL-4, 25 intronic enhancer, 25 LPS, 25 NF-kB p50, 25 PKA phosphorylation sites, 25 S38, 25–26 STAT6, 25 T27, 25–26 Activator protein 1 (AP-1), 14, 152 transcription factor of, 128, 152 ADAP/SKAP-55 complex, 215 ADP ribosylation factor (ARF), 204 AF-6. See Afadin Afadin (AF-6), 236 AI domain, 187–188, 190–192 AICDA gene, 13, 25
AID. See Activation-induced deaminase Airway DC migration, to LN under inflammatory conditions CD38 involvement, 272 chemokine receptor involvement, 270 cysteinyl leukotriene involvement, 271 prostaglandin involvement, 271 S1P involvement, 271 under steady-state conditions bone marrow-derived DCs, 269–270 CCR7, 270 CCR8, 270 CD8a, 269 in MLN, 269 mDCs, 269 pDCs, 269 Airway DC subsets, localization and phenotype of CD11cþ myeloid, 267 CD11chigh DCs, role of, 266–267 pDCs, role of, 267 ALb2 unclasping, 191 Allergen-based immunotherapy, 83 anti-IgE and RIT, 84–85 anti-IgE and SIT, combination of, 84 Allergen-specific IgE-occupied receptors, 92–93 ‘‘Allergic asthma,’’ 74–75 Allergic diseases, 78 allergic rhinitis treatment, 80 CGP51901, 79 omalizumab, 79 in case studies, 81 anaphylactic reactions, 83 atopic dermatitis, 82 omalizumab, 82 SIT, 83
279
280 Allergic diseases (continued) definition of, 66 latex sensitivity treatment, with omalizumab, 81 peanut sensitivity treatment, anti-IgE studies on with epinephrine, 80 with omalizumab, 81 with TNX-901, 80 Allergy, as medical specialty, 83 Alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA), 234 AMb2, 187, 209 AMPA. See Alpha-amino-3-hydroxy-5methyl-4-isoxazole propionic acid Anti-CD72 mAb, 123 Anti-IgE, 73 adverse reactions, 103 ‘‘allergic asthma’’ b2 adrenergic receptor agonists, 74 corticosteroids, 74 omalizumab medication, 75 antibodies, rationale/scope/pharmacological basis of, 67 binding specificities, 68 hybridoma clones, 69 MAbs, 69 mIgE, as immunological site, 69 unique set of, 70 with CGP51901, 73–74 clinical parameters of, 77 corticosteroid, use of, 75 omalizumab treatment, 75–76 confirmation in asthma pathogenesis in allergic rhinitis, 77 inhibitory effects of, 77 development of, major events CGP51901, 64 CGP56901, 64 omalizumab (E25), 64–65 TNX-901, 64 disease-affected tissues in allergen molecules, 100 in mast cells, 99–100 good responders in patients, analyses of, 78 IgE cytokinergic properties neutralization, 98 IgE isotype-specific control/IgE targeting B cells, 68
i nd e x IgE suppression, 67 OKT3 antibody, 68 T cell receptors, 68 immune defense function IgE antibody class, 101–103 in parasites, 102 role of IgE, 102 immune reactivity attenuation CD23, role of, 99 long-term remission state, 100–101 modulation of, IgE-committed B lymphoblasts and memory B cell, 96 in vivo mouse model, 97–98 omalizumab, clinical development of, 74 prevailing concepts during invention, 71, 73 therapeutic, chemical features of CDR, 65 CHO cell line, 66 omalizumab, 65–66 TNX-901, 66 unique binding specificities, structural basis of, 69–71 Antigen receptor signaling pathways in B cells, 151–152 mast cells, 151–152 T cells, 151–152 Antigen-peptide-MHC complex, 200 Antigen-presenting cells (APC), 126–127, 186–187, 195–196, 200–201, 211, 215, 239–241, 243, 266 AP-1. See Activator protein 1 APC. See Antigen-presenting cells APE. See Apurinic/apyrimidic endonuclease APEX. See Apurinic/apyrimidic endonuclease Apolipoprotein B mRNA editing catalytic polypeptide 1, 4 APRIL. See A proliferation-inducing ligand Apurinic/apyrimidic endonuclease (APE or APEX), 5, 37–38 ARF. See ADP ribosylation factor Artemis, 10–11, 36 Ataxia-telangiectasia (A-T), 6, 11, 35, 38–40 Ataxia-telangiectasia and RAD3-related (ATR) protein, 6, 10–11, 34–35, 39 ATM deficiency, in human and mouse in A-T, 38–40 CSR junctions, 39–40 interswitch recombination, 39 intraswitch recombination, 39 mouse knockout models, 39
index SmSa, 39 SmSg, 39 SmSg1 junctions, 39 ATR. See Ataxia telangiectasia and RAD3 AXb2, 187, 190–191 B B cell activation factor (BAFF), 14–15, 32–34 B cell maturation antigen (BCMA), 14–15, 32 B cell receptor (BCR), 32, 34, 68–69, 97, 104, 123–126, 148, 151, 155, 159, 165, 168, 213, 244–246 B-cell chronic lymphocytic leukemia (B-CLL), 245–246 B-cell development and self-tolerance, role of Rap1 autoreactivity, 244 B1 cells, 246 B1a cells, 244 in B-CLL, 246 in CD5þ B cells, 246 IgA, 244 IgG, 244 OcaB, 244 Oct1,2, 244 ‘‘self-sensing’’ signal, 245–246 SPA-1/, 244 –246 in SPA-1 KO mice, 244–246 VH gene, 246 Vk genes, 244–246 Vl gene, 246 B-CLL. See B-cell chronic lymphocytic leukemia BAFF. See B cell activation factor BAFF–APRIL–TACI pathway, in human and mouse IgG, IgA, and IgE switching, 32 TACI, 32 TACI-deficient phenotype, 33 TNFRSF13B, 32 BAP/TFII-I Btk phosphorylation, 151 Base excision repair (BER), 3, 7, 8 BCMA. See B cell maturation antigen BCR. See B cell receptor BCR signaling, 123–125, 155, 165 BER. See Base excision repair BH. See Btk homology Bmx, 146, 156, 158–161 BRDG1, 159 Btk deficiency in mast cell, 169
