TOXIC SHOCK SYNDROME A M EDICAL D ICTIONARY , B IBLIOGRAPHY , AND A NNOTATED R ESEARCH G UIDE TO I NTERNET R E FERENCES
J AMES N. P ARKER , M.D. AND P HILIP M. P ARKER , P H .D., E DITORS
ii
ICON Health Publications ICON Group International, Inc. 4370 La Jolla Village Drive, 4th Floor San Diego, CA 92122 USA Copyright 2004 by ICON Group International, Inc. Copyright 2004 by ICON Group International, Inc. All rights reserved. This book is protected by copyright. No part of it may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying, recording, or otherwise, without written permission from the publisher. Printed in the United States of America. Last digit indicates print number: 10 9 8 7 6 4 5 3 2 1
Publisher, Health Care: Philip Parker, Ph.D. Editor(s): James Parker, M.D., Philip Parker, Ph.D. Publisher's note: The ideas, procedures, and suggestions contained in this book are not intended for the diagnosis or treatment of a health problem. As new medical or scientific information becomes available from academic and clinical research, recommended treatments and drug therapies may undergo changes. The authors, editors, and publisher have attempted to make the information in this book up to date and accurate in accord with accepted standards at the time of publication. The authors, editors, and publisher are not responsible for errors or omissions or for consequences from application of the book, and make no warranty, expressed or implied, in regard to the contents of this book. Any practice described in this book should be applied by the reader in accordance with professional standards of care used in regard to the unique circumstances that may apply in each situation. The reader is advised to always check product information (package inserts) for changes and new information regarding dosage and contraindications before prescribing any drug or pharmacological product. Caution is especially urged when using new or infrequently ordered drugs, herbal remedies, vitamins and supplements, alternative therapies, complementary therapies and medicines, and integrative medical treatments. Cataloging-in-Publication Data Parker, James N., 1961Parker, Philip M., 1960Toxic Shock Syndrome: A Medical Dictionary, Bibliography, and Annotated Research Guide to Internet References / James N. Parker and Philip M. Parker, editors p. cm. Includes bibliographical references, glossary, and index. ISBN: 0-597-84100-4 1. Toxic Shock Syndrome-Popular works. I. Title.
iii
Disclaimer This publication is not intended to be used for the diagnosis or treatment of a health problem. It is sold with the understanding that the publisher, editors, and authors are not engaging in the rendering of medical, psychological, financial, legal, or other professional services. References to any entity, product, service, or source of information that may be contained in this publication should not be considered an endorsement, either direct or implied, by the publisher, editors, or authors. ICON Group International, Inc., the editors, and the authors are not responsible for the content of any Web pages or publications referenced in this publication.
Copyright Notice If a physician wishes to copy limited passages from this book for patient use, this right is automatically granted without written permission from ICON Group International, Inc. (ICON Group). However, all of ICON Group publications have copyrights. With exception to the above, copying our publications in whole or in part, for whatever reason, is a violation of copyright laws and can lead to penalties and fines. Should you want to copy tables, graphs, or other materials, please contact us to request permission (E-mail:
[email protected]). ICON Group often grants permission for very limited reproduction of our publications for internal use, press releases, and academic research. Such reproduction requires confirmed permission from ICON Group International Inc. The disclaimer above must accompany all reproductions, in whole or in part, of this book.
iv
Acknowledgements The collective knowledge generated from academic and applied research summarized in various references has been critical in the creation of this book which is best viewed as a comprehensive compilation and collection of information prepared by various official agencies which produce publications on toxic shock syndrome. Books in this series draw from various agencies and institutions associated with the United States Department of Health and Human Services, and in particular, the Office of the Secretary of Health and Human Services (OS), the Administration for Children and Families (ACF), the Administration on Aging (AOA), the Agency for Healthcare Research and Quality (AHRQ), the Agency for Toxic Substances and Disease Registry (ATSDR), the Centers for Disease Control and Prevention (CDC), the Food and Drug Administration (FDA), the Healthcare Financing Administration (HCFA), the Health Resources and Services Administration (HRSA), the Indian Health Service (IHS), the institutions of the National Institutes of Health (NIH), the Program Support Center (PSC), and the Substance Abuse and Mental Health Services Administration (SAMHSA). In addition to these sources, information gathered from the National Library of Medicine, the United States Patent Office, the European Union, and their related organizations has been invaluable in the creation of this book. Some of the work represented was financially supported by the Research and Development Committee at INSEAD. This support is gratefully acknowledged. Finally, special thanks are owed to Tiffany Freeman for her excellent editorial support.
v
About the Editors James N. Parker, M.D. Dr. James N. Parker received his Bachelor of Science degree in Psychobiology from the University of California, Riverside and his M.D. from the University of California, San Diego. In addition to authoring numerous research publications, he has lectured at various academic institutions. Dr. Parker is the medical editor for health books by ICON Health Publications. Philip M. Parker, Ph.D. Philip M. Parker is the Eli Lilly Chair Professor of Innovation, Business and Society at INSEAD (Fontainebleau, France and Singapore). Dr. Parker has also been Professor at the University of California, San Diego and has taught courses at Harvard University, the Hong Kong University of Science and Technology, the Massachusetts Institute of Technology, Stanford University, and UCLA. Dr. Parker is the associate editor for ICON Health Publications.
vi
About ICON Health Publications To discover more about ICON Health Publications, simply check with your preferred online booksellers, including Barnes&Noble.com and Amazon.com which currently carry all of our titles. Or, feel free to contact us directly for bulk purchases or institutional discounts: ICON Group International, Inc. 4370 La Jolla Village Drive, Fourth Floor San Diego, CA 92122 USA Fax: 858-546-4341 Web site: www.icongrouponline.com/health
vii
Table of Contents FORWARD .......................................................................................................................................... 1 CHAPTER 1. STUDIES ON TOXIC SHOCK SYNDROME ........................................................................ 3 Overview........................................................................................................................................ 3 The Combined Health Information Database................................................................................. 3 Federally Funded Research on Toxic Shock Syndrome .................................................................. 5 E-Journals: PubMed Central ....................................................................................................... 16 The National Library of Medicine: PubMed ................................................................................ 19 CHAPTER 2. NUTRITION AND TOXIC SHOCK SYNDROME .............................................................. 65 Overview...................................................................................................................................... 65 Finding Nutrition Studies on Toxic Shock Syndrome................................................................. 65 Federal Resources on Nutrition ................................................................................................... 68 Additional Web Resources ........................................................................................................... 68 CHAPTER 3. ALTERNATIVE MEDICINE AND TOXIC SHOCK SYNDROME ........................................ 71 Overview...................................................................................................................................... 71 National Center for Complementary and Alternative Medicine.................................................. 71 Additional Web Resources ........................................................................................................... 73 General References ....................................................................................................................... 74 CHAPTER 4. DISSERTATIONS ON TOXIC SHOCK SYNDROME .......................................................... 75 Overview...................................................................................................................................... 75 Dissertations on Toxic Shock Syndrome...................................................................................... 75 Keeping Current .......................................................................................................................... 76 CHAPTER 5. PATENTS ON TOXIC SHOCK SYNDROME..................................................................... 77 Overview...................................................................................................................................... 77 Patents on Toxic Shock Syndrome ............................................................................................... 77 Patent Applications on Toxic Shock Syndrome ........................................................................... 90 Keeping Current .......................................................................................................................... 94 CHAPTER 6. BOOKS ON TOXIC SHOCK SYNDROME ........................................................................ 95 Overview...................................................................................................................................... 95 Book Summaries: Federal Agencies.............................................................................................. 95 Book Summaries: Online Booksellers........................................................................................... 96 The National Library of Medicine Book Index ............................................................................. 97 Chapters on Toxic Shock Syndrome............................................................................................. 97 CHAPTER 7. MULTIMEDIA ON TOXIC SHOCK SYNDROME ............................................................. 99 Overview...................................................................................................................................... 99 Bibliography: Multimedia on Toxic Shock Syndrome.................................................................. 99 CHAPTER 8. PERIODICALS AND NEWS ON TOXIC SHOCK SYNDROME ........................................ 101 Overview.................................................................................................................................... 101 News Services and Press Releases.............................................................................................. 101 Academic Periodicals covering Toxic Shock Syndrome ............................................................. 103 CHAPTER 9. RESEARCHING MEDICATIONS .................................................................................. 105 Overview.................................................................................................................................... 105 U.S. Pharmacopeia..................................................................................................................... 105 Commercial Databases ............................................................................................................... 106 APPENDIX A. PHYSICIAN RESOURCES .......................................................................................... 111 Overview.................................................................................................................................... 111 NIH Guidelines.......................................................................................................................... 111 NIH Databases........................................................................................................................... 113 Other Commercial Databases..................................................................................................... 115 APPENDIX B. PATIENT RESOURCES ............................................................................................... 117 Overview.................................................................................................................................... 117 Patient Guideline Sources.......................................................................................................... 117
viii Contents
Finding Associations.................................................................................................................. 122 APPENDIX C. FINDING MEDICAL LIBRARIES ................................................................................ 125 Overview.................................................................................................................................... 125 Preparation................................................................................................................................. 125 Finding a Local Medical Library................................................................................................ 125 Medical Libraries in the U.S. and Canada ................................................................................. 125 ONLINE GLOSSARIES................................................................................................................ 131 Online Dictionary Directories ................................................................................................... 135 TOXIC SHOCK SYNDROME DICTIONARY ......................................................................... 137 INDEX .............................................................................................................................................. 189
1
FORWARD In March 2001, the National Institutes of Health issued the following warning: "The number of Web sites offering health-related resources grows every day. Many sites provide valuable information, while others may have information that is unreliable or misleading."1 Furthermore, because of the rapid increase in Internet-based information, many hours can be wasted searching, selecting, and printing. Since only the smallest fraction of information dealing with toxic shock syndrome is indexed in search engines, such as www.google.com or others, a non-systematic approach to Internet research can be not only time consuming, but also incomplete. This book was created for medical professionals, students, and members of the general public who want to know as much as possible about toxic shock syndrome, using the most advanced research tools available and spending the least amount of time doing so. In addition to offering a structured and comprehensive bibliography, the pages that follow will tell you where and how to find reliable information covering virtually all topics related to toxic shock syndrome, from the essentials to the most advanced areas of research. Public, academic, government, and peer-reviewed research studies are emphasized. Various abstracts are reproduced to give you some of the latest official information available to date on toxic shock syndrome. Abundant guidance is given on how to obtain free-of-charge primary research results via the Internet. While this book focuses on the field of medicine, when some sources provide access to non-medical information relating to toxic shock syndrome, these are noted in the text. E-book and electronic versions of this book are fully interactive with each of the Internet sites mentioned (clicking on a hyperlink automatically opens your browser to the site indicated). If you are using the hard copy version of this book, you can access a cited Web site by typing the provided Web address directly into your Internet browser. You may find it useful to refer to synonyms or related terms when accessing these Internet databases. NOTE: At the time of publication, the Web addresses were functional. However, some links may fail due to URL address changes, which is a common occurrence on the Internet. For readers unfamiliar with the Internet, detailed instructions are offered on how to access electronic resources. For readers unfamiliar with medical terminology, a comprehensive glossary is provided. For readers without access to Internet resources, a directory of medical libraries, that have or can locate references cited here, is given. We hope these resources will prove useful to the widest possible audience seeking information on toxic shock syndrome. The Editors
1
From the NIH, National Cancer Institute (NCI): http://www.cancer.gov/cancerinfo/ten-things-to-know.
3
CHAPTER 1. STUDIES ON TOXIC SHOCK SYNDROME Overview In this chapter, we will show you how to locate peer-reviewed references and studies on toxic shock syndrome.
The Combined Health Information Database The Combined Health Information Database summarizes studies across numerous federal agencies. To limit your investigation to research studies and toxic shock syndrome, you will need to use the advanced search options. First, go to http://chid.nih.gov/index.html. From there, select the “Detailed Search” option (or go directly to that page with the following hyperlink: http://chid.nih.gov/detail/detail.html). The trick in extracting studies is found in the drop boxes at the bottom of the search page where “You may refine your search by.” Select the dates and language you prefer, and the format option “Journal Article.” At the top of the search form, select the number of records you would like to see (we recommend 100) and check the box to display “whole records.” We recommend that you type “toxic shock syndrome” (or synonyms) into the “For these words:” box. Consider using the option “anywhere in record” to make your search as broad as possible. If you want to limit the search to only a particular field, such as the title of the journal, then select this option in the “Search in these fields” drop box. The following is what you can expect from this type of search: •
Toxic Shock and Down Syndromes in a Dental Patient: A Case Report and Review of the Literature Source: Special Care in Dentistry. 14(6): 246-251. November-December 1994. Summary: In this article, the authors first present a literature review of toxic shock syndrome (TSS), including epidemiology, etiology, signs, symptoms and management, and its relationship to infection susceptibility in the Down syndrome patient. The authors then present a case of a Down syndrome patient with TSS, focusing on the role of odontogenic infection. They report the patient's medical history, social history, and dental history. They conclude with a discussion of the management of the dental patient with a TSS history. 3 figures. 2 tables. 42 references. (AA-M).
4
Toxic Shock Syndrome
•
Syndromes with Renal Failure and Shock Source: Pediatric Nephrology. 8(2): 223-229. April 1994. Contact: Available from Springer-Verlag. Service Center Secaucus, 44 Hartz Way, Secaucus, NJ 07094. (201) 348-4033. Summary: Renal failure occurs commonly in children with shock, coagulopathy, and multi-organ failure. This article reviews the clinical and epidemiological features of the syndromes with shock and renal failure, focusing on the more recently recognized syndromes such as staphylococcal and streptococcal toxic shock syndrome, hemorrhagic shock and encephalopathy syndrome, and viral hemorrhagic fevers. The author stresses that successful management of these patients requires not only management of the renal failure but recognition and treatment of the underlying process. One chart summarizes the conditions associated with each disease. Information is noted on age; presence of fever, rash, shock, encephalopathy, disseminated intravascular coagulation (DIC), thrombocytopenia, and renal pathology; geographic localization; and predisposing factors. 1 table. 49 references. (AA-M).
•
Evaluating the Febrile Patient With a Rash Source: American Family Physician. 62(4): 804-816. August 15, 2000. Contact: American Academy of Family Physicians. 11400 Tomahawk Creek Parkway, Leawood, KS 66211-2672. (800) 274-2237 or (913) 906-6000. E-mail:
[email protected]. Website: www.aafp.org. Summary: This journal article provides health professionals with information on evaluating the febrile patient with a rash. Evaluating the patient who presents with fever and a rash can be challenging because the differential diagnosis is extensive and includes both minor and life threatening illnesses. Diseases that present with fever and rash are usually classified according to the morphology of the primary lesion. Rashes can be categorized as maculopapular, petechial, diffusely erythematous with desquamation, vesiculobullous pustular, and nodular. Centrally distributed maculopapular eruptions are more common than peripheral eruptions. These eruptions include rashes that begin centrally, first affecting the head and neck, and then progress peripherally. The most common peripheral eruptive maculopapular rash is erythema multiforme. Petechial eruptions warrant immediate evaluation to rule out severe, life threatening illness. Diffuse erythema desquamation occurs in scarlet fever, toxic shock syndrome, scalded skin syndrome, and Kawasaki's disease. Vesiculobullous pustular eruptions are those that occur in chickenpox and shingles. Nodular eruptions are a characteristic feature of erythema nodosum. Potential causes of fever and rash include viruses, bacteria, spirochetes, rickettsiae, medications, and rheumatologic diseases. A thorough history and a careful physical examination are essential to a correct diagnosis. Although laboratory studies can be useful in confirming the diagnosis, test results are often not available immediately. The severity of these illnesses can vary from minor to life threatening, so the family physician must make prompt management decisions on empiric therapy. Hospitalization, isolation, and antimicrobial therapy must often be considered with a patient presents with fever and a rash. 9 figures, 4 tables, and 21 references. (AA-M).
•
Rashes and Fever: Part 4, Sorting Out Potentially Dangerous Causes Source: Consultant. 39(10): 2849-2854. October 1999.
Studies
5
Summary: This journal article, the last in a four part series, provides health professionals with information on the diagnosis and treatment of patients who present with acute rash and fever. Vasculitides such as Wegener's granulomatosis and polyarteritis nodosa may present with palpable purpura and necrotic ulcers, as well as renal disease. Diagnosis of these diseases affecting medium sized blood vessels is through a biopsy of affected tissue. Cyclophosphamide and prednisone are recommended for the initial treatment of Wegener's granulomatosis and polyarteritis nodosa. Toxic shock syndrome (TSS) is characterized by the sudden onset of high fever, vomiting, diarrhea, headache, hypotension, decreased urinary output, and shock. The blanching, scarlatiniform, erythematous rash appears early in the illness and generally fades within a few days. Diagnosis of TSS is made by assessing the clinical presentation and conducting laboratory tests and antibiotics are used as treatment. Kawasaki disease typically affects children younger than 5. The associated rash may vary in morphology. It can be macular, papular, morbilliform maculopapular, scarlatiniform erythrodermic, or target like. No single laboratory test can confirm the diagnosis of Kawasaki disease, so the final diagnosis is made by the assessment of certain criteria. A single infusion of intravenous gamma globulin should be initiated in the acute setting. The cutaneous lesions of staphylococcal scalded skin syndrome occur in the perineal or periumbilical regions in neonates and on the extremities in older children. Diagnosis is based on the clinical findings confirmed by bacterial cultures and skin biopsy. An antistaphylococcal antibiotic is the preferred method of treatment. 3 figures, 1 table, and 18 references. (AAM).
Federally Funded Research on Toxic Shock Syndrome The U.S. Government supports a variety of research studies relating to toxic shock syndrome. These studies are tracked by the Office of Extramural Research at the National Institutes of Health.2 CRISP (Computerized Retrieval of Information on Scientific Projects) is a searchable database of federally funded biomedical research projects conducted at universities, hospitals, and other institutions. Search the CRISP Web site at http://crisp.cit.nih.gov/crisp/crisp_query.generate_screen. You will have the option to perform targeted searches by various criteria, including geography, date, and topics related to toxic shock syndrome. For most of the studies, the agencies reporting into CRISP provide summaries or abstracts. As opposed to clinical trial research using patients, many federally funded studies use animals or simulated models to explore toxic shock syndrome. The following is typical of the type of information found when searching the CRISP database for toxic shock syndrome: •
Project Title: CARDIOTOXICITY OF STREPTOCOCCAL PYROGENIC EXOTOXINS Principal Investigator & Institution: Schlievert, Patrick M.; Professor; Microbiology; University of Minnesota Twin Cities 200 Oak Street Se Minneapolis, Mn 554552070 Timing: Fiscal Year 2002; Project Start 01-JUL-1986; Project End 31-MAR-2007
2 Healthcare projects are funded by the National Institutes of Health (NIH), Substance Abuse and Mental Health Services (SAMHSA), Health Resources and Services Administration (HRSA), Food and Drug Administration (FDA), Centers for Disease Control and Prevention (CDCP), Agency for Healthcare Research and Quality (AHRQ), and Office of Assistant Secretary of Health (OASH).
6
Toxic Shock Syndrome
Summary: (provided by applicant): The long term goals of this project are two fold: a) to evaluate the role of pyrogenic toxin superantigens, notably streptococcal pyrogenic exotoxins (SPEs, scarlet fever toxins, in causing both acute toxic shock syndrome and vascular illnesses and chronic autoimmune and allergic diseases, and b) to analyze the structure:function relationships among the SPEs and between the SPEs and the staphylococcal enterotoxins and toxic shock syndrome toxin-1, with the intent of clarifying the molecular mechanisms of action of the toxins, developing toxoid vaccines, and developing useful adjuvants of the toxins. Specific aims of the present application include: a) Biochemical and immunobiological characterization of SPEs J and L, and determining the three dimensional structure of both toxins (complex structures of the SPEs with the variable part of the beta chain of the T cell receptor and major histocompatibility complex II molecules will be determined if such structures are likely to generate new data). Our role in this aim will be to characterize the new SPEs, provide toxins for structural studies, consult on the best conditions for use in crystallization, and preparation and testing mutant toxins for confirmation that important contact residues on the SPEs are required for activity; b) Characterization of SPE C's, and possibly SPE J's ability to cross mucosal surfaces. Studies will include establishment of vaginal epithelial monolayers and stratified epithelium in Transwells and evaluation of the mechanism by which the toxin(s) traverse the layers. We will also evaluate the ability of biologically inactive toxins to permeabilize the epithelium, both in vitro and in rabbits, to other agents, and thus, determine whether the toxoids may be useful as delivery agents (and possibly adjuvants) for transmucosal immunization; and c) Characterization of the mechanism of streptococcal toxic shock syndrome with necrotizing fasciitis in rabbits. We hypothesize that SPEs cause both hypotension and delayed phagocytosis through exaggerated cytokine release, which in turn allows continued growth of the invasive organism with production of necrotizing fasciitis through hemolysins and protease. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen •
Project Title: CHARACTERIZATION OF MUCRS, A VIRULENCE REGULATOR IN GAS Principal Investigator & Institution: Miller, Alita; Laboratory Animal Medicine; University of Michigan at Ann Arbor 3003 South State, Room 1040 Ann Arbor, Mi 481091274 Timing: Fiscal Year 2001; Project Start 01-MAY-2000 Summary: Streptococcus pyogenes (group A streptococcus or GA) is the causative agent of a number of human diseases, including pharyngitis, rheumatic fever, streptococcal toxic shock syndrome and necrotizing fasciitis. Our laboratory recently showed that mucRS is a negative regulatory of three importance virulence factor in GS. The aim of this proposal is to determine the molecular mechanisms involved in mucRS-mediated regulation of gene expression and how this relates in mucRS-mediated regulation of gene expression and how this relates to virulence in GAS. I will (i) characterize the mechanism(s) of repression of MucR, (ii) examine the role of phosphorylation of MucR, (iii) analyze the effect of MucS activity on MucR and (iv) determine the effect of a defined set of environmental conditions of MucRS activity. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen
•
Project Title: DEVELOPMENT OF SUPERANTIGEN ANTAGONISTS Principal Investigator & Institution: Sundberg, Eric J.; None; University of Md Biotechnology Institute Baltimore, Md 212023101
Studies
7
Timing: Fiscal Year 2003; Project Start 15-JUL-2003; Project End 30-JUN-2005 Summary: (provided by applicant): Superantigens (SAGs) comprise a class of toxins that elicit massive T cell proliferation through simultaneous interaction with major histocompatibility complex (MHC) and T cell receptor (TCR) molecules. SAGs have been implicated in the pathogenesis of a number of human diseases, including toxic shock syndrome, food poisoning and several autoimmune disorders, thought to be the result of the stimulation of large numbers of T cells and their subsequent release of inordinate levels of pyrogenic and inflammatory cytokines. Due to their extreme virulence and relative ease with which they could be produced and dispersed throughout a population, SAGs represent credible candidates for biological weapons of mass destruction. Indeed, SAGs have been identified as Category B Agents of Bioterrorism by the Centers for Disease Control and Prevention. The development of therapeutics against SAG-induced disease, against which no drug or vaccine exists, is therefore one important facet of an overall national defense against bioterrorism. We propose to develop a group of engineered TCR fragments with markedly improved affinity for SAGs that will specifically abrogate interactions between SAGs and their cell surface ligands in vivo, thereby inhibiting the pyrogenic cascade in its initial stages and curtailing SAG-induced disease. We will create these SAG-TCR interaction antagonists following a step-wise approach. Milestones along the development pathway for potential therapeutics of SAG-induced disease include (1) structure-function analysis of SAG-TCR interactions, (2) engineering of affinity matured TCR beta domain antagonists, (3) analysis of the in vivo efficacy of antagonists, (4) modification of antagonists to improve the in vivo efficacy, and (5) development of broad spectrum SAG-TCR antagonists. We will focus our initial efforts on guiding an antagonist that has been developed to inhibit interactions between SEC3 and the mouse TCR Vbeta8.2 domain through this development pathway, not only to produce an effective anti-SEC3 therapeutic but also as a general proof-of-principle exercise for the design of anti-SAG biologics. With knowledge gained from studies involving this engineered antagonist, we will shift our focus to targeted antagonism of the numerous hVbeta2.1-specific SAGs by analogous methods. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen •
Project Title: EHRLICHIA CHAFFEENSIS SURFACE PROTEINS Principal Investigator & Institution: Walker, David H.; Professor; Pathology; University of Texas Medical Br Galveston 301 University Blvd Galveston, Tx 77555 Timing: Fiscal Year 2002; Project Start 30-SEP-1991; Project End 31-MAR-2005 Summary: (Adapted from the Applicant's Abstract):The long-term goal of this research project is the elucidation of the mechanisms of protective immunity against Ehrlichia chaffeensis, the causative agent of human monocytotropic ehrlichiosis (HME). Achievement of this goal requires knowledge of the ehrlichial antigens that stimulate protective immunity and of the humoral and cellular immune mechanisms that are effective in the clearance of ehrlichiae from the infected macrophages throughout the body. HME is a life-threatening tick-borne infection that has been associated with toxic shock syndrome-like manifestations, adult respiratory distress syndrome, meningitis, and disseminated intravascular coagulation in immunocompetent patients, overwhelming opportunistic infection in immunocompromised patients, and a fatality rate of 2.7%. The specific aims, designed to test the hypothesis that the immunodominant, surface-exposed p 120 and p28-family stimulate protective immunity by a combination of antibodies and cellular mechanisms, are 1) to determine the roles of proteins of the p28 family and pl2O in stimulating protective immunity in a mouse
8
Toxic Shock Syndrome
model of HME against an organism closely related to E. chaffeensis, an Ehrlichia species isolated from Japanese Ixodes ovatus ticks (IOE); 2) to determine the importance and mechanism(s) of antibodies in protective immunity against IOE in the mouse model of HME; and 3) to identify the cellular immune mechanisms that are critical in protective immunity against IOE in the mouse model of HME. The research design includes purification of recombinant pl2O and each member of the p28 family of IOE, production of DNA vaccines expressing each of these proteins, and testing the DNA and recombinant protein vaccines in the highly pathogenic IOE C57BL/6 mouse model. The hypothesis of humorally mediated immunity will be examined by passive immunization studies with specific polyclonal and monoclonal antibodies to p I 2O and the p28 family in IOE-challenged immunocompetent, SCID, and Fc-receptor knockout mice. Opsonization will be investigated in murine and human macrophages in vitro with E. chaffeensis and specific polyclonal and monoclonal antibodies. Cellular immune mechanisms will be elucidated using gene knockout mice (MHC Class I, MHC Class II, 8 T-cell receptor, IFN-Y, perforin, INOS), immunodeficient SCID and Beige, and TNFalpha depleted mice, immunohistochemical and flow cytometric analyses of the cell subsets and their cytokine profiles, adoptive transfer of T-lymphocytes and their subsets including antigen-specific T-cell lines, and determination of the chemokines that are important for immunity to the IOE in an outstanding new mouse model of HME. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen •
Project Title: IMMUNE RESPONSE TO THE GROUP A STREPTOCOCCAL CAPSULE Principal Investigator & Institution: Wessels, Michael R.; Professor; Brigham and Women's Hospital 75 Francis Street Boston, Ma 02115 Timing: Fiscal Year 2001; Project Start 01-JUL-1991; Project End 30-JUN-2005 Summary: Description (Adapted from applicant's abstract): A global increase in invasive group A Streptococcus (GAS) disease (bacteremia, necrotizing fasciitis, and streptococcal toxic shock syndrome) that began in the 1980's has continued through the present decade and has focused attention on investigation of mechanisms of GAS pathogenesis. During the previous funding period, work in their laboratory and others further documented the central role of the hyaluronic acid capsular polysaccharide in GAS virulence in experimental models of local and systemic infection. These studies showed that the capsule interferes with the phagocytic killing, prevents internalization of GAS by epithelial cells, modulates adherence mediated by other GAS surface molecules, and acts as a ligand for attachment of GAS to CD44 on pharyngeal keratinocytes. Despite these other advances, it remains undefined how the capsule or other virulence determinants control the processes of tissue invasion and persistent colonization in the host. During the next funding period, their objectives are to define the role of the hyaluronic acid capsule in invasion of GAS from an epithelial surface to deep tissue, to characterize the effects of capsule on intracellular trafficking of GAS in epithelial keratinocytes, and to determine how regulation of capsule expression in vivo contributes to pathogenesis of GAS infection. The proposed experiments will make use of primary keratinocyte cultures and a model system simulating intact human skin in conjunction with confocal fluorescence microscopy in order to study the tissue and cell biology of GAS translocation through human skin, the phenomenon of persistence within cells, and the regulation of capsule expression at various phases of the infection process. Results of these studies will elucidate the basic pathogenic mechanisms involved in GAS disease and may suggest strategies for intervention. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen
Studies
•
9
Project Title: LEUKOCYTE KINETICS IN THE MICROCIRCULATION Principal Investigator & Institution: Schmid-Schonbein, Geert W.; Professor; University of California San Diego 9500 Gilman Dr, Dept. 0934 La Jolla, Ca 92093 Timing: Fiscal Year 2002 Summary: This abstract is not available. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen
•
Project Title: ANTHRAX
MACROPHAGE-DEPENDENT
IMMUNOPATHOGENESIS
OF
Principal Investigator & Institution: Cook, James L.; Professor; Medicine; University of Illinois at Chicago 1737 West Polk Street Chicago, Il 60612 Timing: Fiscal Year 2002; Project Start 01-SEP-2002; Project End 31-AUG-2004 Summary: Bacillus anthracis can induce a bacteremic phase of infection that is associated with a shock syndrome and a high-level rate of mortality. Most research in this field is focused on toxin production and function. Relatively little is known about the immunopathogenesis of the disease process related to macrophage infection, activation and sensitization to toxin-mediated triggering. Studies using other intracellular pathogens suggest that infection induced macrophage activation is an independent process from toxin-induced triggering of the shock syndrome. The working hypothesis for this proposal is that Bacillus anthracis induces a similar, 2-step process of macrophage activation followed by toxin triggering and that these are two, independent stages of macrophage- related immunopathogenesis of the shock syndrome. The objectives of this project are to establish an animal model of Bacillus anthracis-induced priming and toxin-induced triggering of the shock syndrome to test the hypothesis that these are independent processes. Contrasts will be made with the well-establish model of BCK-induced priming and endotoxin-induced triggering of the shock response. In vitro corollaries of infection-induced macrophage activation will test the phenotypic and functional changes of macrophage function following Bacillus anthracis infection in vivo and in vitro. Preliminary studies will test the linkage between infection-induced macrophage activation and triggering of the NF kappa B-dependent transcription response. Complementary in vitro studies will be used to test the prediction that toxin-induced triggering of activated macrophage populations will result in changes in toxin receptor expression, cytokine production and nitric oxide production and NF kappa B activation. The long-term objective is to develop an animal model and in vitro cell systems to test the functional relationships between Bacillus anthracisinduced macrophage activation and toxin-mediated triggering of activated macrophage functions that in part mediate the shock syndrome. This information will be used to seem molecular interventions that reduce or abrogate the shock response to this infection. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen •
Project Title: MECHANISM OF ACTION OF CYTOKINES ON BRAIN AND PITUITARY Principal Investigator & Institution: Mccann, Samuel M.; Professor and Director; None; Lsu Pennington Biomedical Research Ctr 6400 Perkins Rd Baton Rouge, La 70808 Timing: Fiscal Year 2001; Project Start 01-APR-1995; Project End 31-MAR-2003 Summary: This abstract is not available. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen
10
Toxic Shock Syndrome
•
Project Title: MOLECULAR BIOLOGY OF TSST-1 & OTHER SUPERANTIGEN TOXINS Principal Investigator & Institution: Novick, Richard P.; Professor; Skirball Institute; New York University School of Medicine 550 1St Ave New York, Ny 10016 Timing: Fiscal Year 2002; Project Start 01-SEP-1985; Project End 31-MAR-2006 Summary: This abstract is not available. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen
•
Project Title: MOLECULAR INTERACTIONS BETWEEN SPEA AND THE TCR Principal Investigator & Institution: Collins, Carleen M.; Professor; Microbiology and Immunology; University of Miami-Medical Box 248293 Coral Gables, Fl 33124 Timing: Fiscal Year 2001; Project Start 01-AUG-1998; Project End 30-JUN-2002 Summary: (Adapted from the applicant's abstract): In recent years in both this country and abroad, there has been a resurgence of acute, often life threatening infections due to Streptococcus pyogenes (group A streptococcus). Many patients experience symptoms mimicking this associated with staphylococcal toxic shock syndrome, and the designation streptococcal toxic shock syndrome (STSS) has been assigned to these invasive streptococcal infections. There is strong epidemiologic evidence implicating streptococcal pyrogenic exotoxin A (SpeA) in the pathogenesis of STSS. SpeA is a bacterial superantigen that is capable, in combination with class II major histocompatibility molecules, of activating a large fraction of T cells. The pathology of STSS and other bacterial superantigen mediated disease is believed to result from the massive and unregulated release of bioactive cytokines from the activated T cells. SpeA and other bacterial (and viral) proteins have been termed superantigens due to their unique mechanisms of interacting with the class II MHC expressing antigen-presenting cells and the T lymphocytes. Superantigens bind to class II MHC as intact molecules at sites distinct from the antigen-presenting groove. In addition to binding the class II MHC molecule, superantigens interact with the T cell receptor (TCR) in regions encoded by the V-gene segments. Each superantigen activates a specific set of V-beta chainencoding T cell, and thus is able to activate a much larger percentage of the T cell population than conventional peptide antigens. The goals of this grant proposal are to examine in detail the interaction between SpeA and the human TCR. The amino acid residues of SpeA needed for a productive TCR interaction will be defined. V-beta chains amino acids residues needed for a productive interaction with SpeA will be identified. These studies will include measurements of the affinities of the toxin- V-beta interactions. In addition, the X ray crystal structure of the toxin, mutant and allelic toxin forms, as well as the toxin completed with a human V-beta chain will be determined. These data will help characterize the interaction needed for activation of a T cell by the superantigen. In addition, the data obtained here are the first step in the design and development of compounds, such as TCR specific peptides, to interfere with the SpeATCR interaction, and in turn prevent SpeA from acting as a superantigen. It is possible that components that can specifically block the superantigenic capabilities of SpeA might prove useful as treatments to ameliorate and possibly prevent STSS in an infected individual. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen
Studies
•
11
Project Title: MYCOPLASMA SUPERANTIGEN MAM IN DISEASE AND AUTOIMMUNITY Principal Investigator & Institution: Cole, Barry C.; Professor; Internal Medicine; University of Utah Salt Lake City, Ut 84102 Timing: Fiscal Year 2001; Project Start 01-MAR-1978; Project End 30-NOV-2003 Summary: (Adapted from the applicant's abstract): The overall goal of this project is to utilize the Mycoplasma arthritidis mitogen (MAM), a model superantigen, (SAg) to define how these substances influence the immune systems of their natural hosts, how they contribute to disease by the organisms that produce them and finally how they interact with compromised hosts leading to immune- mediated or autoimmune disease. Using homogeneous native MAM and/or rMAM-his the investigators will: 1. Define the in vivo effect of MAM on the normal murine host in respect to comparison of different mouse strains; identification of responding cell types; determine the requirements for immunoenhancement vs. immunosuppression; examine the effect of chronic exposure of mice to MAM and neutralization of the in vivo effects of MAM by passive or active immunization. 2. Elucidate the role of MAM in disease induced by M. arthritidis in respect to understanding the mechanisms of lethal toxic shock syndrome and necrotizing fasciitis, acute and chronic arthritis including the role of cytokines specifically produced by MAM or constitutively as a result of host genes; protection against the pathological effects due to MAM by administration of a mutant MAM vaccine and determination of the role played by the potential synergistic effects of MAM and other biologically-active components of M. arthritidis. 3. Determine the mechanisms by which MAM influences the development of autoimmunity by use of collageninduced arthritis of mice and experimental allergic encephalomyelitis. Specifically the investigator shall define the role played by SAg-induced cytokines and protection against disease using the MAM vaccines described earlier. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen
•
Project Title: NOVEL THERAPY FOR STAPHYLOCOCCAL INFECTION Principal Investigator & Institution: Wright, Susan C.; Senior Scientist; Panorama Research, Inc. 2462 Wyandotte St Mountain View, Ca 94043 Timing: Fiscal Year 2001; Project Start 01-APR-2000; Project End 31-AUG-2003 Summary: The emergence of antibiotic-resistant Staphylococcus aureus has created an urgent need for new therapeutic approaches to treat the variety of diseases caused by this common pathogen. S. aureus damages host tissues by the secretion of a variety of toxic exomolecules known as virulence factors. The expression of these factors is controlled by an autocrine regulatory system whereby bacteria secrete autoinducing pheromone peptides that act on the cell to upregulate expression of the set of genes encoding virulence factors. This proposal is based on the serendipitous discovery of a modified peptide contaminating a batch of synthetic pheromone peptide based on the sequence of a non- pathogenic strain of Staphylococcus. This peptide, called virulence inhibitory factor (VIF), inhibited synthesis of alpha toxin and toxic shock syndrome toxin in all Staphylococcal strains tested. Further studies revealed that small molecule analogs of VIF inhibited virulence factor production in vitro and protected mice from a lethal systemic S. aureus infection. The goal of this proposal is to evaluate a large panel of small VIF analogs in vitro and select the best drug candidate for further studies in vivo. Proposed studies include pharmacology, toxicology, and various animal models of S. aureus infection in preparation of an IND. This novel therapeutic approach has promise in the treatment of antibiotic-resistant Staphylococci. PROPOSED
12
Toxic Shock Syndrome
COMMERCIAL APPLICATIONS: Due to the emergence of drug-resistant strains of Staphylococci, many infections are not treatable with conventional antibiotics. The pathogenesis of Staph. infections depend on the production of virulence factors that promote bacterial colonization and are toxic to the host tissues. The present application proposes to develop a novel drug that inhibits production of virulence factors and should be therapeutic to antibiotic resistant Staph. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen •
Project Title: PATHOGENESIS AND ETIOLOGY OF KAWASAKI SYNDROME. Principal Investigator & Institution: Leung, Donald Y.; Head, Div of Pediatric Allergy & Immunol; National Jewish Medical & Res Ctr and Research Center Denver, Co 80206 Timing: Fiscal Year 2001; Project Start 15-FEB-2000; Project End 31-JAN-2005 Summary: This abstract is not available. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen
•