281 Btk homology (BH), 146 Btk in mast cell, function and signaling, 169 Btk receptor signaling, 157 C c-cb1, 159–160 Calf-1, 188–190 Cas–Crk complex, 156 Caveolin-1, 160 CCR7, 270–272 CCR8, 270 CD2 signaling protein, 157–158 CD28 signaling protein, 157–158 CD38 involvement, in airway DC migration, to LN 8-Br-cADPR, 272 cADPR, 272 NADþ, 272 CD40 signaling, 14, 25, 31 CD40–CD40L interaction, 14 CD40–CD40L pathway, in human and mouse anti-CD40 antibodies, 32 CSR pathways, 31 HIGM, 31 IgM serum levels, 31 IL-10, 32 CD72 tyrosine-phosphorylation, 124 CD8 T cell, development and function, 163 CD94/NKG2C, 133 CDC42/Rac-dependent serine/threonine kinase, 158 CemX domain in mIgE, 105 CemX sequence, 104–105 CGP51901, 64–65, 73, 79, 93, 97 Chat-H, 206 Chemokine, 87, 99, 135, 166, 186, 195–196, 198–200, 202–212, 230, 235, 247–248, 266–268, 270–271 with APC, 201 C-C-chemokine ligand 21, 197 CXC chemokine ligand 12, 197 CXCL13, 197 receptor involvement, in airway DC migration, to LN CCL21, 272 CCR7, 272 in RunX3-deficient animals, 272 Chemotaxis, 136, 200, 203–204, 208–210, 268, 272 Chinese hamster ovary (CHO), 66
282 CHO. See Chinese hamster ovary Clasped aLb2, 191 Clasped aXb2, 191 Class switch recombination (CSR), 1 in ABC, 3 IgM class, 2 isotype switching, 2 region-specific process, 2 switch (S) regions, 2 AID, function of APOBEC-1, 4 cytidine deamination, 4 deamination of ssDNA, 4 ectopic expression, 4 editing of mRNA, 4 in gene conversion, 4 RGYW motifs, 5 RPA, 4–5 APRIL, 14–15 BAFF, 14–15 CD40–CD40L interaction, 14 cytokine differential regulation, in human and mouse Cg3 expression, 28 IFN-g, 28 IgG2, 28–29 IL-10, 28 IL-27, 29 IL-4, 28–29 LPS, 29 ‘‘switch factor,’’ 28 DNA damage response/repair pathways in Ig gene diversification, 8–9 Artemis, 10 MLH3, 10 MMR proteins, 7 polm role, 11 TDT role, 11 in XP-V patients, 11 DNA DSB resolutions in ATM/ATR signaling, 6 HR, 6–7 NHEJ, 6–7 DNA repair factors and APEX, in human and mouse, 37–38 ATM deficiency, in human and mouse, 38–40 immunodeficiency, 37 NBS1 deficiency, in human and mouse, 40–42
i nd e x pleiotropic phenotypes, 37 UNG deficiency, in human and mouse, 34, 37 dU:dG mismatches in APE1 (APEX1), 5 APEX2, 5 Mre11/Rad 50 pathway, 5 Mre11/Rad50/NBS1 complex, 6 MSH2-dependent pathway, 5 functional properties of IgG subclasses, in human and mouse FcgPI receptors, 28 IgG1, 27–28 IgG2a, 28 IgG2b, 28 IgG3, 27–28 GL promoters, in human and mouse, 30 ECS-Ig, 29 NF-kB-binding sites, 29 STAT6-binding site, 29 IgA1/IgA2, in human and mouse, 26 IgH 30 enhancers, 12–13 regulation of, 11 accessibility model, 12 AID expression, 12–13 regulation to IgA, in human and mouse, 26 IgA production in mMT mice and Cm-deficient patients, 27 SHM and point mutations, 3 SSB, 4 TGF-b1, in human and mouse, 26 toll and toll-like receptor, 15 V(D)J recombination and RAG1, 3 RAG2, 3 site-specific process, 3 Common variable immunodeficiency (CVID), 31–32, 34 Complement receptor (CR), 187 Complementarity-determining regions (CDR), 65 Constant region gene locus, in human and mouse Cg2a, 16 Cg2b, 16 IGHC gene, 15–16 pseudo-g-genes, 16 Coronin1, 210 Corticosteroids, 74–75, 78, 80
index CR. See Complement receptor Cromones, 92 CSR. See Class switch recombination CVID. See Common variable immunodeficiency Cyclophilin, peptidyl-prolyl isomerase, 155 Cysteine-string motif, 146 Cysteinyl leukotriene involvement, in airway DC migration, to LN ABCC1, 271 CCR7, 271 LTC4, 271 MRP1, 271 Cytokines, 2, 11–14, 28, 32–33, 40, 87, 98, 126, 128, 135–138, 166, 230, 271 D D1PTPD1. See Protein-tyrosine phosphatase DAG. See Diasylglycerol DAP12, 132–134 DC. See Dendritic cells DC and monocyte chemokine-like protein (DMC), 268 DC recruitment, in lung, 269 airway epithelium, 268 alveolar type 2 cells, 268 in asthma, 268 CCL20, 268 CCR2/, 268 CCR6/, 268 chemokine, role in, 268 chemotaxis, 268 defensins, 268 Der p 1, 268 DMC, 268 E-selectin, 267 L-selectin, 267 MHCIIþ DC precursors, 267 MMP9/, 268 in mouse model, 268 P-selectin, 267 role of, 267 ‘‘sentinels’’ of, immune system, 267 VCAM-1, 267 Defensins, 268 Dendritic cells (DC), 185–186, 265 in airways, 266 in immune responses, 266 inflammation, role of, 272–273 migratory capacity of, 272