Project Title: PHYSICAL BASIS OF T CELL ACTIVATION BY SUPERANTIGENS Principal Investigator & Institution: Mariuzza, Roy A.; Professor; None; University of Md Biotechnology Institute Baltimore, Md 212023101 Timing: Fiscal Year 2001; Project Start 15-APR-2001; Project End 31-MAR-2006 Summary: (provided by applicant): Superantigens (SAGs) are proteins of bacterial or viral origins that stimulate T cells by cross-linking T cell receptors (TCRs) and major histocompatibility (MHC) class II molecules. Stimulation leads to hyperactive responses associated with the massive release of pyrogenic and inflammatory cytokines, usually followed by T cell anergy or deletion. Two classes of SAGs have been identified: exogenous soluble proteins secreted by bacteria, such as the staphylococcal enterotoxins (SEs), and endogenous retroviral-encoded transmembrane proteins, such as the SAGs of mouse mammary tumor viruses (Mtv SAGs). Our goal is to elucidate the physical basis of T cell activation by bacterial and viral SAGs through determination of the threedimensional structure of TCR-SAG and SAG-MHC complexes by X-ray crystallographic techniques and to correlate this information with affinity measurements of TCR-SAG and SAG-MHC interactions. We will determine the crystal structures of representative TCR f3 chain-SAG and SAG-MHC complexes in order to define the diverse strategies that SAGs have evolved for binding TCR and MHC. We previously determined the structures of a mouse TCR f3 chain complexed with SEB. We will now determine the structures of a human TCR B chain complexed with toxic shock syndrome toxin-1 (TSST-1) and streptococcal pyrogenic exotoxin C (SPEC). To identify the high-affinity, Zn2+ dependent SAG binding site on MHC class II, we recently solved the structure of SPEC bound to HLA-DR2a bearing a self-peptide from myelin basic protein (MBP). We will now extend this study to SEA and SED, which cross-link class II molecules on APCs. The structure of the SPEC-DR2a/MBP complex reveals that SPEC makes extensive contacts with the bound MBP peptide, suggesting that peptide can directly influence SAG binding and presentation. The affinity of SPEC for HLA-DR2a molecules bearing analogs of the MBP peptide will be determined. The ability of defined MHC/peptide complexes to present SPEC to T cells will be tested by expressing DR molecules with covalently-linked single peptides on the surface of class Il-negative DAP-3 cells. We also propose to define the kinetic and affinity parameters governing T cell activation by bacterial SAGs by engineering mutants of SPEC and TSST-1 with both higher and lower affinities for TCR and MHC than the wild type toxins. Finally, in order to establish the basis for MHC recognition by viral SAGs, we will express soluble forms
Studies
13
of Mtv7 SAG for use in direct binding and co-crystallization experiments with the I Ed class H molecule. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen •
Project Title: RNA POLYMERASE SIGMA FACTORS IN STREPTOCOCCUS PYOGENES Principal Investigator & Institution: Moran, Charles P.; Professor; Microbiology and Immunology; Emory University 1784 North Decatur Road Atlanta, Ga 30322 Timing: Fiscal Year 2002; Project Start 15-MAR-2002; Project End 28-FEB-2006 Summary: Streptococcus pyogenes (the group A streptococcus or GAS) is an important and common human pathogen. The diseases it causes range from self-limiting skin and throat infections, with, however, the potential for serious sequelae including rheumatic heart disease, acute glomerulonephritis, and possibly pediatric neuropsychological disorders, to severe invasive diseases like myositis and streptococcal toxic shock syndrome. Since single strains of the GAS seem to be able to cause most or all of these diseases, regulation of the expression of GAS genes in response to specific environmental differences within the host is probably key in determining the course of the infectious process. We propose here a new approach to learn more about control of gene expression in the GAS by the characterization of a new RNA polymerase (RNAP) secondary sigma factor needed to transcribe genes under different conditions and the characterization of the genes it regulates. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen
•
Project Title: STRUCTURAL GENOMICS OF S. AUREUS PATHOGENICITY ISLANDS Principal Investigator & Institution: Ohlendorf, Douglas H.; Professor; Biochem/Mole Biol/Biophysics; University of Minnesota Twin Cities 200 Oak Street Se Minneapolis, Mn 554552070 Timing: Fiscal Year 2002; Project Start 15-MAR-2002; Project End 28-FEB-2006 Summary: (provided by applicant): Staphylococcus aureus is a primary human pathogen and a leading cause of hospital-acquired infections (over 700,000 annually), food poisoning, sepsis, and toxic shock syndrome. Currently more than 90 percent of community-isolated strains of S. aureus are resistant to penicillin or its derivatives. The ubiquity of S. aureus and its ability to rapidly develop antibiotic resistance have prompted monitoring by the WHO, the CDC and others. Understanding the basis for the pathogenicity of S. aureus opens the door to the development of new therapeutics to combat infectious diseases produced by this organism. S. aureus produces a number of virulence factors. Sequencing of strains of S. aureus has shed light into how the genes for these factors are organized. Recent studies have revealed that the genes for a number of the pyrogenic toxin superantigens are located on mobile genetic elements called pathogenicity islands that are about 16 kb in size and flanked by direct repeats. Recent microarray analysis of S. aureus pathogenicity island 3 (SaPI3) from strain MN NJ has shown that mRNA is produced for 21 of the 23 ORFs examined. In SaPI3 only 6 of these open reading frames (ORFs) encode for proteins whose sequences are homologous to proteins with a known structural fold. The goal of this project is to use the structural genomics paradigm to investigate the SaPI3 ORFs. If soluble protein cannot be isolated or crystallized for a particular ORF, orthologs from other pathogenicity islands (6 S. aureus pathogenicity islands have been identified to date) will be expressed and studied. Functional hypotheses derived from the structures and analyses of ORF null
14
Toxic Shock Syndrome
mutants will be tested using assays by the principal investigator and his collaborators. The principal investigator has been working on gram-positive pathogens since 1993. Since then workers in the laboratory have determined the structures of staphylococcal toxic shock syndrome toxin-1 (wild type and 8 mutants), of streptococcal pyrogenic exotoxin A, and of staphylococcal exfoliative toxins A and B. Progress toward the goals to this proposal include cloning 22 ORFs of SaPI3, the production of soluble protein from 7 ORFs and the crystallization of proteins from 3 ORFs. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen •
Project Title: SUPERANTIGEN-INDUCED VASCULAR INJURY AND DIC Principal Investigator & Institution: Hawiger, Jack J.; Distinguished Chair and Professor; Microbiology and Immunology; Vanderbilt University 3319 West End Ave. Nashville, Tn 372036917 Timing: Fiscal Year 2001; Project Start 30-SEP-2001; Project End 31-JUL-2005 Summary: (provided by applicant): Superantigens are extremely potent stimulators of T lymphocytes that produce a myriad of proinflammatory cytokines known to induce vascular injury, collapse of vascular system (toxic shock syndrome), and disseminated intravascular coagulation (DIC). The mechanisms by which superantigens induce cytokine production in T cells and subsequent cytokine-evoked injury of vascular system and DIC remain to be elucidated. This highly focused and integrated research plan evolves from recent advances made by us in studying superantigen-induced vascular injury, DIC, and apoptotic organ damage. We propose a series of interrelated studies focused on the mechanism of superantigen-induced signaling in T cells subsets, Th1 and Natural Killer T cells (NKT cells). Superantigen-induced signaling mediated by NF-kappaB and other stress-responsive transcription factors will be studied in T cells and NKT cells to delineate the mechanisms responsible for their death or survival. Their interaction with endothelial cells that express superantigen-binding MHC Class II molecules will be elucidated. Cytokine-induced expression of genes encoding procoagulant proteins, tissue factor and plasminogen activator inhibitor, and their role in superantigen-induced microvascular thrombosis manifested by DIC will be delineated. Finally, cell-permeable peptides and proteins that affect superantigeninduced signaling will be designed and tested in animal models for their efficiency to ameliorate vascular injury, DIC, and apoptotic organ damage. Based on this overall workscope, this grant application is submitted in response to RFA HL-01-003 entitled "Cardiovascular, Lung, and Blood Immunobiology in Health and Disease". Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen
•
Project Title: SUPERANTIGENS--CHARACTERIZATION AND ROLE IN DISEASE Principal Investigator & Institution: Johnson, Howard M.; Graduate Research Professor; Microbiology and Cell Science; University of Florida Gainesville, Fl 32611 Timing: Fiscal Year 2001; Project Start 01-MAR-1988; Project End 28-FEB-2003 Summary: Superantigens may play an important role in cancer, acquired immune deficiency syndrome (AIDS), and arthritis, and staphylococcal enterotoxins are prototype superantigens. The objective of this proposal is to determine the structural basis for staphylococcal enterotoxin superantigen activation of lymphocytes. In particular, the P.I. proposes to determine the structural basis for staphylococcal enterotoxin interaction with both major histocompatibility complex (MHC) class II molecules on antigen-presenting cells and T-cell receptors (TCR) on responding T lymphocytes. This will entail determination of the following structures: certain
Studies
15
staphylococcal enterotoxin superantigens, superantigen sites which interact with receptors, and receptor sites which are bound by these superantigens. These studies should help identify structural motifs which convey the property of superantigenicity, and provide insights into how to modulate such activity. The P.I. proposes to achieve the objective through the specific aims which follow: (1) Identify the binding site(s) on staphylococcal enterotoxin A (SEA) and toxic shock syndrome toxin-1 (TSST-1) for MHC class II molecules and TCR using peptides, recombinant native and mutant molecules, and their antibodies; (2) Determine the structures of SEA and TSST-1 peptides as well as recombinant native and mutant molecules to facilitate identification of structural motifs which convey the property of superantigenicity for possible identification of other superantigens in a variety of systems; (3) Determine the agonist / antagonist properties of SEA and TSST-1 receptor binding peptides and recombinant mutant molecules for enhancement of these properties through peptide engineering; (4) Identify the site(s) on MHC class II molecules and TCR that bind SEA and TSST-1; (5) Determine the modulating effect of enterotoxin superantigens on autoimmune diseases such as experimental allergic encephalomyelitis (EAE); and (6) Determine the structural basis for the interaction of the minor lymphocyte stimulating (Mls) superantigens with MHC class II molecules and TCR and its possible relationship to staphylococcal enterotoxin binding to receptors. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen •
Project Title: T CELL RECOGNITION OF BACTERIAL SUPERANTIGENS Principal Investigator & Institution: Woodland, David L.; Member; Trudeau Institute, Inc. Saranac Lake, Ny 12983 Timing: Fiscal Year 2001; Project Start 01-JAN-1993; Project End 31-DEC-2002 Summary: (Adapted from the Investigator's abstract): Bacterial superantigens are toxins secreted by some strains of staphylococcal and streptococcal bacteria which stimulate a substantial proportion of T-cells resulting in fever and severe, sometimes lethal, toxic shock. It is known that superantigens bind as globular proteins to MHC class II molecules and particular V-beta chains of the T-cell antigen receptor (TCR), and in this way bypass the specificity of the TCR for the peptide/MHC complex. Recently, however, it has been clearly demonstrated that MHC-associated peptides control binding of superantigens to class II molecules and their subsequent presentation to Tcells. This application will continue studies of the mechanisms of peptide-mediated control of T-cell activation by superantigens. Altered peptides will be used in Specific Aim 1 to determine whether the length of the C-terminal region, the ability of the peptide to promote stable versus unstable forms of class II molecules, or the specific sequence of the peptide controls presentation of toxic shock syndrome toxin-1 (TSST-1) to T-cells. In Specific Aim 2, these studies will be extended to other bacterial superantigens, which may use distinct mechanisms to distinguish among MHC antigens loaded with different peptides. Also in this aim, staphyloccal enterotoxin A (SEA) mutants will be used to look individually at superantigen binding to two distinct sites on class II. Studies in Specific Aim 3 will approach the question of the biological significance of peptide discrimination by superantigens. To test the idea that superantigens use MHC-associated peptides to distinguish distinct types of antigen presenting cells (APCs), the investigator will compare the capacity of peptides derived from various types of APCs to promote superantigen presentation and affect the quality of the T-cell response. Cells expressing single peptide/MHC complexes will be used to test the idea that peptide discrimination enhances the T-cell response by limiting the density of superantigen presentation.
16
Toxic Shock Syndrome
Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen
E-Journals: PubMed Central3 PubMed Central (PMC) is a digital archive of life sciences journal literature developed and managed by the National Center for Biotechnology Information (NCBI) at the U.S. National Library of Medicine (NLM).4 Access to this growing archive of e-journals is free and unrestricted.5 To search, go to http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Pmc, and type “toxic shock syndrome” (or synonyms) into the search box. This search gives you access to full-text articles. The following is a sample of items found for toxic shock syndrome in the PubMed Central database: •
A mutation at histidine residue 135 of toxic shock syndrome toxin yields an immunogenic protein with minimal toxicity. by Bonventre PF, Heeg H, Edwards CK 3rd, Cullen CM.; 1995 Feb; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&rendertype=abstr act&artid=173024
•
A Single Clone of Staphylococcus Aureus Causes the Majority of Cases of Toxic Shock Syndrome. by Musser JM, Schlievert PM, Chow AW, Ewan P, Kreiswirth BN, Rosdahl VT, Naidu AS, Witte W, Selander RK.; 1990 Jan 1; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&rendertype=abstr act&artid=53234
•
A toxic shock syndrome toxin 1 mutant that defines a functional site critical for T-cell activation. by Cullen CM, Blanco LR, Bonventre PF, Choi E.; 1995 Jun; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&rendertype=abstr act&artid=173278
•
Application of cross-linked carboxymethyl cellulose degradation by beta-glucosidase and vaginal microbes to toxic shock syndrome. by Sierks MR, Reilly PJ.; 1985 Sep; http://www.pubmedcentral.gov/picrender.fcgi?tool=pmcentrez&action=stream&blobt ype=pdf&artid=238681
•
Biological activity of toxic shock syndrome toxin 1 and a site-directed mutant, H135A, in a lipopolysaccharide-potentiated mouse lethality model. by Stiles BG, Krakauer T, Bonventre PF.; 1995 Apr; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&rendertype=abstr act&artid=173139
•
Combination of flucloxacillin and gentamicin inhibits toxic shock syndrome toxin 1 production by Staphylococcus aureus in both logarithmic and stationary phases of growth. by van Langevelde P, van Dissel JT, Meurs CJ, Renz J, Groeneveld PH.; 1997 Aug; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&rendertype=abstr act&artid=163985
3 4
Adapted from the National Library of Medicine: http://www.pubmedcentral.nih.gov/about/intro.html.
With PubMed Central, NCBI is taking the lead in preservation and maintenance of open access to electronic literature, just as NLM has done for decades with printed biomedical literature. PubMed Central aims to become a world-class library of the digital age. 5 The value of PubMed Central, in addition to its role as an archive, lies in the availability of data from diverse sources stored in a common format in a single repository. Many journals already have online publishing operations, and there is a growing tendency to publish material online only, to the exclusion of print.
Studies
17
•
Comparative Analysis of Lipopolysaccharide-Induced Tumor Necrosis Factor Alpha Activity in Serum and Lethality in Mice and Rabbits Pretreated with the Staphylococcal Superantigen Toxic Shock Syndrome Toxin 1. by Dinges MM, Schlievert PM.; 2001 Nov; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&artid=100117
•
Correlation of Temperature and Toxicity in Murine Studies of Staphylococcal Enterotoxins and Toxic Shock Syndrome Toxin 1. by Stiles BG, Campbell YG, Castle RM, Grove SA.; 1999 Mar; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&artid=96491
•
Delineation by use of specific monoclonal antibodies of the T-cell receptor and major histocompatibility complex interaction sites on the superantigen toxic shock syndrome toxin 1. by Shimonkevitz R, Boen E, Malmstrom S, Brown E, Hurley JM, Kotzin BL, Matsumura M.; 1996 Apr; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&rendertype=abstr act&artid=173894
•
Differential Effects of Staphylococcal Toxic Shock Syndrome Toxin-1 on B Cell Apoptosis. by Hofer MF, Newell K, Duke RC, Schlievert PM, Freed JH, Leung DY.; 1996 May 28; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&rendertype=abstr act&artid=39262
•
Differential induction of Th1 versus Th2 cytokines by group A streptococcal toxic shock syndrome isolates. by Norrby-Teglund A, Lustig R, Kotb M.; 1997 Dec; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&rendertype=abstr act&artid=175750
•
Evolutionary genomics of Staphylococcus aureus: Insights into the origin of methicillin-resistant strains and the toxic shock syndrome epidemic. by Fitzgerald JR, Sturdevant DE, Mackie SM, Gill SR, Musser JM.; 2001 Jul 17; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&artid=37519
•
Incidence of antibodies reactive with toxic shock syndrome toxin 1 in bovine milk. by Thompson NE, Gomez-Lucia E, Bergdoll MS.; 1986 Apr; http://www.pubmedcentral.gov/picrender.fcgi?tool=pmcentrez&action=stream&blobt ype=pdf&artid=238975
•
Induction of Nitric Oxide Synthase Activity by Toxic Shock Syndrome Toxin 1 in a Macrophage-Monocyte Cell Line. by Zembowicz A, Vane JR.; 1992 Mar 15; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&rendertype=abstr act&artid=48594
•
Induction of Tumor Necrosis Factor Alpha and Interleukin-8 Gene Expression in Bronchial Epithelial Cells by Toxic Shock Syndrome Toxin 1. by Aubert V, Schneeberger D, Sauty A, Winter J, Sperisen P, Aubert JD, Spertini F.; 2000 Jan; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&artid=97110
•
Inhibition of Staphylococcal Enterotoxin B-Induced Lymphocyte Proliferation and Tumor Necrosis Factor Alpha Secretion by MAb5, an Anti-Toxic Shock Syndrome Toxin 1 Monoclonal Antibody. by Pang LT, Kum WW, Chow AW.; 2000 Jun; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&artid=97575
18
Toxic Shock Syndrome
•
Involvement of Enterotoxins G and I in Staphylococcal Toxic Shock Syndrome and Staphylococcal Scarlet Fever. by Jarraud S, Cozon G, Vandenesch F, Bes M, Etienne J, Lina G.; 1999 Aug; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&artid=85251
•
Localization of a T-Cell Epitope of Superantigen Toxic Shock Syndrome Toxin 1 to Residues 125 to 158. by Hu WG, Zhu XH, Wu YZ, Jia ZC.; 1998 Oct; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&artid=108616
•
Localization of biologically important regions on toxic shock syndrome toxin 1. by Murray DL, Earhart CA, Mitchell DT, Ohlendorf DH, Novick RP, Schlievert PM.; 1996 Jan; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&rendertype=abstr act&artid=173772
•
Multiplex PCR for Detection of Genes for Staphylococcus aureus Enterotoxins, Exfoliative Toxins, Toxic Shock Syndrome Toxin 1, and Methicillin Resistance. by Mehrotra M, Wang G, Johnson WM.; 2000 Mar; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&artid=86330
•
Oxygen and Carbon Dioxide Regulation of Toxic Shock Syndrome Toxin 1 Production by Staphylococcus aureus MN8. by Yarwood JM, Schlievert PM.; 2000 May; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&artid=86591
•
Production of Toxic Shock Syndrome Toxin 1 by Staphylococcus aureus Requires Both Oxygen and Carbon Dioxide. by Ross RA, Onderdonk AB.; 2000 Sep; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&artid=101779
•
Pyrogenic Toxin Superantigen Site Specificity in Toxic Shock Syndrome and Food Poisoning in Animals. by Schlievert PM, Jablonski LM, Roggiani M, Sadler I, Callantine S, Mitchell DT, Ohlendorf DH, Bohach GA.; 2000 Jun; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&artid=97652
•
Rapid and Specific Detection of Toxigenic Staphylococcus aureus: Use of Two Multiplex PCR Enzyme Immunoassays for Amplification and Hybridization of Staphylococcal Enterotoxin Genes, Exfoliative Toxin Genes, and Toxic Shock Syndrome Toxin 1 Gene. by Becker K, Roth R, Peters G.; 1998 Sep; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&artid=105160
•
Role of a carboxy-terminal site of toxic shock syndrome toxin 1 in eliciting immune responses of human peripheral blood mononuclear cells. by Drynda A, Konig B, Bonventre PF, Konig W.; 1995 Mar; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&rendertype=abstr act&artid=173115
•
Role of T Cells and Gamma Interferon during Induction of Hypersensitivity to Lipopolysaccharide by Toxic Shock Syndrome Toxin 1 in Mice. by Dinges MM, Schlievert PM.; 2001 Mar; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&artid=98015
•
Sequence of the toxic shock syndrome toxin gene (tstH) borne by strains of Staphylococcus aureus isolated from patients with Kawasaki syndrome. by Deresiewicz RL, Flaxenburg J, Leng K, Kasper DL.; 1996 Aug; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&rendertype=abstr act&artid=174235
Studies
19
•
Staphylococcal enterotoxin A and toxic shock syndrome toxin compete with CD4 for human major histocompatibility complex class II binding. by Bavari S, Ulrich RG.; 1995 Feb; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&rendertype=abstr act&artid=173012
•
Structural Basis for Differential Binding of Staphylococcal Enterotoxin A and Toxic Shock Syndrome Toxin 1 to Class II Major Histocompatibility Molecules. by Pontzer CH, Russell JK, Johnson HM.; 1991 Jan 1; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&rendertype=abstr act&artid=50762
•
Temporal Sequence and Kinetics of Proinflammatory and Anti-Inflammatory Cytokine Secretion Induced by Toxic Shock Syndrome Toxin 1 in Human Peripheral Blood Mononuclear Cells. by Kum WW, Cameron SB, Hung RW, Kalyan S, Chow AW.; 2001 Dec; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&artid=98845
•
Toxic shock syndrome toxin 1 (TSST-1) production by staphylococci isolated from goats and presence of specific antibodies to TSST-1 in serum and milk. by Valle J, Vadillo S, Piriz S, Gomez-Lucia E.; 1991 Mar; http://www.pubmedcentral.gov/picrender.fcgi?tool=pmcentrez&action=stream&blobt ype=pdf&artid=182814
•
Toxoids of Streptococcal Pyrogenic Exotoxin A Are Protective in Rabbit Models of Streptococcal Toxic Shock Syndrome. by Roggiani M, Stoehr JA, Olmsted SB, Matsuka YV, Pillai S, Ohlendorf DH, Schlievert PM.; 2000 Sep; http://www.pubmedcentral.gov/articlerender.fcgi?tool=pmcentrez&artid=101724
The National Library of Medicine: PubMed One of the quickest and most comprehensive ways to find academic studies in both English and other languages is to use PubMed, maintained by the National Library of Medicine.6 The advantage of PubMed over previously mentioned sources is that it covers a greater number of domestic and foreign references. It is also free to use. If the publisher has a Web site that offers full text of its journals, PubMed will provide links to that site, as well as to sites offering other related data. User registration, a subscription fee, or some other type of fee may be required to access the full text of articles in some journals. To generate your own bibliography of studies dealing with toxic shock syndrome, simply go to the PubMed Web site at http://www.ncbi.nlm.nih.gov/pubmed. Type “toxic shock syndrome” (or synonyms) into the search box, and click “Go.” The following is the type of output you can expect from PubMed for toxic shock syndrome (hyperlinks lead to article summaries):
6 PubMed was developed by the National Center for Biotechnology Information (NCBI) at the National Library of Medicine (NLM) at the National Institutes of Health (NIH). The PubMed database was developed in conjunction with publishers of biomedical literature as a search tool for accessing literature citations and linking to full-text journal articles at Web sites of participating publishers. Publishers that participate in PubMed supply NLM with their citations electronically prior to or at the time of publication.