283 Diacylglycerol (DAG), 152, 213, 231 Disodium cromoglycogate, 92 DMC. See DC and monocyte chemokine-like protein DNA damage response/repair pathways, 7–11 DNA ligase IV, 6–7, 34, 36 DNA-PKcs, 6 bI domain, 188–193 Double strand breaks (DSB), 3–5 repair mechanisms HR, 6–7 NHEJ, 6–7 Double-positive (DP) thymocytes, 237 DP. See Double-positive DRap1. See Rap1 in Drosophila melanogaster DSB. See DNA double strand breaks E EBV. See Epstein-Barr virus ECM. See Extracellular matrix ECS-Ig. See Evolutionarily conserved sequence EGF. See Epithelial growth factor Ena. See Actin regulating enabled 30 Enhancers, in human and mouse GLe and g2b promoters, 24 HS3 enhancers, 24 HS4 enhancers, 24 a1HS1, 2, 24 a2HS1, 2, 24 Epinephrine, 80, 253 Epithelial growth factor (EGF), 189–190, 233–234, 253 Epstein-Barr virus (EBV), 206 ERK1/ERK2, 152 Evolutionarily conserved sequence (ECS-Ig), 29–31 Extracellular matrix (ECM), 156, 200, 235–237 F FAK. See Focal adhesion kinase Fas, 158–159 FceRI and IgE in Type I hypersensitivity. See IgE and FceRI in Type I hypersensitivity, roles of FceRI activation-induced signaling, 167
284 FceRI downregulation anti-IgE, as mast ‘‘cell-stabilizing’’ agent cromones, 92 mast cells, role of, 91–92 IgE and FceRI, relationship between, 91–92 insensitivity of FceRIIgE; for a mast cell allergen concentration, 92–93 FceRI density, 92–93 FceRI on CH3 domains, binding site of a chain, 72 FceRI stimulation, 155 Fetal thymic organ cultures (FTOC), 237 Focal adhesion kinase, 156, 199 FTOC. See Fetal thymic organ cultures G G-protein b and g subunits, 158 G-protein-coupled receptors (GPCR), 198, 203, 232 Gbg. See G-protein b and g subunits GAP. See GTPase-activating proteins GAP-related domain (GRD), 232 GEF. See Guanine exchange factor; Guanine nucleotide exchange factor Genome sequences, 1–2 Germ line (GL), 2–3, 11–14, 21, 24, 26–27, 29–31, 34, 37, 39, 41 Germ stem cells (GSC), 248 GFFKR motif, 188, 193–195, 206 Gi-coupled signaling, 198 GL. See Germ line GL transcription, 11–13, 34, 39, 41 Glutamic acid mutation, 192 Glycosylphosphatidylinositol (GPI), 122 GPCR. See G-protein-coupled receptors GPCR-triggered signals development of leading edge, 203 uropod structure, 203 integrin activation, 203 GPI. See Glycosylphosphatidylinositol Grb10/Grb1R, 159 GRD. See GAP-related domain GSC. See Germ stem cells GTPase RhoH, 210 GTPase-activating proteins (GAP), 232 GTPases. See Guanine triphosphatases Guanine exchange factor (GEF), 204, 212
i nd e x Guanine nucleotide exchange factors (GEF), 231 Guanine triphosphatases (GTPases), 133–135, 157, 199, 203–205, 208, 210–212, 215, 229–230, 232 H H2AX, 6, 10–11, 34 Hematopoiesis and Rap1 signal. See Hematopoietic stem cells (HSC) Hematopoietic stem cells (HSC), 210, 250, 254 deregulated Rap1 signal BCR-ABL protein, 252–253 CML, 251–253 in NF1 þ/ mice, 252 PI3K/AKT activation, 252 Pten gene, 251–253 in Pten/ mice, 251–253 in SPA-1/ mice, 249, 251–253 regulated Rap1 signal c-Myc, 249 in Drosophila, 248 in GSC, 248 in N-cadherinþ osteoblastic cells, 249 in SPA-1/ mice, 249 niche, 248–249 SDF-1, 249 Heterotrimeric G-protein, 158 High endothelial venules (HEV), 186, 196, 197, 200, 204–205, 210 in sequential adhesion steps, 195 Homeostatic hematopoiesis, by Rap1 and myeloid leukemia, 250 Homologous recombination (HR), 2, 6–7, 9, 31 HR. See Homologous recombination HSC. See Hematopoietic stem cells I IC3b-coated particles, 187 ICAM. See Intercellular adhesion molecule IFN-g promoter region, 150 transcription, 151 IgA, 27, 31–33, 36–42 IgE and FceRI in Type I hypersensitivity, roles of anti-IgE pharmacological effects of, binding to FceRI and FceRII, 87–88 IgE-mediated allergic pathway chemokines, 87
index cytokines, 87 lipid mediators, 87 manifestation stage, 87 prepacked mediators, 87 sensitization stage, 85 triggering stage, 85–86 IgE neutralization, 88 IgE concentration versus IgE occupancy of FceRI, 89–90 total IgE and proportion of allergen-specific IgE ‘‘hygiene hypothesis,’’ 89 sensitivity of mast cells/basophils, 88–89 IgE or IgE-expressing B cell targeting IgE-mediated allergic pathway attenuation anti-CD23, 103 IL-4, 104 immune modulators, 103 mIgE, epitope on B lymphoblasts, 104 CemX sequence, 104–105 memory B cells, 104 IgE-mediated allergy allergic diseases, 66 allergic reactions, 66 IgE roles, 66 IgE:anti-IgE immune complexes, beneficial effects of antigen trappers antigen-binding sites, 95 omalizumab treatment, 96 clinical improvement case studies, 94 CGP51901, 93–94 molecular/cellular pharmacological mechanisms, 94 omalizumab, 94 IL-4, 12–13, 25, 28–29, 31, 33–34, 40–41, 89, 97, 99, 102–104, 127–128 Iloprost, 271 Immunoglobulin (Ig), 2–3, 6–8, 13–14, 15–16, 20, 21, 29, 33, 38, 244–245, 247 Immunological synapse and T-cell activation, role of Rap1 LFA-1, 240–241 Rap1GDP, 240 Rap1GTP, 240–241 SLP-76, 240–241 in SMAC, 240
285 synapse formation, 240 TCR signaling, 240 Immunoreceptor tyrosine-based inhibitory motif (ITIM), 123–125, 133, 168, 242 Inositol-1,4,5-triphosphate (IP3), 152, 168 Inside-out signaling, 186–187, 194, 198, 200, 203–204, 206, 209, 211–212, 214 Integrin adhesion receptor, role of, 186 avidity regulation, 197 conformational change affinity regulation of bI domain, 192 coherent model of, 191 cytoplasmic domain, 193 extensions of extracellular domains, 190–191 global changes of extracellular domain, 189–190 multiple affinity states of aI domain, 192 regulation of aI domain conformation, 192 cytoplasmic domain, 187 a4 Integrins, 186–187, 196–197, 199–200, 209, 272 b2 Integrin, 187, 190–191, 199, 204, 207–208, 212, 214, 247–248 structure of, 188 Intercellular adhesion molecule (ICAM), 186, 196, 201 Interleukin-1 receptor-associated kinase-1 (IRAK), 157 IP3. See Inositol-1,4,5-triphosphate IRAK. See Interleukin-1 receptor-associated kinase-1 ITIM. See Immunoreceptor tyrosine-based inhibitory motif Itk role in mast cells, 167 SH2 domain, 155 J JAM-1. See Junctional adhesion molecule-1 JUN amino-terminal kinase, 152 Junctional adhesion molecule-1, 187 L LAD. See Leukocyte adhesion deficiency LAT. See Linker for activation of T cells Leukocyte adhesion deficiency (LAD), 187, 206, 247–248
286 Leukocyte integrin affinity, 189 avidity, 189 conformational changes, 190–195 genu, structural studies of, 190 inside-out signaling, 187 valency regulation, 189 LFA-1; aL/b2. See Lymphocyte function-associated antigen Lig4 gene, 6–7, 9, 36 Ligand-binding headpiece, 187, 191, 198 Linker for activation of T cells, 152, 167–172, 211–213 Lymph nodes (LN), 26, 194–195, 197, 199–200, 206–207, 210, 247, 266, 268–273 Lymphocyte interaction, swarming pattern, 201 role of Rap1 CD44, 247 chemokine migration, 247 homing of, 247 in immunosurveillance, 247 in LAD patients, 247–248 in RapL/ mice, 247 Rap1 activation, 247–248 transendothelial migration, 247 Lymphocyte b2 legpiece extension, 198 Lymphocyte function-associated antigen, 186 M MAb. See Monoclonal antibody Mac-1, 187, 235 MAdCAM. See Mucosal addressin cell adhesion molecule Mammalian Ste20-like kinase MST1/ STK4, 207 Matrix metalloproteinase (MMP), 268 MDC. See Myeloid dendritic cells MDS. See Myelodysplastic syndrome Mediastinal draining lymph nodes (MLN), 269–272 Metal ion-dependent adhesion site, 188, 190–193 MIDAS. See Metal ion-dependent adhesion site Mismatch repair (MMR), 3, 5, 7–8, 10, 37 MLN. See Mediastinal draining lymph nodes MMP. See Matrix metalloproteinase MMR. See Mismatch repair Monoclonal antibody (MAb), 64, 68, 191
i nd e x MPD. See Myeloproliferative disorder Mre11, 5–6, 10, 34, 36 MRP1. See Multidrug resistance-related protein 1 Mucosal addressin cell adhesion molecule, 186 Multidrug resistance-related protein 1 (MRP1), 271 Mus musculus, 1 MyD88 adapter-like protein, 157 Myelodysplastic syndrome (MDS), 251 Myeloid cell-2 (TREM-2)–DAP12 complex, 132 Myeloid dendritic cells (MDC), 265, 269, 271 Myeloproliferative disorder (MPD), 238, 249, 250–251. See also Hematopoietic stem cells (HSC) N NBS. See Nijmegen breakage syndrome NBS1, 6, 10–11, 34, 36, 40–42 deficiency, in human and mouse 5-bp deletion hypomorphic allele, 41 CSR defect, 41 NBS1 mutation, 657 del5, 40–41 null mutation, 40 Nerve growth factor (NGF), 233–234 NF-kB. See Nuclear factor-kB NFAT transcription factor, 152 NGF. See Nerve growth factor NHEJ. See Nonhomologous end joining Nijmegen breakage syndrome (NBS), 7, 36, 40–41 NKT cell development, 163 Nonhomologous end joining (NHEJ), 3, 6–7, 9 Nuclear factor-kB (NF-kB) activity, 13 activation in B cells, 151 p50 of, 25 O Omalizumab, 64, 65–66, 70, 74–76, 78–85, 94, 96–97, 103, 105, 107 30 Phase II and III clinical trials, 106 clinical utility of, 106 OVA. See Ovalbumin Ovalbumin (OVA), 269 P P13K. See Phosphatidylinositol 3-kinase P21-activated kinase 1, 158 Pax5, 12–13, 22, 25