20
Toxic Shock Syndrome
•
A cluster of blister-associated toxic shock syndrome in male military trainees and a study of staphylococcal carriage patterns. Author(s): Berkley SF, McNeil JG, Hightower AW, Graves LM, Smith PB, Broome CV. Source: Military Medicine. 1989 October; 154(10): 496-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2515473&dopt=Abstract
•
A family cluster of streptococcal toxic shock syndrome in children: clinical implication and epidemiological investigation. Author(s): Huang YC, Hsueh PR, Lin TY, Yan DC, Hsia SH. Source: Pediatrics. 2001 May; 107(5): 1181-3. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11331706&dopt=Abstract
•
A fatal postpartum Clostridium sordellii associated toxic shock syndrome. Author(s): Bitti A, Mastrantonio P, Spigaglia P, Urru G, Spano AI, Moretti G, Cherchi GB. Source: Journal of Clinical Pathology. 1997 March; 50(3): 259-60. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9155682&dopt=Abstract
•
A mild case of toxic shock syndrome. Author(s): Ponte CD, Traugh C. Source: Drug Intell Clin Pharm. 1983 April; 17(4): 283-5. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6839960&dopt=Abstract
•
A mutation at glycine residue 31 of toxic shock syndrome toxin-1 defines a functional site critical for major histocompatibility complex class II binding and superantigenic activity. Author(s): Kum WW, Wood JA, Chow AW. Source: The Journal of Infectious Diseases. 1996 December; 174(6): 1261-70. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8940217&dopt=Abstract
•
A new therapeutic strategy for streptococcal toxic shock syndrome: a key target for cytokines. Author(s): Kawaguchi T, Igaki N, Kinoshita S, Matsuda T, Kida A, Moriguchi R, Sakai M, Tamada F, Oimomi M, Goto T. Source: Intern Med. 2003 February; 42(2): 211-8. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12636246&dopt=Abstract
•
A review of toxic shock syndrome: the need for education still exists. Author(s): Colbry SL. Source: The Nurse Practitioner. 1992 September; 17(9): 39-40, 43, 46. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=1328970&dopt=Abstract
Studies
21
•
A role for cytokines in toxic shock syndrome? Author(s): Chaves-Carballo E, Bouchama A. Source: The Journal of Pediatrics. 1998 July; 133(1): 169. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9672539&dopt=Abstract
•
A single clone of Staphylococcus aureus causes the majority of cases of toxic shock syndrome. Author(s): Musser JM, Schlievert PM, Chow AW, Ewan P, Kreiswirth BN, Rosdahl VT, Naidu AS, Witte W, Selander RK. Source: Proceedings of the National Academy of Sciences of the United States of America. 1990 January; 87(1): 225-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=1967495&dopt=Abstract
•
A survey into toxic shock syndrome (TSS) in UK burns units. Author(s): Edwards-Jones V, Dawson MM, Childs C. Source: Burns : Journal of the International Society for Burn Injuries. 2000 June; 26(4): 323-33. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10751699&dopt=Abstract
•
A toxic shock syndrome toxin-1 peptide that shows homology to amino acids 180-193 of mycobacterial heat shock protein 65 is presented as conventional antigen. Author(s): Ramesh N, Parronchi P, Ahern D, Romagnani S, Geha R. Source: Immunological Investigations. 1994 November; 23(6-7): 381-91. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=7851957&dopt=Abstract
•
A toxic shock syndrome toxin-1 peptide that shows homology to mycobacterial heat shock protein 18 is presented as conventional antigen to T cells by multiple HLA-DR alleles. Author(s): Ramesh N, Spertini F, Scholl P, Geha R. Source: Journal of Immunology (Baltimore, Md. : 1950). 1992 February 15; 148(4): 102530. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=1737925&dopt=Abstract
•
A variant of toxic shock syndrome. Clinical, microbiologic, and autopsy findings in a fatal case. Author(s): Smith JH, Krull F, Cohen GH, Truant AL, Goldblum R, Haque A, Ladoulis CT. Source: Archives of Pathology & Laboratory Medicine. 1983 July; 107(7): 351-7. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6687993&dopt=Abstract
22
Toxic Shock Syndrome
•
Activation of human T cells by toxic shock syndrome toxin-1: the toxin-binding structures expressed on human lymphoid cells acting as accessory cells are HLA class II molecules. Author(s): Uchiyama T, Imanishi K, Saito S, Araake M, Yan XJ, Fujikawa H, Igarashi H, Kato H, Obata F, Kashiwagi N, et al. Source: European Journal of Immunology. 1989 October; 19(10): 1803-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2583222&dopt=Abstract
•
Activation of in vitro proliferation of human T cells by a synthetic peptide of toxic shock syndrome toxin 1. Author(s): Edwin C, Swack JA, Williams K, Bonventre PF, Kass EH. Source: The Journal of Infectious Diseases. 1991 March; 163(3): 524-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=1995725&dopt=Abstract
•
Acute group G streptococcal myositis associated with streptococcal toxic shock syndrome: case report and review. Author(s): Wagner JG, Schlievert PM, Assimacopoulos AP, Stoehr JA, Carson PJ, Komadina K. Source: Clinical Infectious Diseases : an Official Publication of the Infectious Diseases Society of America. 1996 November; 23(5): 1159-61. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8922817&dopt=Abstract
•
Acute pancreatitis associated with streptococcal toxic shock syndrome. Author(s): Chiu CH, Lin TY, Wu JL. Source: Clinical Infectious Diseases : an Official Publication of the Infectious Diseases Society of America. 1996 April; 22(4): 724-6. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8729223&dopt=Abstract
•
Adjunctive treatment of streptococcal toxic shock syndrome using intravenous immunoglobulin: case report and review. Author(s): Perez CM, Kubak BM, Cryer HG, Salehmugodam S, Vespa P, Farmer D. Source: The American Journal of Medicine. 1997 January; 102(1): 111-3. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9209207&dopt=Abstract
•
Advanced cervical carcinoma presenting with toxic shock syndrome. Author(s): Rose PG, Wilson G. Source: Gynecologic Oncology. 1994 February; 52(2): 264-6. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8314150&dopt=Abstract
•
An NP's experience with toxic shock syndrome. Author(s): Kennedy MA. Source: The Nurse Practitioner. 1992 December; 17(12): 15. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=1465224&dopt=Abstract
Studies
23
•
An outbreak of enteritis induced by methicillin-resistant Staphylococcus aureus producing enterotoxin types A and C, toxic shock syndrome toxin-1 and coagulase type II. Author(s): Kaneko A, Mori T, Fujino T, Nakamura A, Naiki Y, Mutoh M, Nagata A, Kirikae T. Source: Japanese Journal of Infectious Diseases. 2000 October; 53(5): 212-4. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11135710&dopt=Abstract
•
An outbreak of neonatal toxic shock syndrome-like exanthematous disease (NTED) caused by methicillin-resistant Staphylococcus aureus (MRSA) in a neonatal intensive care unit. Author(s): Nakano M, Miyazawa H, Kawano Y, Kawagishi M, Torii K, Hasegawa T, Iinuma Y, Ohta M. Source: Microbiology and Immunology. 2002; 46(4): 277-84. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12061630&dopt=Abstract
•
Analysis of mec regulator genes in clinical methicillin-resistant Staphylococcus aureus isolates according to the production of coagulase, types of enterotoxin, and toxic shock syndrome toxin-1. Author(s): Santo T, Hiyama E, Takesue Y, Matsuura Y, Yokoyama T. Source: Hiroshima J Med Sci. 1999 June; 48(2): 49-56. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10434474&dopt=Abstract
•
Anaphylactoid reaction to ciprofloxacin versus toxic shock syndrome. Author(s): Salon EJ, Newbrough MA, Albarracin CA, Hernandez JE. Source: The Annals of Pharmacotherapy. 1997 January; 31(1): 119-20. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8997481&dopt=Abstract
•
Another toxic shock syndrome. Streptococcal infection is even more dangerous than the staphylococcal form. Author(s): Hauser AR. Source: Postgraduate Medicine. 1998 December; 104(6): 31-4, 39, 43-4. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9861255&dopt=Abstract
•
Apparent lower rates of streptococcal toxic shock syndrome and lower mortality in children with invasive group A streptococcal infections compared with adults. Author(s): Davies HD, Matlow A, Scriver SR, Schlievert P, Lovgren M, Talbot JA, Low DE. Source: The Pediatric Infectious Disease Journal. 1994 January; 13(1): 49-56. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8170732&dopt=Abstract
24
Toxic Shock Syndrome
•
Association of phenotypic and genotypic characteristics of invasive Streptococcus pyogenes isolates with clinical components of streptococcal toxic shock syndrome. Author(s): Talkington DF, Schwartz B, Black CM, Todd JK, Elliott J, Breiman RF, Facklam RR. Source: Infection and Immunity. 1993 August; 61(8): 3369-74. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8335368&dopt=Abstract
•
Association of toxic shock syndrome toxin-secreting and exfoliative toxin-secreting Staphylococcus aureus with Kawasaki syndrome complicated by coronary artery disease. Author(s): Rowley AH, Shulman ST. Source: Pediatric Research. 1998 February; 43(2): 291-3. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9475299&dopt=Abstract
•
Association of toxic shock syndrome toxin-secreting and exfoliative toxin-secreting Staphylococcus aureus with Kawasaki syndrome complicated by coronary artery disease. Author(s): Leung DY, Sullivan KE, Brown-Whitehorn TF, Fehringer AP, Allen S, Finkel TH, Washington RL, Makida R, Schlievert PM. Source: Pediatric Research. 1997 September; 42(3): 268-72. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9284264&dopt=Abstract
•
Awareness, knowledge and perceived risk for toxic shock syndrome in relation to health behavior. Author(s): Riggs RS, Noland MP. Source: The Journal of School Health. 1983 May; 53(5): 303-7. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6553697&dopt=Abstract
•
Bacteremic nonmenstrual staphylococcal toxic shock syndrome associated with enterotoxins A and C. Author(s): Czachor J, Herchline T. Source: Clinical Infectious Diseases : an Official Publication of the Infectious Diseases Society of America. 2001 February 1; 32(3): E53-6. Epub 2001 January 24. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11170971&dopt=Abstract
•
Bacterial croup and toxic shock syndrome. Author(s): Chenaud M, Leclerc F, Martinot A. Source: European Journal of Pediatrics. 1986 September; 145(4): 306-7. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=3769999&dopt=Abstract
Studies
25
•
Bacterial interference and toxic shock syndrome. Author(s): Tagg JR, Peters G, Gray ED, Wannamaker LW. Source: Annals of Internal Medicine. 1983 December; 99(6): 879-80. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6651039&dopt=Abstract
•
Bacterial laryngotracheitis associated with toxic shock syndrome in an adult. Author(s): Dann EJ, Weinberger M, Gillis S, Parsonnet J, Shapiro M, Moses AE. Source: Clinical Infectious Diseases : an Official Publication of the Infectious Diseases Society of America. 1994 March; 18(3): 437-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8011830&dopt=Abstract
•
Bacterial tracheitis associated with respiratory syncytial virus infection and toxic shock syndrome. Author(s): Nijssen-Jordan C, Donaldson JD, Halperin SA. Source: Cmaj : Canadian Medical Association Journal = Journal De L'association Medicale Canadienne. 1990 February 1; 142(3): 233-4. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2302615&dopt=Abstract
•
Barrier contraceptives and toxic shock syndrome. Author(s): Lee R, Dillon WP, Baehler E. Source: Lancet. 1982 January 23; 1(8265): 221-2. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6119576&dopt=Abstract
•
Bee bite and the toxic shock syndrome. Author(s): Klug R, Immerman R, Giron JA. Source: Annals of Internal Medicine. 1982 March; 96(3): 382. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=7059111&dopt=Abstract
•
Binding competition of toxic shock syndrome toxin 1 and other staphylococcal exoproteins for receptors on human peripheral blood mononuclear cells. Author(s): See RH, Krystal G, Chow AW. Source: Infection and Immunity. 1990 July; 58(7): 2392-6. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=1694828&dopt=Abstract
•
Binding of type-I and type-II collagens to Staphylococcus aureus strains isolated from patients with toxic shock syndrome compared to other staphylococcal infections. Author(s): Naidu AS, Ekstrand J, Wadstrom T. Source: Fems Microbiol Immunol. 1989 March; 1(4): 219-27. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2629906&dopt=Abstract
26
Toxic Shock Syndrome
•
Biological properties of toxic shock syndrome exotoxin. Author(s): Schlievert PM. Source: Surv Synth Pathol Res. 1984; 3(1): 54-62. No Abstract Available. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6505480&dopt=Abstract
•
Bullae in a patient with toxic shock syndrome. Author(s): Elbaum DJ, Wood C, Abuabara F, Morhenn VB. Source: Journal of the American Academy of Dermatology. 1984 February; 10(2 Pt 1): 267-72. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6715594&dopt=Abstract
•
Carpal tunnel syndrome. Complication of toxic shock syndrome. Author(s): Sahs AL, Helms CM, DuBois C. Source: Archives of Neurology. 1983 July; 40(7): 414-5. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6860177&dopt=Abstract
•
Case report: Molluscum contagiosum. Toxic shock syndrome following cantharidin treatment. Author(s): Langley JM, Soder CM, Schlievert PM, Murray S. Source: Can Fam Physician. 2003 July; 49: 887-9. No Abstract Available. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12901485&dopt=Abstract
•
Case report: streptococcal toxic shock syndrome presenting as septic thrombophlebitis in a child with varicella. Author(s): Cohen-Abbo A, Harper MB. Source: The Pediatric Infectious Disease Journal. 1993 December; 12(12): 1033-4. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8108215&dopt=Abstract
•
Case report: toxic shock syndrome arising from cellulitis. Author(s): DiTomaso A, Warner EA, Holt D, Ritrosky S. Source: The American Journal of the Medical Sciences. 1994 August; 308(2): 110-1. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8042650&dopt=Abstract
•
Cases of streptococcal toxic shock syndrome in Germany since 1989, toxin (mitogen) expression, content of toxin genes and relation to M-serotypes. Author(s): Gunther E, Gerlach D, Reichardt W, Ozegowski JH, Zigann T. Source: Advances in Experimental Medicine and Biology. 1997; 418: 245-8. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9331643&dopt=Abstract
Studies
27
•
Cellular and molecular mechanisms of immune activation by microbial superantigens: studies using toxic shock syndrome toxin-1. Author(s): Chatila T, Scholl P, Ramesh N, Trede N, Fuleihan R, Morio T, Geha RS. Source: Chem Immunol. 1992; 55: 146-71. Review. No Abstract Available. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=1418616&dopt=Abstract
•
Central myonecrosis in a patient with group a beta-hemolytic streptococcus toxic shock syndrome. Author(s): Nichol P, Rod R, Corliss RF, Schurr M. Source: The Journal of Trauma. 2003 November; 55(5): 994-6. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=14608183&dopt=Abstract
•
Characterization of the hemolytic activity of Staphylococcus aureus strains associated with toxic shock syndrome. Author(s): Chow AW, Gribble MJ, Bartlett KH. Source: Journal of Clinical Microbiology. 1983 March; 17(3): 524-8. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6841587&dopt=Abstract
•
Cisplatin therapy-associated recurrent toxic shock syndrome. Author(s): Berman AC, Boly LR. Source: The Western Journal of Medicine. 1991 October; 155(4): 415-6. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=1771888&dopt=Abstract
•
Clinical and microbiological characteristics of severe group A streptococcus infections and streptococcal toxic shock syndrome. Author(s): Forni AL, Kaplan EL, Schlievert PM, Roberts RB. Source: Clinical Infectious Diseases : an Official Publication of the Infectious Diseases Society of America. 1995 August; 21(2): 333-40. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8562741&dopt=Abstract
•
Clinical spectrum of nonmenstrual toxic shock syndrome (TSS): comparison with menstrual TSS by multivariate discriminant analyses. Author(s): Kain KC, Schulzer M, Chow AW. Source: Clinical Infectious Diseases : an Official Publication of the Infectious Diseases Society of America. 1993 January; 16(1): 100-6. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8448283&dopt=Abstract
•
Coagulase-negative staphylococci isolated from two cases of toxic shock syndrome lack superantigenic activity, but induce cytokine production. Author(s): Lina G, Fleer A, Etienne J, Greenland TB, Vandenesch F. Source: Fems Immunology and Medical Microbiology. 1996 January; 13(1): 81-6. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8821402&dopt=Abstract
28
Toxic Shock Syndrome
•
Colony immunoblot assay for the detection of staphylococcal toxic shock syndrome toxin 1 (TSST-1) with anti-TSST-1 F(ab')2 fragments. Author(s): See RH, Adilman S, Bartlett KH, Chow AW. Source: Journal of Clinical Microbiology. 1989 September; 27(9): 2050-3. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2778069&dopt=Abstract
•
Comparison of hemodynamic changes resulting from toxic shock syndrome toxin-1producing Staphylococcus aureus sepsis and endotoxin-producing gram-negative rod sepsis in patients with severe burns. Author(s): Tanaka H, Mituo T, Yukioka T, Matsuda H, Shimazaki S, Igarashi H. Source: The Journal of Burn Care & Rehabilitation. 1995 November-December; 16(6): 616-21. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8582941&dopt=Abstract
•
Comparison of pathogenic factors expressed by group A Streptococci isolated from patients with streptococcal toxic shock syndrome and scarlet fever. Author(s): Shiseki M, Miwa K, Nemoto Y, Kato H, Suzuki J, Sekiya K, Murai T, Kikuchi T, Yamashita N, Totsuka K, Ooe K, Shimizu Y, Uchiyama T. Source: Microbial Pathogenesis. 1999 October; 27(4): 243-52. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10502465&dopt=Abstract
•
Complete heart block in toxic shock syndrome. Author(s): McMahon WS, Patrenos ME, McConnell ME, Tilden SJ. Source: Am J Dis Child. 1990 July; 144(7): 748-50. No Abstract Available. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2356787&dopt=Abstract
•
Congenital streptococcal toxic shock syndrome with absence of antibodies against streptococcal pyrogenic exotoxins. Author(s): Mahieu LM, Holm SE, Goossens HJ, Van Acker KJ. Source: The Journal of Pediatrics. 1995 December; 127(6): 987-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8523204&dopt=Abstract
•
Co-production of staphylococcal enterotoxin A with toxic shock syndrome toxin-1 (TSST-1) enhances TSST-1 mediated mortality in a D-galactosamine sensitized mouse model of lethal shock. Author(s): De Boer ML, Kum WW, Pang LT, Chow AW. Source: Microbial Pathogenesis. 1999 August; 27(2): 61-70. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10458917&dopt=Abstract
Studies
29
•
Cortisol levels and control of inflammatory responses to toxic shock syndrome toxin-1 (TSST-1): the prevalence of night-time deaths in sudden infant death syndrome (SIDS). Author(s): Gordon AE, Al Madani O, Weir DM, Busuttil A, Blackwell C. Source: Fems Immunology and Medical Microbiology. 1999 August 1; 25(1-2): 199-206. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10443509&dopt=Abstract
•
Could nonsteroidal antiinflammatory drugs (NSAIDs) enhance the progression of bacterial infections to toxic shock syndrome? Author(s): Stevens DL. Source: Clinical Infectious Diseases : an Official Publication of the Infectious Diseases Society of America. 1995 October; 21(4): 977-80. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8645850&dopt=Abstract
•
Cryptic alpha-toxin gene in toxic shock syndrome and septicaemia strains of Staphylococcus aureus. Author(s): O'Reilly M, Kreiswirth B, Foster TJ. Source: Molecular Microbiology. 1990 November; 4(11): 1947-55. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2082151&dopt=Abstract
•
Culture independent and rapid identification of bacterial pathogens in necrotising fasciitis and streptococcal toxic shock syndrome by fluorescence in situ hybridisation. Author(s): Trebesius K, Leitritz L, Adler K, Schubert S, Autenrieth IB, Heesemann J. Source: Medical Microbiology and Immunology. 2000 June; 188(4): 169-75. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10917153&dopt=Abstract
•
Damaging effect of toxic shock syndrome toxin 1 on chick embryo cells in vitro. Author(s): Drumm A, de Azavedo JC, Arbuthnott JP. Source: Reviews of Infectious Diseases. 1989 January-February; 11 Suppl 1: S275-80; Discussion S280-1. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2928645&dopt=Abstract
•
Decreased responsiveness of T cells to toxic shock syndrome toxin-1 in patients with severe psoriasis at active stage. Author(s): Yokote R, Tokura Y, Furukawa F, Takigawa M. Source: Archives of Dermatological Research. 1997 August; 289(9): 547-50. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9341976&dopt=Abstract
30
Toxic Shock Syndrome
•
Defining a novel domain of staphylococcal toxic shock syndrome toxin-1 critical for major histocompatibility complex class II binding, superantigenic activity, and lethality. Author(s): Kum WW, Laupland KB, Chow AW. Source: Canadian Journal of Microbiology. 2000 February; 46(2): 171-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10721486&dopt=Abstract
•
Delayed toxic shock syndrome after functional endonasal sinus surgery. Author(s): Younis RT, Lazar RH. Source: Archives of Otolaryngology--Head & Neck Surgery. 1996 January; 122(1): 83-5. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8554751&dopt=Abstract
•
Delayed toxic shock syndrome in sinus surgery. Author(s): Miller W, Stankiewicz JA. Source: Otolaryngology and Head and Neck Surgery. 1994 July; 111(1): 121-3. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8028919&dopt=Abstract
•
Delineation by use of specific monoclonal antibodies of the T-cell receptor and major histocompatibility complex interaction sites on the superantigen toxic shock syndrome toxin 1. Author(s): Shimonkevitz R, Boen E, Malmstrom S, Brown E, Hurley JM, Kotzin BL, Matsumura M. Source: Infection and Immunity. 1996 April; 64(4): 1133-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8606069&dopt=Abstract
•
Detection and quantitation of toxic shock syndrome toxin 1 in vitro and in vivo by noncompetitive enzyme-linked immunosorbent assay. Author(s): Rosten PM, Bartlett KH, Chow AW. Source: Journal of Clinical Microbiology. 1987 February; 25(2): 327-32. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=3818927&dopt=Abstract
•
Detection of antibodies to Staphylococcus aureus Toxic Shock Syndrome Toxin-1 using a competitive agglutination inhibition assay. Author(s): Javid Khojasteh V, Rogan MT, Edwards-Jones V, Foster HA. Source: Letters in Applied Microbiology. 2003; 36(6): 372-6. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12753244&dopt=Abstract
•
Detection of genes for enterotoxins, exfoliative toxins, and toxic shock syndrome toxin 1 in Staphylococcus aureus by the polymerase chain reaction. Author(s): Johnson WM, Tyler SD, Ewan EP, Ashton FE, Pollard DR, Rozee KR. Source: Journal of Clinical Microbiology. 1991 March; 29(3): 426-30. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2037659&dopt=Abstract
Studies
31
•
Detection of staphylococcal enterotoxin B among toxic shock syndrome (TSS)- and non-TSS-associated Staphylococcus aureus isolates. Author(s): Lee VT, Chang AH, Chow AW. Source: The Journal of Infectious Diseases. 1992 October; 166(4): 911-5. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=1527429&dopt=Abstract
•
Detection of staphylococcal toxic shock syndrome toxin 1 by a latex agglutination kit. Author(s): Espersen F, Baek L, Kjaeldgaard P, Rosdahl VT. Source: Scandinavian Journal of Infectious Diseases. 1988; 20(4): 449-50. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=3194712&dopt=Abstract
•
Determination by western blot (immunoblot) of seroconversions to toxic shock syndrome (TSS) toxin 1 and enterotoxin A, B, or C during infection with TSS- and non-TSS-associated Staphylococcus aureus. Author(s): Whiting JL, Rosten PM, Chow AW. Source: Infection and Immunity. 1989 January; 57(1): 231-4. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2909490&dopt=Abstract
•
Development of a multiplex-PCR for direct detection of the genes for enterotoxin B and C, and toxic shock syndrome toxin-1 in Staphylococcus aureus isolates. Author(s): Schmitz FJ, Steiert M, Hofmann B, Verhoef J, Hadding U, Heinz HP, Kohrer K. Source: Journal of Medical Microbiology. 1998 April; 47(4): 335-40. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9569000&dopt=Abstract
•
Development of serum antibody to toxic shock toxin among individuals with toxic shock syndrome in Wisconsin. Author(s): Stolz SJ, Davis JP, Vergeront JM, Crass BA, Chesney PJ, Wand PJ, Bergdoll MS. Source: The Journal of Infectious Diseases. 1985 May; 151(5): 883-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=3989322&dopt=Abstract
•
Development of streptococcal pyrogenic exotoxin C vaccine toxoids that are protective in the rabbit model of toxic shock syndrome. Author(s): McCormick JK, Tripp TJ, Olmsted SB, Matsuka YV, Gahr PJ, Ohlendorf DH, Schlievert PM. Source: Journal of Immunology (Baltimore, Md. : 1950). 2000 August 15; 165(4): 2306-12. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10925320&dopt=Abstract
32
Toxic Shock Syndrome
•
Differential effects of staphylococcal toxic shock syndrome toxin-1 on B cell apoptosis. Author(s): Hofer MF, Newell K, Duke RC, Schlievert PM, Freed JH, Leung DY. Source: Proceedings of the National Academy of Sciences of the United States of America. 1996 May 28; 93(11): 5425-30. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8643591&dopt=Abstract
•
Dissection of the function of HLA class II and costimulation in B cell-mediated and toxic shock syndrome toxin-1-induced T cell proliferation. Author(s): Dennig D, O'Reilly RJ. Source: Journal of Immunology (Baltimore, Md. : 1950). 1993 June 15; 150(12): 5231-40. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=7685791&dopt=Abstract
•
Disseminated aspergillosis in a patient with staphylococcal toxic shock syndrome. Author(s): Bouter PK, Diepersloot RJ, Eggink HD, Remmert HP, Verbrugh HA. Source: The Netherlands Journal of Medicine. 1986; 29(7): 208-11. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=3748246&dopt=Abstract
•
Distribution and expression of toxic shock syndrome toxin 1 gene among Staphylococcus aureus isolates of toxic shock syndrome and non-toxic shock syndrome origin. Author(s): Bonventre PF, Weckbach L, Harth G, Haidaris C. Source: Reviews of Infectious Diseases. 1989 January-February; 11 Suppl 1: S90-5. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2928656&dopt=Abstract
•
Dual infections with Staphylococcus aureus and Streptococcus pyogenes causing toxic shock syndrome. Possible synergistic effects of toxic shock syndrome toxin 1 and streptococcal pyrogenic exotoxin C. Author(s): Smith RJ, Schlievert PM, Himelright IM, Baddour LM. Source: Diagnostic Microbiology and Infectious Disease. 1994 August; 19(4): 245-7. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=7851088&dopt=Abstract
•
Early activation events induced by the staphylococcal superantigen toxic shock syndrome toxin-1 in human peripheral blood monocytes. Author(s): Trede NS, Morio T, Scholl PR, Geha RS, Chatila T. Source: Clinical Immunology and Immunopathology. 1994 February; 70(2): 137-44. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8299229&dopt=Abstract
Studies
33
•
Early and definitive diagnosis of toxic shock syndrome by detection of marked expansion of T-cell-receptor VBeta2-positive T cells. Author(s): Matsuda Y, Kato H, Yamada R, Okano H, Ohta H, Imanishi K, Kikuchi K, Totsuka K, Uchiyama T. Source: Emerging Infectious Diseases. 2003 March; 9(3): 387-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12643839&dopt=Abstract
•
Effect of superantigens on human thymocytes: selective proliferation of V beta 2+ cells in response to toxic shock syndrome toxin-1 and their deletion upon secondary stimulation. Author(s): Mingari MC, Cambiaggi A, Vitale C, Schiavetti F, Bellomo R, Poggi A. Source: International Immunology. 1996 February; 8(2): 203-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8671605&dopt=Abstract
•
Effect of tampon wraps on production of toxic shock syndrome toxin 1. Author(s): Robbins RN, Kelly BJ, Hehl GL, Bergdoll MS. Source: Reviews of Infectious Diseases. 1989 January-February; 11 Suppl 1: S197-202. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2928637&dopt=Abstract
•
Effect of toxic shock syndrome toxin-1 on human hemostatic parameters. Author(s): Gareau R, Gruda J, Micusan VV. Source: Thrombosis Research. 1989 May 15; 54(4): 349-56. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2503907&dopt=Abstract
•
Effects of monoclonal antibody on biologic function of toxic shock syndrome toxin 1 in vitro and in vivo. Author(s): Parsonnet J, Gillis ZA, Thompson MR, Adinolfi L, Bonventre PF. Source: Reviews of Infectious Diseases. 1989 January-February; 11 Suppl 1: S318-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2928650&dopt=Abstract
•
Effects of staphylococcal toxic shock syndrome toxin 1 on aortic endothelial cells. Author(s): Lee PK, Vercellotti GM, Deringer JR, Schlievert PM. Source: The Journal of Infectious Diseases. 1991 October; 164(4): 711-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=1654356&dopt=Abstract
•
Ehrlichiosis presenting as a life-threatening illness with features of the toxic shock syndrome. Author(s): Fichtenbaum CJ, Peterson LR, Weil GJ. Source: The American Journal of Medicine. 1993 October; 95(4): 351-7. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8213865&dopt=Abstract
34
Toxic Shock Syndrome
•
Enterotoxin and toxic shock syndrome toxin-1 production of methicillin resistant and methicillin sensitive Staphylococcus aureus strains. Author(s): Schmitz FJ, MacKenzie CR, Geisel R, Wagner S, Idel H, Verhoef J, Hadding U, Heinz HP. Source: European Journal of Epidemiology. 1997 September; 13(6): 699-708. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9324218&dopt=Abstract
•
Enzymic hydrolysis of tampon carboxymethylcellulose and toxic shock syndrome. Author(s): Tierno PM, Hanna BA. Source: Lancet. 1983 June 18; 1(8338): 1379-80. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6134151&dopt=Abstract
•
Eosinophilia in toxic shock syndrome: review of 20 cases. Author(s): Mert A, Tabak F, Aktuglu Y. Source: Scandinavian Journal of Infectious Diseases. 1998; 30(3): 320. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9790151&dopt=Abstract
•
Epidemiological and clinical aspects of invasive group A streptococcal infections and the streptococcal toxic shock syndrome. Author(s): Eriksson BK, Andersson J, Holm SE, Norgren M. Source: Clinical Infectious Diseases : an Official Publication of the Infectious Diseases Society of America. 1998 December; 27(6): 1428-36. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9868656&dopt=Abstract
•
Epidemiology of toxic shock syndrome toxin-1 production in Staphylococcus aureus strains isolated in Denmark between 1959 and 1990. Author(s): Ejlertsen T, Jensen A, Lester A, Rosdahl VT. Source: Scandinavian Journal of Infectious Diseases. 1994; 26(5): 599-604. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=7855557&dopt=Abstract
•
Evaluation of single-dose cefazolin prophylaxis for toxic shock syndrome. Author(s): Poole MD. Source: Archives of Otolaryngology--Head & Neck Surgery. 1989 February; 115(2): 248. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2914100&dopt=Abstract
•
Evidence of mast cell involvement in a clinical syndrome mimicking toxic shock syndrome. Author(s): Miles SE, Mamlok RJ. Source: The Journal of Allergy and Clinical Immunology. 1992 February; 89(2): 638-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=1740592&dopt=Abstract
Studies
35
•
Evolutionary genomics of Staphylococcus aureus: insights into the origin of methicillin-resistant strains and the toxic shock syndrome epidemic. Author(s): Fitzgerald JR, Sturdevant DE, Mackie SM, Gill SR, Musser JM. Source: Proceedings of the National Academy of Sciences of the United States of America. 2001 July 17; 98(15): 8821-6. Epub 2001 Jul 10. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11447287&dopt=Abstract
•
Exanthematous disease induced by toxic shock syndrome toxin 1 in the early neonatal period. Author(s): Takahashi N, Nishida H, Kato H, Imanishi K, Sakata Y, Uchiyama T. Source: Lancet. 1998 May 30; 351(9116): 1614-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9620715&dopt=Abstract
•
Expanding perspectives on the toxic shock syndrome. Author(s): Freedman JD, Beer DJ. Source: Adv Intern Med. 1991; 36: 363-97. Review. No Abstract Available. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2024587&dopt=Abstract
•
Expression of type 8 capsular polysaccharide and production of toxic shock syndrome toxin 1 are associated among vaginal isolates of Staphylococcus aureus. Author(s): Lee JC, Liu MJ, Parsonnet J, Arbeit RD. Source: Journal of Clinical Microbiology. 1990 December; 28(12): 2612-5. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2279990&dopt=Abstract
•
Extreme lymphocytopenia associated with toxic shock syndrome. Author(s): Galus MA, Stern J. Source: Journal of Internal Medicine. 1998 October; 244(4): 351-4. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9797499&dopt=Abstract
•
Fatal cerebral edema complicating toxic shock syndrome. Author(s): Smith DB, Gulinson J. Source: Neurosurgery. 1988 March; 22(3): 598-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=3362331&dopt=Abstract
•
Fatal group A streptococcal infection with toxic shock syndrome: complicating minor orthopedic trauma. Author(s): Mills WJ, Swiontkowski MF. Source: Journal of Orthopaedic Trauma. 1996; 10(3): 149-55. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8667105&dopt=Abstract
36
Toxic Shock Syndrome
•
Fatal group A streptococcal necrotizing fasciitis and toxic shock syndrome in a patient with psoriasis and chronic renal impairment. Author(s): Chong AH, Burrows NP. Source: The Australasian Journal of Dermatology. 2002 August; 43(3): 194-8. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12121397&dopt=Abstract
•
Fatal toxic shock syndrome as a complication of orthopaedic surgery. A case report. Author(s): Rovner RA, Baird RA, Malerich MM. Source: The Journal of Bone and Joint Surgery. American Volume. 1984 July; 66(6): 9524. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6736096&dopt=Abstract
•
Fatal toxic shock syndrome following endometrial resection. Author(s): Parkin DE. Source: British Journal of Obstetrics and Gynaecology. 1995 February; 102(2): 163-4. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=7756211&dopt=Abstract
•
Fibrinolytic changes in a patient with toxic shock syndrome; release of active u-PA. Author(s): Haj MA, Robbie LA, Croll A, Adey GD, Bennett B. Source: Intensive Care Medicine. 1998 March; 24(3): 258-61. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9565810&dopt=Abstract
•
Fibronectin and toxic shock syndrome. Author(s): Wadstrom T, Rubin K, Ljungh A, Hook M, Switalski LM. Source: Jama : the Journal of the American Medical Association. 1984 July 20; 252(3): 343. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6737622&dopt=Abstract
•
Frequency of toxic shock syndrome toxin- and enterotoxin-producing clinical isolates of Staphylococcus aureus. Author(s): Lehn N, Schaller E, Wagner H, Kronke M. Source: European Journal of Clinical Microbiology & Infectious Diseases : Official Publication of the European Society of Clinical Microbiology. 1995 January; 14(1): 43-6. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=7729452&dopt=Abstract
•
Fulminant hospital-acquired toxic shock syndrome. Author(s): Farber BF, Broome CV, Hopkins CC. Source: The American Journal of Medicine. 1984 August; 77(2): 331-2. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6465178&dopt=Abstract
Studies
37
•
Fulminant infection and toxic shock syndrome caused by Streptococcus pyogenes. Author(s): Fox KL, Born MW, Cohen MA. Source: The Journal of Emergency Medicine. 2002 May; 22(4): 357-66. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12113845&dopt=Abstract
•
Functional analysis of the TCR binding domain of toxic shock syndrome toxin-1 predicts further diversity in MHC class II/superantigen/TCR ternary complexes. Author(s): McCormick JK, Tripp TJ, Llera AS, Sundberg EJ, Dinges MM, Mariuzza RA, Schlievert PM. Source: Journal of Immunology (Baltimore, Md. : 1950). 2003 August 1; 171(3): 1385-92. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12874229&dopt=Abstract
•
Gallium scintigraphy in toxic shock syndrome. Author(s): Moreno AJ, Billingsley JL, Lundy MN, Brown JM, Baker FJ, Graham GD, Brown TJ. Source: Journal of Nuclear Medicine : Official Publication, Society of Nuclear Medicine. 1982 December; 23(12): 1142-4. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6958827&dopt=Abstract
•
Genetic characterization and cloning of the toxic shock syndrome exotoxin. Author(s): Kreiswirth BN, O'Reilly M, Novick RP. Source: Surv Synth Pathol Res. 1984; 3(1): 73-82. No Abstract Available. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6438758&dopt=Abstract
•
Genetic studies on Staphylococcal strains from patients with toxic shock syndrome. Author(s): Kreiswirth BN, Novick RP, Schlievert PM, Bergdoll M. Source: Annals of Internal Medicine. 1982 June; 96(6 Pt 2): 974-7. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6212007&dopt=Abstract
•
Genetics and expression of toxic shock syndrome toxin 1: overview. Author(s): Kreiswirth BN. Source: Reviews of Infectious Diseases. 1989 January-February; 11 Suppl 1: S97-100. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2648542&dopt=Abstract
•
Gonorrhea in female adolescents: potential analogies to toxic shock syndrome. Author(s): Bell TA. Source: Annals of Internal Medicine. 1982 June; 96(6 Pt 2): 924-5. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6807163&dopt=Abstract
38
Toxic Shock Syndrome
•
Gram-negative endotoxins and staphylococcal toxic shock syndrome. Author(s): de Azavedo JC, Hartigan PJ, de Saxe M, Arbuthnott JP. Source: Prog Clin Biol Res. 1985; 189: 419-32. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=4048216&dopt=Abstract
•
Group A beta-hemolytic Streptococcus as a cause of toxic shock syndrome. A case report. Author(s): Whitted RW, Yeomans ER, Hankins GD. Source: J Reprod Med. 1990 May; 35(5): 558-60. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2191134&dopt=Abstract
•
Group A streptococcal meningitis and toxic shock syndrome caused by a protein M type 3 strain producing exotoxin C. Author(s): Guibert M, Livartowski J, Brivet F, Galanaud P, Nordmann P. Source: European Journal of Clinical Microbiology & Infectious Diseases : Official Publication of the European Society of Clinical Microbiology. 1997 April; 16(4): 323-4. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9177970&dopt=Abstract
•
Group A streptococcal toxic shock syndrome and associated respiratory distress. Author(s): Friedman O, Cook SP. Source: Otolaryngology and Head and Neck Surgery. 1999 April; 120(4): 566-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10187961&dopt=Abstract
•
Group A streptococcal toxic shock syndrome developing in the third trimester of pregnancy. Author(s): Crum NF, Chun HM, Gaylord TG, Hale BR. Source: Infectious Diseases in Obstetrics and Gynecology. 2002; 10(4): 209-16. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12648315&dopt=Abstract
•
Group A streptococcal toxic shock syndrome with severe necrotizing fasciitis following hysterectomy--a case report. Author(s): Loscar M, Schelling G, Haller M, Polasek J, Stoll C, Kreimeier U, Finsterer U, Steitz HO, Baumeister R, Kimmig R, Grabein B, Briegel J. Source: Intensive Care Medicine. 1998 February; 24(2): 190-3. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9539081&dopt=Abstract