index pDC. See Plasmacytoid dendritic cells Peroxisome proliferator-activated receptor-g (PPAR-g), 271 PH. See Plekstrin homology PH/TH domain-mediated association of Btk, 158 Phosphalidylinositol (PI)-3-kinase (PI3K), 42, 147–149, 154, 167–169, 203–205, 212, 252 Phosphatidylinositol (3,4,5) triphosphate (PIP3), 147–149, 154–155, 158, 167, 168, 204, 210, 251 PIP3. See Phosphatidylinositol (3,4,5) triphosphate PKA. See Protein kinase A PKC-z kinase activity, 205 Plasmacytoid dendritic cells (pDC), 265–267, 269 recruitment, to sites of inflammation in asthma, 272 CD62L, 272 CXCR3, 272 ICAM-1, 272 a4 integrin, 272 b2 integrin, 272 in nasal allergy, 272 PNAd, 272 VCAM, 272 Plekstrin homology (PH), 146–149, 151, 154–156, 158–159, 167, 168, 204, 207, 210, 214 PPAR-g. See Peroxisome proliferator-activated receptor-g Proline-rich region (PRR), 146, 150–151, 154, 161–163 b-Propeller, 188–192 Prostaglandin involvement, in airway DC migration, to LN iloprost, 271 PGD2, 271 PGE2, 271 PGI2, 271 PPAR-g, 271 Protein kinase A (PKA), 13, 25–26 Protein tyrosine kinases (PTK), 145, 161, 231, 234 Protein-tyrosine phosphatase D1, 159 PRR. See Proline-rich region PRR mutant of Rch1a in Jurkat cells, 151 PTK. See Protein tyrosine kinases
287 R Rac pathways, 208–210 Rap1. See Ras-proximity 1 Rap1 in Drosophila melanogaster (DRap1), 230, 233 Rap1-binding protein (RAPL), 206, 213, 235, 241 overexpression, 207 Rap1-interacting adaptor molecule (RIAM), 207, 236 Rap1A, 205, 213, 230, 238 Rap1B, 205–206, 213, 230, 238 RAPL. See Rap1-binding protein RAS guanyl-releasing protein, 152 Ras-proximity 1 (Rap1), 229 activation, regulation of C3G, 231 CalDAG-GEF I, 231 CalDAG-GEF III, 231 cAMP, 231 E6TP1, 232 Epac/Rap1, 232 Epacs, role in, 232 in GTPase activity, 232 Rap1GAP, 232 Rap1GDP (an inactive form), 230 Rap1GEF, 231–232 Rap1GTP (an active form), 230 RapGA1, 232 RapGA2, 232 SPA-1, 232 in budding yeasts, 230 cell adhesion, control of actin dynamics, regulation of, 236 AF-6, 236 DE-cadherin, 236 in Drosophila, 236 Ena/ VASP, 236 ‘‘inside-out’’ activation, 235 integrins, 235 JAM1, 236–237 LFA-1 activation, 235 profillin, 236 Rap1GTP, 236 RapL, 235–236 RIAM, 236 SPA-1 overexpression, 235 in cancer, 253, 255 BCR-ABL oncoprotein, 254 ‘‘conditional’’ oncoprotein, 254
288 Ras-proximity 1 (Rap1) (continued) DOCK4 gene, mutations of, 254 Rap1GAP transduction, 254 SPA-1/741A alleles, 254 in Drosophila melanogaster, 230 exchange factor, 206 gene-engineered mice, phenotypes of, 238 in hematopoiesis and leukemia deregulated Rap1 signal and myeloproliferative disorders, 249, 251–253 HSCs, 248–249 in platelet generation and function, role of, 253 in lymphocyte development and immune responses B-cell development and self-tolerance, 244–246 immunological synapse and T-cell activation, 240–241 lymphocyte migration and homing, 247–248 T-cell nonresponsiveness and anergy, 241–243 thymic T-cell development, 237–240 in mammals, 230 MAPK activation, regulation of B-Raf, role of, 233 c-Raf-1, role of, 233–234 DRap1, 233 in hippocampal neurons, 234 ligand-occupied EGF receptors, 234 in MEK-1, 2–ERK pathway, 233 in MEK-3, 6–p38MAPK pathway, 234 NGF receptors, 234 in PC12 neuronal cell line, 233 PI3K–AKT pathway, 234–235 PI3Kp110, 234 RalGDS, 234 Rap1GTP, 234 Ras-mediated ERK activation, 234 overexpression of, 207, 230 regulation and functions of, 231 roles of, 230 ‘‘self-sensing’’ signal in immature bone marrow B cells, 245 RASGRP. See RAS guanyl-releasing protein Rassf 5, 207
i nd e x Receptor-proximal pathways in FceRI signaling, 167 Recombinant integrins electron microscopic analysis, 190 Replication protein A (RPA), 4–5, 10, 13 RHOH gene inactivation, 210 RHOH-specific siRNA, 210 RIAM. See Rap1-interacting adaptor molecule RIAM knockdown, 208 RIT. See Rush immunotherapy RPA. See Replication protein A Rush immunotherapy (RIT), 84–85, 101, 106 S S1P. See Sphingosine-1-phosphate S1P involvement, in airway DC migration, to LN FTY720, 271 in immune cells, 271 S38. See Serine 38 Sab, overexpression in B cell, 155 SAC. See Staphylococcus aureus Cowan I Sak kinase, 159 b-Sandwich hybrid domain, 189–190 b-Sandwich module, 189 Sema4A expression pattern of, 127 involvement in T cell activation and differentiation, 129 receptors in immune system, 130 Sema4A-Fc fusion protein, 127 Th1 differentiation of, 128 Sema4D CD72 receptor for, 123 CD72 interaction and, 123 exogenous expression of, 123 human Sema4D-Fc protein, 123 in immune system, 123 in T cell-mediated immunity, 126 Sema4D-CD72 interaction, 123 B cell homeostasis, 124 mechanism of, 124 regulation of CD40, 124 TLR4 signal, 124 Sema4D-Fc, 123 Sema6D-Plexin-A1 interaction in cardiac development, 131 in DC function, 131 in osteopetrosis, 132