•
Group A streptococcal toxic shock syndrome. Author(s): Hussain A, Allmad F, McCulloch AJ. Source: Br J Clin Pract. 1995 November-December; 49(6): 336. No Abstract Available. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8554967&dopt=Abstract
Studies
39
•
Group A streptococcal tracheitis associated with toxic shock syndrome. Author(s): Burns JA, Brown J, Ogle JW. Source: The Pediatric Infectious Disease Journal. 1998 October; 17(10): 933-5. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9802646&dopt=Abstract
•
Group A streptococcus and streptococcal toxic shock syndrome: a postpartum case report. Author(s): Golden S. Source: Journal of Midwifery & Women's Health. 2003 September-October; 48(5): 357-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=14526350&dopt=Abstract
•
Growth of Staphylococcus aureus and synthesis of toxic shock syndrome toxin 1 in different in vitro systems. Author(s): Kirkland JJ, Ryan CA, Kohrman KA, Danneman PJ. Source: Reviews of Infectious Diseases. 1989 January-February; 11 Suppl 1: S188-95; Discussion S195-6. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2928636&dopt=Abstract
•
Growth of toxic shock syndrome toxin 1-producing, tryptophan-requiring strains of Staphylococcus aureus associated with the presence of Escherichia coli. Author(s): Chu MC, Melish ME, James JF. Source: Reviews of Infectious Diseases. 1989 January-February; 11 Suppl 1: S101-3. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2648534&dopt=Abstract
•
Historical review of menstrual toxic shock syndrome. Author(s): Hanrahan SN. Source: Women & Health. 1994; 21(2-3): 141-65. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8073784&dopt=Abstract
•
Human bite on penile shaft from oral sex as a portal of entry for streptococcal toxic shock syndrome. Author(s): Behar DM, Edelshtein S, Ben-Ami H, Mansano R, Edoute Y. Source: Isr Med Assoc J. 2000 December; 2(12): 945-7. No Abstract Available. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11344784&dopt=Abstract
•
Human ehrlichiosis with features of toxic shock syndrome. Author(s): Brouqui P, Raoult D. Source: The American Journal of Medicine. 1995 July; 99(1): 107. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=7598131&dopt=Abstract
40
Toxic Shock Syndrome
•
Human mononuclear leukocyte transglutaminase activity is enhanced by streptococcal erythrogenic toxin and a staphylococcal mitogenic factor associated with toxic shock syndrome. Author(s): Zettergren JG, Leifer MJ, Nakashima H, Wuepper KD. Source: Biochimica Et Biophysica Acta. 1984 December 20; 802(3): 385-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6150728&dopt=Abstract
•
Hypercalcitoninemia, hypocalcemia, and toxic shock syndrome. Author(s): Sperber SJ, Blevins DD, Francis JB. Source: Reviews of Infectious Diseases. 1990 September-October; 12(5): 736-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2237110&dopt=Abstract
•
Hyperthyrocalcitoninemia in toxic shock syndrome. Author(s): Heimburger DC. Source: Southern Medical Journal. 1981 October; 74(10): 1265-6. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=7292071&dopt=Abstract
•
Hypocalcaemia and toxic shock syndrome. Author(s): Wagner MA, Batts DH, Colville JM, Lauter CB. Source: Lancet. 1981 May 30; 1(8231): 1208. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6112545&dopt=Abstract
•
Identification from a phage display library of peptides that bind to toxic shock syndrome toxin-1 and that inhibit its binding to major histocompatibility complex (MHC) class II molecules. Author(s): Sato A, Ida N, Fukuyama M, Miwa K, Kazami J, Nakamura H. Source: Biochemistry. 1996 August 13; 35(32): 10441-7. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8756700&dopt=Abstract
•
Identification of class II major histocompatibility complex and T cell receptor binding sites in the superantigen toxic shock syndrome toxin 1. Author(s): Hurley JM, Shimonkevitz R, Hanagan A, Enney K, Boen E, Malmstrom S, Kotzin BL, Matsumura M. Source: The Journal of Experimental Medicine. 1995 June 1; 181(6): 2229-35. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=7760008&dopt=Abstract
•
Immunoglobulin therapy in non-menstrual streptococcal toxic shock syndrome. Author(s): Murthy BV, Nelson RA, Mannion PT. Source: Anaesthesia and Intensive Care. 2003 June; 31(3): 320-3. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12879681&dopt=Abstract
Studies
41
•
Index of suspicion. Case 1. Toxic shock syndrome. Author(s): Spentzas T. Source: Pediatrics in Review / American Academy of Pediatrics. 1999 June; 20(6): 199201. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10352041&dopt=Abstract
•
Index of suspicion. Case 3. Toxic shock syndrome. Author(s): Pandit S. Source: Pediatrics in Review / American Academy of Pediatrics. 1996 September; 17(9): 319, 321-2. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8806205&dopt=Abstract
•
Induction of tumor necrosis factor alpha and interleukin-8 gene expression in bronchial epithelial cells by toxic shock syndrome toxin 1. Author(s): Aubert V, Schneeberger D, Sauty A, Winter J, Sperisen P, Aubert JD, Spertini F. Source: Infection and Immunity. 2000 January; 68(1): 120-4. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10603377&dopt=Abstract
•
Infantile exanthematous disease with elevated anti-toxic shock syndrome toxin-1 antibody: related to toxic shock syndrome toxin-1? Author(s): Imai C, Uchiyama M. Source: Pediatrics International : Official Journal of the Japan Pediatric Society. 2000 April; 42(2): 178-80. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10804737&dopt=Abstract
•
Influence of serum on zinc, toxic shock syndrome toxin-1, and lipopolysaccharideinduced production of IFN-gamma and IL-1 beta by human mononuclear cells. Author(s): Driessen C, Hirv K, Wellinghausen N, Kirchner H, Rink L. Source: Journal of Leukocyte Biology. 1995 June; 57(6): 904-8. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=7790774&dopt=Abstract
•
Inhalational mercury poisoning masquerading as toxic shock syndrome. Author(s): Mohan SB, Tamilarasan A, Buhl M. Source: Anaesthesia and Intensive Care. 1994 June; 22(3): 305-6. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8085634&dopt=Abstract
•
Inhibition of staphylococcal enterotoxin A-induced superantigenic and lethal activities by a monoclonal antibody to toxic shock syndrome toxin-1. Author(s): Kum WW, Chow AW. Source: The Journal of Infectious Diseases. 2001 June 15; 183(12): 1739-48. Epub 2001 May 16. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11372026&dopt=Abstract
42
Toxic Shock Syndrome
•
Inhibition of staphylococcal enterotoxin B-induced lymphocyte proliferation and tumor necrosis factor alpha secretion by MAb5, an anti-toxic shock syndrome toxin 1 monoclonal antibody. Author(s): Pang LT, Kum WW, Chow AW. Source: Infection and Immunity. 2000 June; 68(6): 3261-8. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10816471&dopt=Abstract
•
Inhibition of toxic shock syndrome toxin-1-induced cytokine production and T cell activation by interleukin-10, interleukin-4, and dexamethasone. Author(s): Krakauer T. Source: The Journal of Infectious Diseases. 1995 October; 172(4): 988-92. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=7561220&dopt=Abstract
•
Intracellular expression of toxic shock syndrome toxin 1 in Saccharomyces cerevisiae. Author(s): Deresiewicz RL, Flaxenburg JA, Chan M, Finberg RW, Kasper DL. Source: Infection and Immunity. 1994 June; 62(6): 2202-7. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8188341&dopt=Abstract
•
Intravenous immunoglobulin as adjunctive treatment for streptococcal toxic shock syndrome associated with necrotizing fasciitis: case report and review. Author(s): Cawley MJ, Briggs M, Haith LR Jr, Reilly KJ, Guilday RE, Braxton GR, Patton ML. Source: Pharmacotherapy. 1999 September; 19(9): 1094-8. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10610017&dopt=Abstract
•
Intravenous immunoglobulin G therapy in streptococcal toxic shock syndrome: a European randomized, double-blind, placebo-controlled trial. Author(s): Darenberg J, Ihendyane N, Sjolin J, Aufwerber E, Haidl S, Follin P, Andersson J, Norrby-Teglund A; StreptIg Study Group. Source: Clinical Infectious Diseases : an Official Publication of the Infectious Diseases Society of America. 2003 August 1; 37(3): 333-40. Epub 2003 July 17. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12884156&dopt=Abstract
•
Intravenous immunoglobulin therapy for streptococcal toxic shock syndrome--a comparative observational study. The Canadian Streptococcal Study Group. Author(s): Kaul R, McGeer A, Norrby-Teglund A, Kotb M, Schwartz B, O'Rourke K, Talbot J, Low DE. Source: Clinical Infectious Diseases : an Official Publication of the Infectious Diseases Society of America. 1999 April; 28(4): 800-7. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10825042&dopt=Abstract
Studies
43
•
Invasive group A streptococcal infections: T1M1 isolates expressing pyrogenic exotoxins A and B in combination with selective lack of toxin-neutralizing antibodies are associated with increased risk of streptococcal toxic shock syndrome. Author(s): Eriksson BK, Andersson J, Holm SE, Norgren M. Source: The Journal of Infectious Diseases. 1999 August; 180(2): 410-8. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10395857&dopt=Abstract
•
Invasive group A streptococcus infection of the scrotum and streptococcal toxic shock syndrome. Author(s): Walker BR, Pribble CG, Cartwright PC. Source: Urology. 2000 October 1; 56(4): 669. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11018632&dopt=Abstract
•
Invasive streptococcal group A infection and toxic shock syndrome in Songklanagarind hospital. Author(s): Tongyoo S, Sithinamsuwan P, Apakupakul N, Chayakul P. Source: J Med Assoc Thai. 2002 July; 85(7): 749-56. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12296405&dopt=Abstract
•
Involvement of enterotoxins G and I in staphylococcal toxic shock syndrome and staphylococcal scarlet fever. Author(s): Jarraud S, Cozon G, Vandenesch F, Bes M, Etienne J, Lina G. Source: Journal of Clinical Microbiology. 1999 August; 37(8): 2446-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10405382&dopt=Abstract
•
Kallikrein-kinin system activation in streptococcal toxic shock syndrome. Author(s): Sriskandan S, Cohen J. Source: Clinical Infectious Diseases : an Official Publication of the Infectious Diseases Society of America. 2000 June; 30(6): 961-2. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10880316&dopt=Abstract
•
Knowledge of toxic shock syndrome among adolescent females: a need for education. Author(s): Witzig DK, Ostwald SK. Source: The Journal of School Health. 1985 January; 55(1): 17-20. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=3844569&dopt=Abstract
•
Lack of muco-cutaneous signs of toxic shock syndrome when T cells are absent: S. aureus shock in immunodeficient adults with multiple myeloma. Author(s): Kamel NS, Banks MC, Dosik A, Ursea D, Yarilina AA, Posnett DN. Source: Clinical and Experimental Immunology. 2002 April; 128(1): 131-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12033193&dopt=Abstract
44
Toxic Shock Syndrome
•
Latex agglutination test for staphylococcal toxic shock syndrome toxin 1. Author(s): Igarashi H, Fujikawa H, Shingaki M, Bergdoll MS. Source: Journal of Clinical Microbiology. 1986 March; 23(3): 509-12. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=3082921&dopt=Abstract
•
Left ventricular dysfunction in a patient with toxic shock syndrome. Author(s): Fitz JD, Weeks KD Jr, Duff P. Source: American Journal of Obstetrics and Gynecology. 1983 June 15; 146(4): 467-8. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6859168&dopt=Abstract
•
Levels of toxic shock syndrome toxin-1 production among Staphylococcus aureus strains and clinical implications. Author(s): Naidu AS, Kamme C, Ljungh A, Wadstrom T. Source: Zentralbl Bakteriol Mikrobiol Hyg [a]. 1989 January; 270(3): 337-44. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2648709&dopt=Abstract
•
Localization of a T-cell epitope of superantigen toxic shock syndrome toxin 1 to residues 125 to 158. Author(s): Hu WG, Zhu XH, Wu YZ, Jia ZC. Source: Infection and Immunity. 1998 October; 66(10): 4971-5. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9746605&dopt=Abstract
•
Low incidence of toxic shock syndrome in children with staphylococcal infection. Author(s): Jacobson JA, Kasworm EM, Reiser RF, Bergdoll MS. Source: The American Journal of the Medical Sciences. 1987 December; 294(6): 403-7. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=3425588&dopt=Abstract
•
Magnesium and the pathogenesis of toxic shock syndrome. Author(s): Kass EH. Source: Reviews of Infectious Diseases. 1989 January-February; 11 Suppl 1: S167-73; Discussion S173-5. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2928633&dopt=Abstract
•
Major histocompatibility complex class II-associated peptides determine the binding of the superantigen toxic shock syndrome toxin-1. Author(s): von Bonin A, Ehrlich S, Malcherek G, Fleischer B. Source: European Journal of Immunology. 1995 October; 25(10): 2894-8. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=7589089&dopt=Abstract
Studies
45
•
Management of nonmenstrual toxic shock syndrome. Author(s): Miller G, Cooper M. Source: The Journal of Pediatrics. 1991 May; 118(5): 829-30. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2019949&dopt=Abstract
•
Management of toxic shock syndrome. Author(s): Meeks GR, Lassiter CL. Source: J Miss State Med Assoc. 1990 January; 31(1): 7-11. No Abstract Available. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2304080&dopt=Abstract
•
Managing toxic shock syndrome. Author(s): Michie CA, Shah V. Source: Nurs Times. 2003 February 4-10; 99(5): 26-7. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12640786&dopt=Abstract
•
Mastitis and toxic shock syndrome. Author(s): Demey HE, Hautekeete ML, Buytaert P, Bossaert LL. Source: Acta Obstetricia Et Gynecologica Scandinavica. 1989; 68(1): 87-8. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2801034&dopt=Abstract
•
Maternal antibody against toxic shock syndrome toxin-1 may protect infants younger than 6 months of age from developing Kawasaki syndrome. Author(s): Nomura Y, Yoshinaga M, Masuda K, Takei S, Miyata K. Source: The Journal of Infectious Diseases. 2002 June 1; 185(11): 1677-80. Epub 2002 May 17. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12023778&dopt=Abstract
•
Mediators in the pathogenesis of toxic shock syndrome: overview. Author(s): Parsonnet J. Source: Reviews of Infectious Diseases. 1989 January-February; 11 Suppl 1: S263-9. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2648540&dopt=Abstract
•
Menstrual toxic shock syndrome complicated by persistent bacteremia: case report and review. Author(s): Crowther MA, Ralph ED. Source: Clinical Infectious Diseases : an Official Publication of the Infectious Diseases Society of America. 1993 February; 16(2): 288-9. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8443309&dopt=Abstract
46
Toxic Shock Syndrome
•
Menstrual toxic shock syndrome. Author(s): Sagraves R. Source: Am Pharm. 1995 August; Ns35(8): 12-7. Review. No Abstract Available. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=7677050&dopt=Abstract
•
Menstrually-related toxic shock syndrome. Author(s): Helms C, Wintermeyer L. Source: Iowa Med. 1991 January; 81(1): 17-20. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2004877&dopt=Abstract
•
MHC class II molecules transduce signals in monocytes in response to bound staphylococcal enterotoxins and toxic shock syndrome toxin. Author(s): Mollick JA, Deemer KP, Chintagumpala M, Rich RR. Source: Trans Assoc Am Physicians. 1990; 103: 289-97. No Abstract Available. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2132539&dopt=Abstract
•
Microbial factors in disease emergence illustrated by streptococcal toxic shock syndrome. Author(s): Krause R. Source: Fems Immunology and Medical Microbiology. 1997 August; 18(4): 227-32. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9348157&dopt=Abstract
•
Microbiology of toxic shock syndrome: overview. Author(s): See RH, Chow AW. Source: Reviews of Infectious Diseases. 1989 January-February; 11 Suppl 1: S55-60. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2648541&dopt=Abstract
•
Mitogenic factors from group G streptococci associated with scarlet fever and streptococcal toxic shock syndrome. Author(s): Assimacopoulos AP, Stoehr JA, Schlievert PM. Source: Advances in Experimental Medicine and Biology. 1997; 418: 109-14. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9331611&dopt=Abstract
•
Molecular epidemiology of methicillin-resistant Staphylococcus aureus strains causing neonatal toxic shock syndrome-like exanthematous disease in neonatal and perinatal wards. Author(s): Kikuchi K, Takahashi N, Piao C, Totsuka K, Nishida H, Uchiyama T. Source: Journal of Clinical Microbiology. 2003 July; 41(7): 3001-6. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12843033&dopt=Abstract
Studies
47
•
Molecular epidemiology of nga and NAD glycohydrolase/ADP-ribosyltransferase activity among Streptococcus pyogenes causing streptococcal toxic shock syndrome. Author(s): Stevens DL, Salmi DB, McIndoo ER, Bryant AE. Source: The Journal of Infectious Diseases. 2000 October; 182(4): 1117-28. Epub 2000 September 08. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10979908&dopt=Abstract
•
Multiple splenic infarcts associated with toxic shock syndrome. Author(s): Cassar SL, Wong AL, Jadavji T, Leung AK. Source: Pediatric Emergency Care. 2002 February; 18(1): 31-2. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11862136&dopt=Abstract
•
Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance. Author(s): Mehrotra M, Wang G, Johnson WM. Source: Journal of Clinical Microbiology. 2000 March; 38(3): 1032-5. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10698991&dopt=Abstract
•
Mutations affecting the activity of toxic shock syndrome toxin-1. Author(s): Deresiewicz RL, Woo J, Chan M, Finberg RW, Kasper DL. Source: Biochemistry. 1994 November 1; 33(43): 12844-51. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=7947690&dopt=Abstract
•
Naloxone treatment of toxic shock syndrome. Author(s): Cohen KR, Emmons KM, Goldstein MF. Source: Archives of Internal Medicine. 1983 May; 143(5): 1072. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6679223&dopt=Abstract
•
Necrotizing group A streptococcal infections associated with streptococcal toxic shock syndrome. Author(s): Sellers BJ, Woods ML, Morris SE, Saffle JR. Source: American Journal of Surgery. 1996 November; 172(5): 523-7; Discussion 527-8. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8942557&dopt=Abstract
•
Neonatal toxic shock syndrome-like exanthematous disease (NTED). Author(s): Takahashi N. Source: Pediatrics International : Official Journal of the Japan Pediatric Society. 2003 April; 45(2): 233-7. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12709162&dopt=Abstract
48
Toxic Shock Syndrome
•
Neutralization of toxic shock syndrome toxin-1 by monoclonal antibodies in vitro and in vivo. Author(s): Bonventre PF, Thompson MR, Adinolfi LE, Gillis ZA, Parsonnet J. Source: Infection and Immunity. 1988 January; 56(1): 135-41. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=3257201&dopt=Abstract
•
Non-menstrual associated toxic shock syndrome. Author(s): Murphy PG, Holmes W, Wilson TS, Alexander JP. Source: Ulster Med J. 1987 October; 56(2): 146-8. No Abstract Available. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=3445394&dopt=Abstract
•
Nonmenstrual toxic shock syndrome after aspiration of an ovarian cyst. A case report. Author(s): London SN. Source: J Reprod Med. 1991 December; 36(12): 885-6. No Abstract Available. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=1840073&dopt=Abstract
•
Nonmenstrual toxic shock syndrome associated with barrier contraceptives: report of a case-control study. Author(s): Schwartz B, Gaventa S, Broome CV, Reingold AL, Hightower AW, Perlman JA, Wolf PH. Source: Reviews of Infectious Diseases. 1989 January-February; 11 Suppl 1: S43-8; Discussion S48-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2928652&dopt=Abstract