index Sema7A as monocyte stimulator, 135 as negative regulator for T Cells, 136 Semaphorin biological functions in immune system, 121–138 Class III semaphorin, 122, 137–138 glycosylphosphatidylinositol, 122 neuropilin, 122 plexin-D1, 122 Serine 38 (S38), 25–26 44-kDa serine/threonine kinase Pim-1, 158 SH2-domain-containing leukocyte protein of 76 kDa, 152 SH3-domain binding protein, 155 SHIP proteins Dok-1, 154 Dok-2, 154 signaling of, 154 SHM. See Somatic hypermutation Single-strand breaks (SSB), 3–5 SIT. See Specific immunotherapy SKAP-55, 214–215 SLP-76. See SH2-domain-containing leukocyte protein of 76 kDa SMAC. See Supramolecular activation clusters Smad proteins, 13 Sodium nedocromil, 92 Somatic hypermutation (SHM), 3–11, 14, 37–38 Specific immunotherapy (SIT), 83–84, 101, 106 Sphingosine-1-phosphate (S1P), 205–206, 271 SSB. See Single-strand breaks Staphylococcus aureus Cowan I (SAC), 28, 31 STAT6, 13, 25, 29, 31 Stem cell factor (SCF), 154, 210–211 Supramolecular activation clusters (SMAC), 200, 240 SWAP-70, 210 Switch (S) regions, in human and mouse, 42 characteristics of, 16, 19–20 structural, 17–18 dot matrix analysis, 16, 19 polymorphism of, 20–21 secondary structures, 21–22 Sg1, 17, 18, 20–21 Sg3, 17–21 Sm Sa, Se and Sg, 16, 19–20
289 T T27. See Threonine 27 T cell receptors (TCR), 68, 146 complex, 200, 211 T cell-APC conjugate, 201 T-cell nonresponsiveness and anergy, role of Rap1 Cbl, 242 CD44highmemory phenotype, 243 CTLA-4, 241 IL-2 gene, 242–243 IL-2 response, 241 in RapGAP transgenic mice, 242–243 RapE63 transgene, 241 Ras–ERK pathway, 242 in SPA-1/ mice, 243 T-cell anergy, 242 TCR/CD3-stimulation per se, 241 TACI. See Transmembrane activator and AML interactor Talin aIIbb3 activation and, 208 intracellular regulator, in lymphocyte adhesion and migration, 201–202 TCR. See T cell receptor TCR-mediated inside-out signals, 201 TCR-stimulated lymphocytes, inside-out signaling events, 211 adaptor protein, 214 PKD1, 214 Rac signaling pathways, 212 Tec family kinases, 212 TCR-triggered signals, 211 Tec homology (TH), 146, 152, 155 Tec kinase activation, regulation of by interdomain interactions, 161–162 intramolecular domain interactions, 161–162 by tyrosine phosphorylation, 160 in antigen receptor signaling pathway, 151 C-terminal kinase domain, 145 cytoskeletal components interactions with, 156–157 interacting protein, 153 level of, 146 membrane localization of, 148 negative regulators interactions with, 153–155 nuclear localization, 150–151
290 Tec kinase (continued) overview of, 145–146 regulation of, 146 roles in mast cells, 167 SH3 domain, 145 Src homology (SH)2 domain, 145 subcellular localization, regulation of membrane recruitment and, 147 in T cell, 145–172 Tec/SHIP/Dok complex, 154 Tetherto-synapse dynamic, 201 TFII-I-dependent transcriptional activation in COS7 cell, 151 TH. See Tec homology Therapeutic anti-IgE antibody, 64 Threonine 27 (T27), 25–26 Thymic T-cell development, roles of Rap1 and Ras CAG promoter, 237 in DP thymocytes, 237 in ERK activation, 238 in FTOC, 237–238 ‘‘hyperexcitability,’’ 239–240 pre-TCR-mediated signal, 239 RapE63 transgene, 237 in bselection, 238–239 SPA-1 transgene, 237 in transgenic mice, 237–240 Tim loci, 130 Tim-1, 130 Tim-2, 130 Tim-3, 130 TKB. See Tyrosine kinase binding TLR. See Toll-like receptor TLR4. See Toll-like receptor 4 TLR4 signal transduction, 157 TLR9 pathway, 15 TNX-901, 64, 66, 70, 80–81, 105–107 Toll and Toll-like receptor, 15 in human and mouse
i nd e x CpG DNAs, 33–34 in CVID patients, 34 TLR4 expression, 33 TLR9, 33–34 Toll-like receptor (TLR), 157 Toll-like receptor 4 (TLR4), 15, 33, 124, 157 Transmembrane activator and CAML interactor (TACI), 14, 32–33 Tyrosine kinase binding (TKB), 159 Tyrosine phosphatase SHP-1, 123 Tyrosine phosphorylation, 123–124, 130, 133, 147–148, 155, 160 U Uracil DNA glycosylase (UNG), 5, 7–8 deficiency, in human and mouse HIGM2, 34, 37 HIGM5, 34, 37 knockout model, 37 MSH2 pathway, 37 SMUG1, 37 noncanonical role, 42 V V(D)J recombination, 3, 7, 10–11, 34 Vaccinia virus semaphorin A39R, 137 Vascular cell adhesion molecule (VCAM), 186 Vasodilator-stimulated phosphoprotein (VASP), 207–208 VASP. See Vasodilator-stimulated phosphoprotein Vav, guanine nucleotide exchange factor, 157 VCAM. See Vascular cell adhesion molecule VEGFR2, 131–133 Viral semaphorin, 137 X X-linked agammaglobulinemia, 157 Xeroderma pigmentosum variant (XP-V), 11 XRCC4, 6–7, 9
Contents of Recent Volumes
An Integrated Model of Immunoregulation Mediated by Regulatory T Cell Subsets Hong Jiang and Leonard Chess
Volume 83 Lineage Commitment and Developmental Plasticity in Early Lymphoid Progenitor Subsets David Traver and Koichi Akashi
Index
The CD4/CD8 Lineage Choice: New Insights into Epigenetic Regulation during T Cell Development Ichiro Taniuchi, Wilfried Ellmeier, and Dan R. Littman
Volume 84
CD4/CD8 Coreceptors in Thymocyte Development, Selection, and Lineage Commitment: Analysis of the CD4/CD8 Lineage Decision Alfred Singer and Remy Bosselut
Multitasking of Helix-Loop-Helix Proteins in Lymphopoiesis Xiao-Hong Sun
Development and Function of T Helper 1 Cells Anne O’Garra and Douglas Robinson Th2 Cells: Orchestrating Barrier Immunity Daniel B. Stetson, David Voehringer, Jane L. Grogan, Min Xu, R. Lee Reinhardt, Stefanie Scheu, Ben L. Kelly, and Richard M. Locksley Generation, Maintenance, and Function of Memory T Cells Patrick R. Burkett, Rima Koka, Marcia Chien, David L. Boone, and Averil Ma
Interactions Between NK Cells and B Lymphocytes Dorothy Yuan
Customized Antigens for Desensitizing Allergic Patients Fa¨tima Ferreira, Michael Wallner, and Josef Thalhamer Immune Response Against Dying Tumor Cells Laurence Zitvogel, Noelia Casares, Marie O. Pe¨quignot, Nathalie Chaput, Mathew L. Albert, and Guido Kroemer HMGB1 in the Immunology of Sepsis (Not Septic Shock) and Arthritis Christopher J. Czura, Huan Yang,
CD8þ Effector Cells Pierre A. Henkart and Marta Catalfamo
291
292 Carol Ann Amella, and Kevin J. Tracey Selection of the T-Cell Repertoire: Receptor-Controlled Checkpoints in T-Cell Development Harald Von Boehmer The Pathogenesis of Diabetes in the NOD Mouse Michelle Solomon and Nora Sarvetnick
co n t e nt s o f re c e nt vo l um es Interleukin-2, Interleukin-15, and Their Roles in Human Natural Killer Cells Brian Becknell and Michael A. Caligiuri Regulation of Antigen Presentation and CrossPresentation in the Dendritic Cell Network: Facts, Hypothesis, and Immunological Implications Nicholas S. Wilson and Jose A. Villadangos Index
Index
Volume 87 Volume 85 Cumulative Subject Index Volumes 66–82
Volume 86 Adenosine Deaminase Deficiency: Metabolic Basis of Immune Deficiency and Pulmonary Inflammation Michael R. Blackburn and Rodney E. Kellems Mechanism and Control of V(D)J Recombination Versus Class Switch Recombination: Similarities and Differences Darryll D. Dudley, Jayanta Chaudhuri, Craig H. Bassing, and Frederick W. Alt
Role of the LAT Adaptor in T-Cell Development and Th2 Differentiation Bernard Malissen, Enrique Aguado, and Marie Malissen The Integration of Conventional and Unconventional T Cells that Characterizes Cell-Mediated Responses Daniel J. Pennington, David Vermijlen, Emma L. Wise, Sarah L. Clarke, Robert E. Tigelaar, and Adrian C. Hayday Negative Regulation of Cytokine and TLR Signalings by SOCS and Others Tetsuji Naka, Minoru Fujimoto, Hiroko Tsutsui, and Akihiko Yoshimura Pathogenic T-Cell Clones in Autoimmune Diabetes: More Lessons from the NOD Mouse Kathryn Haskins
Isoforms of Terminal Deoxynucleotidyltransferase: Developmental Aspects and Function To-Ha Thai and John F. Kearney
The Biology of Human Lymphoid Malignancies Revealed by Gene Expression Profiling Louis M. Staudt and Sandeep Dave
Innate Autoimmunity Michael C. Carroll and V. Michael Holers
New Insights into Alternative Mechanisms of Immune Receptor Diversification Gary W. Litman, John P. Cannon, and Jonathan P. Rast
Formation of Bradykinin: A Major Contributor to the Innate Inflammatory Response Kusumam Joseph and Allen P. Kaplan
The Repair of DNA Damages/Modifications During the Maturation of the Immune
c o nt e n t s of re c e n t vo l u m es System: Lessons from Human Primary Immunodeficiency Disorders and Animal Models Patrick Revy, Dietke Buck, Franc,oise le Deist, and Jean-Pierre de Villartay Antibody Class Switch Recombination: Roles for Switch Sequences and Mismatch Repair Proteins Irene M. Min and Erik Selsing
293 Properties and Specificity of Peptide Selection Anish Suri and Emil R. Unanue RNAi and RNA-Based Regulation of Immune System Function Dipanjan Chowdhury and Carl D. Novina Index
Index
Volume 89
Volume 88
Posttranscriptional Mechanisms Regulating the Inflammatory Response Georg Stoecklin Paul Anderson