•
Non-menstrual toxic shock syndrome complicating orthopaedic surgery. Author(s): Croall J, Chaudhri S. Source: The Journal of Infection. 1989 March; 18(2): 195-6. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2708836&dopt=Abstract
•
Nonmenstrual toxic shock syndrome in a young child with human immunodeficiency virus infection. Author(s): Shah A, Moss W, Champion S, Abrams EJ. Source: The Pediatric Infectious Disease Journal. 1996 July; 15(7): 639-41. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8823867&dopt=Abstract
•
Nonmenstrual toxic shock syndrome. Author(s): MacMillan JC, Poole AP, Lo G, Walkinshaw J. Source: N Z Med J. 1987 August 26; 100(830): 537. No Abstract Available. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=3452091&dopt=Abstract
Studies
49
•
Nonmenstrual toxic shock syndrome: new insights into diagnosis, pathogenesis, and treatment. Author(s): Parsonnet J. Source: Curr Clin Top Infect Dis. 1996; 16: 1-20. Review. No Abstract Available. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8714246&dopt=Abstract
•
Nonmenstrual toxic shock syndrome--a case report. Author(s): Ramanathan M, Teng TL. Source: Med J Malaysia. 1991 September; 46(3): 283-6. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=1839926&dopt=Abstract
•
Nonpurulent response to toxic shock syndrome toxin 1-producing Staphylococcus aureus. Relationship to toxin-stimulated production of tumor necrosis factor. Author(s): Fast DJ, Schlievert PM, Nelson RD. Source: Journal of Immunology (Baltimore, Md. : 1950). 1988 February 1; 140(3): 949-53. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=3339245&dopt=Abstract
•
Nonsteroidal anti-inflammatory drugs and streptococcal toxic shock syndrome. Author(s): Schummer W, Schummer C. Source: Intensive Care Medicine. 2002 August; 28(8): 1194. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12400522&dopt=Abstract
•
Norwegian scabies and a toxic shock syndrome toxin 1-producing strain of Staphylococcus aureus endocarditis in a patient with trisomy 21. Author(s): Bonomo RA, Jacobs M, Jacobs G, Graham R, Salata RA. Source: Clinical Infectious Diseases : an Official Publication of the Infectious Diseases Society of America. 1998 September; 27(3): 645-6. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9770170&dopt=Abstract
•
Novel superantigens from streptococcal toxic shock syndrome Streptococcus pyogenes isolates. Author(s): Newton D, Norrby-Teglund A, McGeer A, Low DE, Schlievert PM, Kotb M. Source: Advances in Experimental Medicine and Biology. 1997; 418: 525-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9331707&dopt=Abstract
•
Nucleotide sequences and biologic properties of toxic shock syndrome toxin 1 from ovine- and bovine-associated Staphylococcus aureus. Author(s): Lee PK, Kreiswirth BN, Deringer JR, Projan SJ, Eisner W, Smith BL, Carlson E, Novick RP, Schlievert PM. Source: The Journal of Infectious Diseases. 1992 June; 165(6): 1056-63. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=1583323&dopt=Abstract
50
Toxic Shock Syndrome
•
Nurse and the law. Tampons and toxic shock syndrome. Author(s): Lanslow A. Source: Aust Nurses J. 1991 July; 21(1): 25-6. No Abstract Available. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=1929968&dopt=Abstract
•
Nursing care study: toxic shock syndrome. Author(s): Schiff S. Source: Nurs Mirror. 1983 September 7; 157(10): 17-23. No Abstract Available. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6555677&dopt=Abstract
•
Nursing grand rounds: toxic shock syndrome. Author(s): McNeil S, Paradis A, Wig P, Edwards E, Link H. Source: Can Nurse. 1983 April; 79(4): 38-41. No Abstract Available. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6550514&dopt=Abstract
•
Observations during the treatment with antithrombin-III concentrate of a case of a tampon-related toxic shock syndrome and disseminated intravascular coagulation. Discrepancies between functional and immunologic determinations of antithrombin. Author(s): Jespersen J, Rasmussen NR, Toftgaard C. Source: Thrombosis Research. 1982 June 15; 26(6): 457-62. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=7112521&dopt=Abstract
•
Occurrence of toxic shock syndrome toxin-1 producing Staphylococcus aureus and the anti TSST-1 serostatus of hospital personnel in Nigeria. Author(s): Olusanya O, Naidu AS. Source: East Afr Med J. 1991 July; 68(7): 507-14. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=1756702&dopt=Abstract
•
On the pathogenesis of toxic shock syndrome. Author(s): Kass EH, Parsonnet J. Source: Reviews of Infectious Diseases. 1987 September-October; 9 Suppl 5: S482-9. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=3317745&dopt=Abstract
•
On the proposed screening definition for toxic shock syndrome by Todd et al. Author(s): Reingold AL. Source: American Journal of Epidemiology. 1985 November; 122(5): 918-20. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=4050779&dopt=Abstract
Studies
51
•
Outbreak of non-menstrual fatal staphylococcal toxic shock syndrome in India. Author(s): Naidu AS, Rathna K, Nirmala P, Devi DY, Rajyalakshmi K. Source: Lancet. 1986 December 20-27; 2(8521-22): 1454-5. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2878296&dopt=Abstract
•
Pathology. What origin for toxic shock syndrome? Author(s): Lacey RW. Source: Nature. 1983 October 20-26; 305(5936): 667-8. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6226875&dopt=Abstract
•
Pathophysiology and treatment of streptococcal toxic shock syndrome. Author(s): Tachi M, Hirabayashi S, Harada H, Nishio T. Source: Scandinavian Journal of Plastic and Reconstructive Surgery and Hand Surgery / Nordisk Plastikkirurgisk Forening [and] Nordisk Klubb for Handkirurgi. 2002; 36(5): 305-8. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12477090&dopt=Abstract
•
Phenol peels and toxic shock syndrome. Author(s): Dmytryshyn JR. Source: Journal of the American Academy of Dermatology. 1983 July; 9(1): 163. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6886101&dopt=Abstract
•
Plasmapheresis in streptococcal toxic shock syndrome. Author(s): Hoeper MM, Abou-Rebyeh F, Athman C, Schwarz A. Source: Critical Care Medicine. 2001 December; 29(12): 2399. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11801855&dopt=Abstract
•
Postoperative staphylococcal toxic shock syndrome due to pre-existing staphylococcal infection: case report and review of the literature. Author(s): Odom SR, Stallard JD, Pacheco HO, Ho H. Source: The American Surgeon. 2001 August; 67(8): 745-7. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11510574&dopt=Abstract
•
Postoperative toxic shock syndrome after lumbar laminectomy in a male patient. Author(s): Miller SD. Source: Spine. 1994 May 15; 19(10): 1182-5. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8059278&dopt=Abstract
52
Toxic Shock Syndrome
•
Postoperative toxic shock syndrome caused by a highly virulent methicillin-resistant Staphylococcus aureus strain. Author(s): Cui L, Kasegawa H, Murakami Y, Hanaki H, Hiramatsu K. Source: Scandinavian Journal of Infectious Diseases. 1999; 31(2): 208-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10447337&dopt=Abstract
•
Postoperative toxic shock syndrome. Author(s): Morrison VA, Oldfield EC 3rd. Source: Archives of Surgery (Chicago, Ill. : 1960). 1983 July; 118(7): 791-4. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6860126&dopt=Abstract
•
Postoperative toxic shock syndrome. Author(s): Graham DR, O'Brien M, Hayes JM, Raab MG. Source: Clinical Infectious Diseases : an Official Publication of the Infectious Diseases Society of America. 1995 April; 20(4): 895-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=7795091&dopt=Abstract
•
Postoperative toxic shock syndrome. Author(s): Raab MG, O'Brien M, Hayes JM, Graham DR. Source: Am J Orthop. 1995 February; 24(2): 130-6. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=7613977&dopt=Abstract
•
Postpartum Clostridium sordellii infection associated with fatal toxic shock syndrome. Author(s): Rorbye C, Petersen IS, Nilas L. Source: Acta Obstetricia Et Gynecologica Scandinavica. 2000 December; 79(12): 1134-5. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11130102&dopt=Abstract
•
Post-partum toxic shock syndrome due to an unexpected source. Author(s): Sam IC, Ng PH. Source: Journal of Obstetrics and Gynaecology : the Journal of the Institute of Obstetrics and Gynaecology. 2002 September; 22(5): 556. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12521433&dopt=Abstract
•
Post-thymic maturation of migrating human thymic single-positive T cells: thymic CD1a- CD4+ T cells are more susceptible to anergy induction by toxic shock syndrome toxin-1 than cord blood CD4+ T cells. Author(s): Imanishi K, Seo K, Kato H, Miyoshi-Akiyama T, Zhang RH, Takanashi Y, Imai Y, Uchiyama T. Source: Journal of Immunology (Baltimore, Md. : 1950). 1998 January 1; 160(1): 112-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9551963&dopt=Abstract
Studies
53
•
Prevalence of producers of enterotoxins and toxic shock syndrome toxin-1 among Staphylococcus aureus strains isolated from atopic dermatitis lesions. Author(s): Akiyama H, Toi Y, Kanzaki H, Tada J, Arata J. Source: Archives of Dermatological Research. 1996 June; 288(7): 418-20. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8818194&dopt=Abstract
•
Primary staphylococcal infection and toxic shock syndrome diagnosed by polymerase chain reaction. Author(s): Tsai YG, Wang CC, Chu DM, Tsai MC, Chu ML. Source: J Formos Med Assoc. 2000 December; 99(12): 942-4. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11155749&dopt=Abstract
•
Production of staphylococcal enterotoxin F and pyrogenic exotoxin C by Staphylococcus aureus isolates from toxic shock syndrome-associated sources. Author(s): Bonventre PF, Weckbach L, Staneck J, Schlievert PM, Thompson M. Source: Infection and Immunity. 1983 June; 40(3): 1023-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6189784&dopt=Abstract
•
Production of tumour necrosis factors by human T cells stimulated by a superantigen, toxic shock syndrome toxin-1. Author(s): Akatsuka H, Imanishi K, Inada K, Yamashita H, Yoshida M, Uchiyama T. Source: Clinical and Experimental Immunology. 1994 June; 96(3): 422-6. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=7911750&dopt=Abstract
•
Prolonged course of toxic shock syndrome associated with methicillin-resistant Staphylococcus aureus enterotoxins G and I. Author(s): Meyer RD, Monday SR, Bohach GA, Schlievert SM. Source: International Journal of Infectious Diseases : Ijid : Official Publication of the International Society for Infectious Diseases. 2001; 5(3): 163-6. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11724675&dopt=Abstract
•
Pyomyositis with toxic shock syndrome presenting as back pain and fever: a case report and literature review. Author(s): Wolfe MW, Bennett JT. Source: Am J Orthop. 1997 February; 26(2): 135-7. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9040888&dopt=Abstract
•
Pyrogenic toxins of Staphylococcus aureus in sudden unexpected nocturnal deaths in adults and older children: factors influencing the control of inflammatory responses to toxic shock syndrome toxins. Author(s): Al Madani O, Gordon AE, Weir DM, Raza MW, Busuttil A, Blackwell C. Source: Fems Immunology and Medical Microbiology. 1999 August 1; 25(1-2): 207-19. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10443510&dopt=Abstract
54
Toxic Shock Syndrome
•
Quantitative vaginal microflora in women convalescent from toxic shock syndrome and in healthy controls. Author(s): Chow AW, Bartlett KH, Goldring AM. Source: Infection and Immunity. 1984 June; 44(3): 650-2. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6724691&dopt=Abstract
•
Rapid and specific detection of toxigenic Staphylococcus aureus: use of two multiplex PCR enzyme immunoassays for amplification and hybridization of staphylococcal enterotoxin genes, exfoliative toxin genes, and toxic shock syndrome toxin 1 gene. Author(s): Becker K, Roth R, Peters G. Source: Journal of Clinical Microbiology. 1998 September; 36(9): 2548-53. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9705390&dopt=Abstract
•
Rapid assay for detection of toxic shock syndrome toxin 1 from human sera. Author(s): Miwa K, Fukuyama M, Kunitomo T, Igarashi H. Source: Journal of Clinical Microbiology. 1994 February; 32(2): 539-42. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8150970&dopt=Abstract
•
Rationale for the use of intravenous gamma globulin in the treatment of streptococcal toxic shock syndrome. Author(s): Stevens DL. Source: Clinical Infectious Diseases : an Official Publication of the Infectious Diseases Society of America. 1998 March; 26(3): 639-41. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9524836&dopt=Abstract
•
Recent advances in toxic shock syndrome. Author(s): Lauter CB. Source: Contemp Intern Med. 1994 June; 6(6): 11-6, 19-22. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10150365&dopt=Abstract
•
Recent trends in the incidence of toxic shock syndrome in northern California. Author(s): Petitti DB, Reingold AL. Source: American Journal of Public Health. 1991 September; 81(9): 1209-11. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=1951837&dopt=Abstract
•
Receptors for toxic shock syndrome toxin-1 and staphylococcal enterotoxin A on human blood monocytes. Author(s): See RH, Krystal G, Chow AW. Source: Canadian Journal of Microbiology. 1992 September; 38(9): 937-44. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=1281444&dopt=Abstract
Studies
55
•
Recombinant expression and neutralizing activity of an MHC class II binding epitope of toxic shock syndrome toxin-1. Author(s): Rubinchik E, Chow AW. Source: Vaccine. 2000 April 28; 18(21): 2312-20. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10717352&dopt=Abstract
•
Recurrent nonmenstrual toxic shock syndrome: clinical manifestations, diagnosis, and treatment. Author(s): Andrews MM, Parent EM, Barry M, Parsonnet J. Source: Clinical Infectious Diseases : an Official Publication of the Infectious Diseases Society of America. 2001 May 15; 32(10): 1470-9. Epub 2001 April 18. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11317249&dopt=Abstract
•
Recurrent toxic shock syndrome. Author(s): Bryner CL Jr. Source: American Family Physician. 1989 March; 39(3): 157-64. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2923028&dopt=Abstract
•
Regulation of toxic shock syndrome toxin-1 gene in Staphylococcus aureus. Author(s): Woo JH, Kim YS, Hwang SD. Source: Molecules and Cells. 1997 February 28; 7(1): 28-33. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9085261&dopt=Abstract
•
Relatedness of Streptococcus canis from canine streptococcal toxic shock syndrome and necrotizing fasciitis. Author(s): DeWinter LM, Prescott JF. Source: Can J Vet Res. 1999 April; 63(2): 90-5. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10369564&dopt=Abstract
•
Relative activities of distinct isotypes of murine and human major histocompatibility complex class II molecules in binding toxic shock syndrome toxin 1 and determination of CD antigens expressed on T cells generated upon stimulation by the toxin. Author(s): Uchiyama T, Saito S, Inoko H, Yan XJ, Imanishi K, Araake M, Igarashi H. Source: Infection and Immunity. 1990 December; 58(12): 3877-82. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2123824&dopt=Abstract
56
Toxic Shock Syndrome
•
Relative strength of the mitogenic and interleukin-2-production-inducing activities of staphylococcal exotoxins presumed to be causative exotoxins of toxic shock syndrome: toxic shock syndrome toxin-1 and enterotoxins A, B and C to murine and human T cells. Author(s): Uchiyama T, Kamagata Y, Yan XJ, Kawachi A, Fujikawa H, Igarashi H, Okubo M. Source: Clinical and Experimental Immunology. 1989 February; 75(2): 239-44. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2784735&dopt=Abstract
•
Release of tumor necrosis factor alpha by human peritoneal macrophages in response to toxic shock syndrome toxin-1. Author(s): Buyalos RP, Rutanen EM, Tsui E, Halme J. Source: Obstetrics and Gynecology. 1991 August; 78(2): 182-6. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2067760&dopt=Abstract
•
Report of 2 fatal cases of adult necrotizing fasciitis and toxic shock syndrome caused by Streptococcus agalactiae. Author(s): Tang WM, Ho PL, Yau WP, Wong JW, Yip DK. Source: Clinical Infectious Diseases : an Official Publication of the Infectious Diseases Society of America. 2000 October; 31(4): E15-7. Epub 2000 October 17. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11049806&dopt=Abstract
•
Reporting of toxic shock syndrome Staphylococcus aureus in 1982 to 1990. Author(s): Schlievert PM, Kim MH. Source: The Journal of Infectious Diseases. 1991 December; 164(6): 1245-6. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=1955734&dopt=Abstract
•
Reporting of toxic shock syndrome. Author(s): Jackson LA, Schuchat A. Source: The Journal of Infectious Diseases. 1992 August; 166(2): 445. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=1321864&dopt=Abstract
•
Role of a carboxy-terminal site of toxic shock syndrome toxin 1 in eliciting immune responses of human peripheral blood mononuclear cells. Author(s): Drynda A, Konig B, Bonventre PF, Konig W. Source: Infection and Immunity. 1995 March; 63(3): 1095-101. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=7532624&dopt=Abstract
•
Role of protein tyrosine phosphorylation in monokine induction by the staphylococcal superantigen toxic shock syndrome toxin-1. Author(s): Scholl PR, Trede N, Chatila TA, Geha RS. Source: Journal of Immunology (Baltimore, Md. : 1950). 1992 April 1; 148(7): 2237-41. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=1545128&dopt=Abstract
Studies
57
•
Role of the adhesion molecule lymphocyte function associated antigen 1 in toxic shock syndrome toxin 1-induced tumor necrosis factor alpha and interleukin-1 beta secretion by human monocytes. Author(s): See RH, Chow AW. Source: Infection and Immunity. 1992 November; 60(11): 4957-60. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=1399006&dopt=Abstract
•
Scientists build a peptide to stop toxic shock syndrome. Author(s): Siegel-Itzkovich J. Source: Bmj (Clinical Research Ed.). 2000 April 8; 320(7240): 958. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10753134&dopt=Abstract
•
Sequence of the toxic shock syndrome toxin gene (tstH) borne by strains of Staphylococcus aureus isolated from patients with Kawasaki syndrome. Author(s): Deresiewicz RL, Flaxenburg J, Leng K, Kasper DL. Source: Infection and Immunity. 1996 August; 64(8): 3394-6. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8757881&dopt=Abstract
•
Severe eosinophilia during the course of toxic shock syndrome. Author(s): Ozaras R, Mert A, Tabak F, Bilir M, Ozturk R. Source: Southern Medical Journal. 2003 July; 96(7): 727-8. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12940337&dopt=Abstract
•
Severe group A streptococcal infection and streptococcal toxic shock syndrome. Author(s): Baxter F, McChesney J. Source: Canadian Journal of Anaesthesia = Journal Canadien D'anesthesie. 2000 November; 47(11): 1129-40. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11097546&dopt=Abstract
•
Severe recalcitrant erythematous desquamating disorder associated with fatal recurrent toxic shock syndrome in a patient without AIDS. Author(s): Verbon A, Fisher CJ Jr. Source: Clinical Infectious Diseases : an Official Publication of the Infectious Diseases Society of America. 1997 June; 24(6): 1274-5. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9195107&dopt=Abstract
•
Simultaneous presentation of Kawasaki disease and toxic shock syndrome in an adolescent male. Author(s): Davies HD, Kirk V, Jadavji T, Kotzin BL. Source: The Pediatric Infectious Disease Journal. 1996 December; 15(12): 1136-8. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8970231&dopt=Abstract
58
Toxic Shock Syndrome
•