CD22: A Multifunctional Receptor That Regulates B Lymphocyte Survival and Signal Transduction Thomas F. Tedder, Jonathan C. Poe, and Karen M. Haas Tetramer Analysis of Human Autoreactive CD4-Positive T Cells Gerald T. Nepom Regulation of Phospholipase C-g2 Networks in B Lymphocytes Masaki Hikida and Tomohiro Kurosaki Role of Human Mast Cells and Basophils in Bronchial Asthma Gianni Marone, Massimo Triggiani, Arturo Genovese, and Amato De Paulis A Novel Recognition System for MHC Class I Molecules Constituted by PIR Toshiyuki Takai Dendritic Cell Biology Francesca Granucci, Maria Foti, and Paola Ricciardi-Castagnoli The Murine Diabetogenic Class II Histocompatibility Molecule I-Ag7: Structural and Functional
Negative Signaling in Fc Receptor Complexes Marc Dae¨ron and Renaud Lesourne The Surprising Diversity of Lipid Antigens for CD1-Restricted T Cells D. Branch Moody Lysophospholipids as Mediators of Immunity Debby A. Lin and Joshua A. Boyce Systemic Mastocytosis Jamie Robyn and Dean D. Metcalfe Regulation of Fibrosis by the Immune System Mark L. Lupher, Jr. and W. Michael Gallatin Immunity and Acquired Alterations in Cognition and Emotion: Lessons from SLE Betty Diamond, Czeslawa Kowal, Patricio T. Huerta, Cynthia Aranow, Meggan Mackay, Lorraine A. DeGiorgio, Ji Lee, Antigone Triantafyllopoulou, Joel Cohen-Solal Bruce, and T. Volpe Immunodeficiencies with Autoimmune Consequences Luigi D. Notarangelo, Eleonora Gambineri, and Raffaele Badolato Index
294
Volume 90 Cancer Immunosurveillance and Immunoediting: The Roles of Immunity in Suppressing Tumor Development and Shaping Tumor Immunogenicity Mark J. Smyth, Gavin P. Dunn, and Robert D. Schreiber
co n t e nt s o f re c e nt vo l um es Combinatorial Cancer Immunotherapy F. Stephen Hodi and Glenn Dranoff Index
Volume 91
Mechanisms of Immune Evasion by Tumors Charles G. Drake, Elizabeth Jaffee, and Drew M. Pardoll
A Reappraisal of Humoral Immunity Based on Mechanisms of Antibody-Mediated Protection Against Intracellular Pathogens Arturo Casadevall and Liise-anne Pirofski
Development of Antibodies and Chimeric Molecules for Cancer Immunotherapy Thomas A. Waldmann and John C. Morris
Accessibility Control of V(D)J Recombination Robin Milley Cobb, Kenneth J. Oestreich, Oleg A. Osipovich, and Eugene M. Oltz
Induction of Tumor Immunity Following Allogeneic Stem Cell Transplantation Catherine J. Wu and Jerome Ritz
Targeting Integrin Structure and Function in Disease Donald E. Staunton, Mark L. Lupher, Robert Liddington, and W. Michael Gallatin
Vaccination for Treatment and Prevention of Cancer in Animal Models Federica Cavallo, Rienk Offringa, Sjoerd H. van der Burg, Guido Forni, and Cornelis J. M. Melief Unraveling the Complex Relationship Between Cancer Immunity and Autoimmunity: Lessons from Melanoma and Vitiligo Hiroshi Uchi, Rodica Stan, Mary Jo Turk, Manuel E. Engelhorn, Gabrielle A. Rizzuto, Stacie M. Goldberg, Jedd D. Wolchok, and Alan N. Houghton Immunity to Melanoma Antigens: From Self-Tolerance to Immunotherapy Craig L. Slingluff, Jr., Kimberly A. Chianese-Bullock, Timothy N. J. Bullock, William W. Grosh, David W. Mullins, Lisa Nichols, Walter Olson, Gina Petroni, Mark Smolkin, and Victor H. Engelhard Checkpoint Blockade in Cancer Immunotherapy Alan J. Korman, Karl S. Peggs, and James P. Allison
Endogenous TLR Ligands and Autoimmunity Hermann Wagner Genetic Analysis of Innate Immunity Kasper Hoebe, Zhengfan Jiang, Koichi Tabeta, Xin Du, Philippe Georgel, Karine Crozat, and Bruce Beutler TIM Family of Genes in Immunity and Tolerance Vijay K. Kuchroo, Jennifer Hartt Meyers, Dale T. Umetsu, and Rosemarie H. DeKruyff Inhibition of Inflammatory Responses by Leukocyte Ig-Like Receptors Howard R. Katz Index
Volume 92 Systemic Lupus Erythematosus: Multiple Immunological Phenotypes in a Complex Genetic Disease
c o nt e n t s of re c e n t vo l u m es Anna-Marie Fairhurst, Amy E. Wandstrat, and Edward K. Wakeland Avian Models with Spontaneous Autoimmune Diseases Georg Wick, Leif Andersson, Karel Hala, M. Eric Gershwin,Carlo Selmi, Gisela F. Erf, Susan J. Lamont, and Roswitha Sgonc Functional Dynamics of Naturally Occurring Regulatory T Cells in Health and Autoimmunity Megan K. Levings, Sarah Allan, Eva d’Hennezel, and Ciriaco A. Piccirillo BTLA and HVEM Cross Talk Regulates Inhibition and Costimulation
295 Maya Gavrieli, John Sedy, Christopher A. Nelson, and Kenneth M. Murphy The Human T Cell Response to Melanoma Antigens Pedro Romero, Jean-Charles Cerottini, and Daniel E. Speiser Antigen Presentation and the Ubiquitin-Proteasome System in Host–Pathogen Interactions Joana Loureiro and Hidde L. Ploegh Index