Staphylococcal toxic shock syndrome associated with human immunodeficiency virus infection: report of a case with bacteremia. Author(s): Gutierrez Rodero F, Ortiz de la Tabla V, Martinez C, del Mar Masia M. Source: Clinical Infectious Diseases : an Official Publication of the Infectious Diseases Society of America. 1996 May; 22(5): 875-6. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8722964&dopt=Abstract
•
Staphylococcus aureus nasal carriage in rheumatoid arthritis: antibody response to toxic shock syndrome toxin-1. Author(s): Tabarya D, Hoffman WL. Source: Annals of the Rheumatic Diseases. 1996 November; 55(11): 822-8. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8976639&dopt=Abstract
•
Streptococcal fasciitis with toxic shock syndrome in the pediatric patient. Author(s): Jackson MA, Colombo J, Boldrey A. Source: Orthopaedic Nursing / National Association of Orthopaedic Nurses. 2003 January-February; 22(1): 4-8. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12640946&dopt=Abstract
•
Streptococcal toxic shock syndrome from a puncture wound to the foot. Author(s): Miller JH, Nath RL, Stoughton J, Carpenter BB, Mostone EJ. Source: The Journal of Foot and Ankle Surgery : Official Publication of the American College of Foot and Ankle Surgeons. 1996 November-December; 35(6): 578-84. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8986898&dopt=Abstract
•
Streptococcal toxic shock syndrome in a patient with rheumatoid arthritis. Author(s): Morishita M, Yamahatsu S, Yoshino S, Ohkuni H, Nagashima M. Source: Clin Exp Rheumatol. 2001 March-April; 19(2): 231-2. No Abstract Available. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11326498&dopt=Abstract
•
Streptococcal toxic shock syndrome in a postpartum woman. Case report and review of the literature. Author(s): Jorup-Ronstrom C, Hofling M, Lundberg C, Holm S. Source: Infection. 1996 March-April; 24(2): 164-7. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8740114&dopt=Abstract
•
Streptococcal toxic shock syndrome in two patients infected by a colonized surgeon. Author(s): Rutishauser J, Funke G, Lutticken R, Ruef C. Source: Infection. 1999; 27(4-5): 259-60. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10885838&dopt=Abstract
Studies
59
•
Streptococcal toxic shock syndrome manifesting as peritonitis in a child. Author(s): Liang TC, Lu CY, Lu FL, Lee PI, Huang LM. Source: J Formos Med Assoc. 2002 July; 101(7): 509-13. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12353345&dopt=Abstract
•
Streptococcal toxic shock syndrome presenting with spontaneous hypoglycemia in a chronic hemodialysis patient: pathophysiological mechanisms. Author(s): Igaki N, Matsuda T, Hirota Y, Kawaguchi T, Tamada F, Goto T. Source: Intern Med. 2003 May; 42(5): 421-3. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12793713&dopt=Abstract
•
Streptococcal toxic shock syndrome revealed by a peritonitis. Case report and review of the literature. Author(s): Vuilleumier H, Halkic N. Source: Swiss Surg. 2001; 7(1): 25-7. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11234313&dopt=Abstract
•
Streptococcal toxic shock syndrome. Author(s): Dhawan B, Mohanty S, Ammini AC, Dhanwal D, Das BK, Kapil A. Source: J Assoc Physicians India. 2002 April; 50: 599-600. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12164422&dopt=Abstract
•
Successful treatment of severe streptococcal toxic shock syndrome with a combination of intravenous immunoglobulin, dexamethasone and antibiotics. Author(s): Chiu CH, Ou JT, Chang KS, Lin TY. Source: Infection. 1997 January-February; 25(1): 47-8. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9039540&dopt=Abstract
•
Survey of staphylococcal enterotoxin genes, exfoliative toxin genes, and toxic shock syndrome toxin 1 gene in non-Staphylococcus aureus species. Author(s): Becker K, Haverkamper G, von Eiff C, Roth R, Peters G. Source: European Journal of Clinical Microbiology & Infectious Diseases : Official Publication of the European Society of Clinical Microbiology. 2001 June; 20(6): 407-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11476441&dopt=Abstract
•
Synoviocyte proliferation in joints of SCID mice induced by toxic shock syndrome toxin-1 stimulated T cells from patient with rheumatoid arthritis. Author(s): Suzuki T, Nishimaki T, Kogure A, Okubo M, Akatsuka H, Kokubun M, Kasukawa R, Natsume T, Suzuki T. Source: The Journal of Rheumatology. 1997 June; 24(6): 1115-21. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9195519&dopt=Abstract
60
Toxic Shock Syndrome
•
The effect of C1-esterase inhibitor in definite and suspected streptococcal toxic shock syndrome. Report of seven patients. Author(s): Fronhoffs S, Luyken J, Steuer K, Hansis M, Vetter H, Walger P. Source: Intensive Care Medicine. 2000 October; 26(10): 1566-70. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11126274&dopt=Abstract
•
Toxic shock syndrome after anterior-posterior nasal packing. Author(s): Aeumjaturapat S, Supanakorn S, Cutchavaree A. Source: J Med Assoc Thai. 2001 March; 84(3): 453-8. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11460952&dopt=Abstract
•
Toxic shock syndrome after burn injuries in children. Author(s): Blomqvist L. Source: Scandinavian Journal of Plastic and Reconstructive Surgery and Hand Surgery / Nordisk Plastikkirurgisk Forening [and] Nordisk Klubb for Handkirurgi. 1997 March; 31(1): 77-81. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9075292&dopt=Abstract
•
Toxic shock syndrome after closed reduction of a nasal fracture. Author(s): Keller JL, Evan KE, Wetmore RF. Source: Otolaryngology and Head and Neck Surgery. 1999 April; 120(4): 569-70. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10187962&dopt=Abstract
•
Toxic shock syndrome after explantation of breast implants: a case report and review of the literature. Author(s): Walker LE, Breiner MJ, Goodman CM. Source: Plastic and Reconstructive Surgery. 1997 March; 99(3): 875-9. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9047212&dopt=Abstract
•
Toxic shock syndrome after suction lipectomy. Author(s): Umeda T, Ohara H, Hayashi O, Ueki M, Hata Y. Source: Plastic and Reconstructive Surgery. 2000 July; 106(1): 204-7; Discussion 208-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10883636&dopt=Abstract
•
Toxic shock syndrome and bacterial superantigens: an update. Author(s): McCormick JK, Yarwood JM, Schlievert PM. Source: Annual Review of Microbiology. 2001; 55: 77-104. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11544350&dopt=Abstract
Studies
61
•
Toxic shock syndrome and streptococcal myositis: three case reports. Author(s): Watkins R, Vyas H. Source: European Journal of Pediatrics. 2002 September; 161(9): 497-8. Epub 2002 August 13. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12200610&dopt=Abstract
•
Toxic shock syndrome associated with frontal sinus stents. Author(s): Chadwell JS, Gustafson LM, Tami TA. Source: Otolaryngology and Head and Neck Surgery. 2001 May; 124(5): 573-4. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11337665&dopt=Abstract
•
Toxic shock syndrome complicating influenza A infection: a two-case report with one case of bacteremia and endocarditis. Author(s): Sion ML, Hatzitolios AI, Toulis EN, Mikoudi KD, Ziakas GN. Source: Intensive Care Medicine. 2001 February; 27(2): 443. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11396292&dopt=Abstract
•
Toxic shock syndrome due to Clostridium sordellii: a dramatic postpartum and postabortion disease. Author(s): Sinave C, Le Templier G, Blouin D, Leveille F, Deland E. Source: Clinical Infectious Diseases : an Official Publication of the Infectious Diseases Society of America. 2002 December 1; 35(11): 1441-3. Epub 2002 November 13. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12439811&dopt=Abstract
•
Toxic Shock Syndrome in a neonate? Author(s): Carvalho L, Neves JF. Source: Acta Paediatrica (Oslo, Norway : 1992). 1998 June; 87(6): 699-701. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9686667&dopt=Abstract
•
Toxic shock syndrome in a patient with breast cancer and systemic lupus erythematosus. Author(s): Huseyin TS, Maynard JP, Leach RD. Source: European Journal of Surgical Oncology : the Journal of the European Society of Surgical Oncology and the British Association of Surgical Oncology. 2001 April; 27(3): 330-1. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11373115&dopt=Abstract
•
Toxic shock syndrome in two CAPD patients with Staphylococcus aureus exit-site infection. Author(s): Altiparmak MR, Demirel H, Mert A, Serdengecti K, Ataman R. Source: Perit Dial Int. 2003 March-April; 23(2): 191-3. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12713088&dopt=Abstract
62
Toxic Shock Syndrome
•
Toxic shock syndrome secondary to a dental abscess. Author(s): Fardy CH, Findlay G, Owen G, Shortland G. Source: International Journal of Oral and Maxillofacial Surgery. 1999 February; 28(1): 601. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10065654&dopt=Abstract
•
Toxic shock syndrome: broadening the differential diagnosis. Author(s): Herzer CM. Source: The Journal of the American Board of Family Practice / American Board of Family Practice. 2001 March-April; 14(2): 131-6. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11314920&dopt=Abstract
•
Toxic shock syndrome: case report of a postpartum female and a literature review. Author(s): Davis D, Gash-Kim TL, Heffernan EJ. Source: The Journal of Emergency Medicine. 1998 July-August; 16(4): 607-14. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=9696180&dopt=Abstract
•
Toxoids of streptococcal pyrogenic exotoxin A are protective in rabbit models of streptococcal toxic shock syndrome. Author(s): Roggiani M, Stoehr JA, Olmsted SB, Matsuka YV, Pillai S, Ohlendorf DH, Schlievert PM. Source: Infection and Immunity. 2000 September; 68(9): 5011-7. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10948118&dopt=Abstract
•
Two cases of delayed diagnosis of postpartal streptococcal toxic shock syndrome. Author(s): Schummer W, Schummer C. Source: Infectious Diseases in Obstetrics and Gynecology. 2002; 10(4): 217-22. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12648316&dopt=Abstract
•
Two men with toxic shock syndrome presenting with targetoid and spotty skin rashes. Author(s): Scheinfeld N, Pollack MJ, McNiff JM, Imaeda S, Sinha AA. Source: Acta Dermato-Venereologica. 2002; 82(6): 449-52. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12575853&dopt=Abstract
•
Untoward effect of a face peel: toxic shock syndrome. Author(s): Korcok M. Source: Jama : the Journal of the American Medical Association. 1982 July 2; 248(1): 23. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=7087081&dopt=Abstract
Studies
63
•
Update on toxic shock syndrome. Recognizing and treating the mild case. Author(s): Smirniotopoulos TT. Source: Postgraduate Medicine. 1983 October; 74(4): 369-72. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6622321&dopt=Abstract
•
Update through 1985 on the incidence of toxic shock syndrome among members of a prepaid health plan. Author(s): Petitti DB, Reingold AL. Source: Reviews of Infectious Diseases. 1989 January-February; 11 Suppl 1: S22-6; Discussion S26-7. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2928640&dopt=Abstract
•
Update: toxic shock syndrome. Author(s): Price JH. Source: The Journal of School Health. 1981 March; 51(3): 143-5. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6908632&dopt=Abstract
•
Upregulation of IgE synthesis by staphylococcal toxic shock syndrome toxin-1 in peripheral blood mononuclear cells from patients with atopic dermatitis. Author(s): Hofer MF, Lester MR, Schlievert PM, Leung DY. Source: Clinical and Experimental Allergy : Journal of the British Society for Allergy and Clinical Immunology. 1995 December; 25(12): 1218-27. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8821303&dopt=Abstract
•
Vaginal isolates of Staphylococcus aureus associated with toxic shock syndrome. Author(s): Barbour AG. Source: Infection and Immunity. 1981 August; 33(2): 442-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6456228&dopt=Abstract
•
Variant postpartum toxic shock syndrome with probable intrapartum transmission to the neonate. Author(s): Chow AW, Wittmann BK, Bartlett KH, Scheifele DW. Source: American Journal of Obstetrics and Gynecology. 1984 April 15; 148(8): 1074-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6711641&dopt=Abstract
•
Varicella zoster and staphylococcal toxic shock syndrome in a young man. Author(s): Jacobson JA, Burke JP, Benowitz BA, Clark PV. Source: Jama : the Journal of the American Medical Association. 1983 February 18; 249(7): 922-3. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6218314&dopt=Abstract
64
Toxic Shock Syndrome
•
Vulvovaginal steroid cream and toxic shock syndrome. Author(s): Dutton AH, Hayes PC, Shepherd AN, Geirsson R. Source: Lancet. 1983 April 23; 1(8330): 938. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=6132260&dopt=Abstract
65
CHAPTER 2. NUTRITION AND TOXIC SHOCK SYNDROME Overview In this chapter, we will show you how to find studies dedicated specifically to nutrition and toxic shock syndrome.
Finding Nutrition Studies on Toxic Shock Syndrome The National Institutes of Health’s Office of Dietary Supplements (ODS) offers a searchable bibliographic database called the IBIDS (International Bibliographic Information on Dietary Supplements; National Institutes of Health, Building 31, Room 1B29, 31 Center Drive, MSC 2086, Bethesda, Maryland 20892-2086, Tel: 301-435-2920, Fax: 301-480-1845, E-mail:
[email protected]). The IBIDS contains over 460,000 scientific citations and summaries about dietary supplements and nutrition as well as references to published international, scientific literature on dietary supplements such as vitamins, minerals, and botanicals.7 The IBIDS includes references and citations to both human and animal research studies. As a service of the ODS, access to the IBIDS database is available free of charge at the following Web address: http://ods.od.nih.gov/databases/ibids.html. After entering the search area, you have three choices: (1) IBIDS Consumer Database, (2) Full IBIDS Database, or (3) Peer Reviewed Citations Only. Now that you have selected a database, click on the “Advanced” tab. An advanced search allows you to retrieve up to 100 fully explained references in a comprehensive format. Type “toxic shock syndrome” (or synonyms) into the search box, and click “Go.” To narrow the search, you can also select the “Title” field.
7 Adapted from http://ods.od.nih.gov. IBIDS is produced by the Office of Dietary Supplements (ODS) at the National Institutes of Health to assist the public, healthcare providers, educators, and researchers in locating credible, scientific information on dietary supplements. IBIDS was developed and will be maintained through an interagency partnership with the Food and Nutrition Information Center of the National Agricultural Library, U.S. Department of Agriculture.
66
Toxic Shock Syndrome
The following information is typical of that found when using the “Full IBIDS Database” to search for “toxic shock syndrome” (or a synonym): •
A single clone of Staphylococcus aureus causes the majority of cases of toxic shock syndrome. Author(s): Department of Biology, Mueller Laboratory, Pennsylvania State University, University Park 16802. Source: Musser, J M Schlievert, P M Chow, A W Ewan, P Kreiswirth, B N Rosdahl, V T Naidu, A S Witte, W Selander, R K Proc-Natl-Acad-Sci-U-S-A. 1990 January; 87(1): 225-9 0027-8424
•
Comparison of two newly developed forms of an enzyme-linked immunosorbent assay for the detection of staphylococcal toxic shock syndrome toxin-1 (TSST-1). Author(s): Institut fur Med. Mikrobiologie und Immunologie, Universitat Bonn. Source: Pickenhahn, P Lenz, W Schaal, K P Zentralbl-Bakteriol-Mikrobiol-Hyg-[A]. 1987 December; 267(2): 206-16 0176-6724
•
Effect of dilution rate and Mg2+ limitation on toxic shock syndrome toxin-1 production by Staphylococcus aureus grown in defined continuous culture. Author(s): Department of Microbiology, University of Leeds, UK. Source: Taylor, D Holland, K T J-Gen-Microbiol. 1988 March; 134 ( Pt 3)719-23 0022-1287
•
Effect of magnesium on in vitro production of toxic shock syndrome toxin 1. Author(s): Department of Tropical Medicine, John A. Burns School of Medicine, University of Hawaii, Honolulu. Source: James, J F Chu, M C Lee, L Peck, S A McKissick, C Sullivan, H Frogner, K Melish, M Rev-Infect-Dis. 1989 Jan-February; 11 Suppl 1S157-66 0162-0886
•
Effect of trace metals on the synthesis of toxic shock syndrome toxin 1. Author(s): Division of Bacterial Diseases, Centers for Disease Control, Atlanta, Georgia 30333. Source: Reeves, M W Rev-Infect-Dis. 1989 Jan-February; 11 Suppl 1S145-49; discussion S149-50 0162-0886
•
Effects of staphylococcal toxic shock syndrome toxin 1 on aortic endothelial cells. Author(s): Department of Microbiology, University of Minnesota Medical School, Minneapolis 55455-0312. Source: Lee, P K Vercellotti, G M Deringer, J R Schlievert, P M J-Infect-Dis. 1991 October; 164(4): 711-9 0022-1899
•
Environmental factors affecting toxic shock syndrome toxin-1 (TSST-1) synthesis. Source: Sarafian, S K Morse, S A J-Med-Microbiol. 1987 August; 24(1): 75-81 0022-2615
•
Fluid replacement protection of rabbits challenged subcutaneous with toxic shock syndrome toxins. Author(s): Department of Microbiology, University of Minnesota Medical School, Minneapolis 55455. Source: Lee, P K Deringer, J R Kreiswirth, B N Novick, R P Schlievert, P M InfectImmun. 1991 March; 59(3): 879-84 0019-9567
•
Group A beta-hemolytic Streptococcus as a cause of toxic shock syndrome. A case report. Author(s): Department of Obstetrics and Gynecology, Wilford Hall United States Air Force Medical Center, Lackland Air Force Base, TX 78236-5300. Source: Whitted, R W Yeomans, E R Hankins, G D J-Reprod-Med. 1990 May; 35(5): 55860 0024-7758
Nutrition
67
•
Induction of nitric oxide synthase activity by toxic shock syndrome toxin 1 in a macrophage-monocyte cell line. Author(s): William Harvey Research Institute, St. Bartholomew's Hospital Medical College, London, England. Source: Zembowicz, A Vane, J R Proc-Natl-Acad-Sci-U-S-A. 1992 March 15; 89(6): 2051-5 0027-8424
•
Influence of focal growth conditions on the pathogenesis of toxic shock syndrome. Source: Todd, J K Todd, B H Franco Buff, A Smith, C M Lawellin, D W J-Infect-Dis. 1987 April; 155(4): 673-81 0022-1899
•
Influence of serum on zinc, toxic shock syndrome toxin-1, and lipopolysaccharideinduced production of IFN-gamma and IL-1 beta by human mononuclear cells. Author(s): Institute of Immunology and Transfusion Medicine, University of Lubeck School of Medicine, Germany. Source: Driessen, C Hirv, K Wellinghausen, N Kirchner, H Rink, L J-Leukoc-Biol. 1995 June; 57(6): 904-8 0741-5400
•
Inhalational mercury poisoning masquerading as toxic shock syndrome. Author(s): Department of Anaesthesia & Intensive Care, Sultan Qaboos University Hospital, Sultanate of Oman. Source: Mohan, S B Tamilarasan, A Buhl, M Anaesth-Intensive-Care. 1994 June; 22(3): 305-6 0310-057X
•
Production of toxic shock syndrome toxin 1 by Staphylococcus aureus under aerobic and anaerobic conditions and the effect of magnesium ion limitation. Author(s): Department of Microbiology, University of Leeds, United Kingdom. Source: Taylor, D Holland, K T Rev-Infect-Dis. 1989 Jan-February; 11 Suppl 1S151-6 0162-0886
•
Role of magnesium ion in the pathogenesis of toxic shock syndrome. Author(s): Department of Medicine, Harvard Medical School, Boston, MA 02115. Source: Kass, E H Parsonnet, J Mills, J T Trans-Assoc-Am-Physicians. 1987; 100158-63 0066-9458
•
Staphylococcal toxic shock syndrome toxin 1-induced tumor necrosis factor alpha and interleukin-1 beta secretion by human peripheral blood monocytes and T lymphocytes is differentially suppressed by protein kinase inhibitors. Author(s): Department of Medicine, University of British Columbia, Vancouver, Canada. Source: See, R H Chow, A W Infect-Immun. 1992 August; 60(8): 3456-9 0019-9567
•
Staphylococcus aureus toxic shock syndrome toxin 1 and Streptococcus pyogenes erythrogenic toxin A modulate inflammatory mediator release from human neutrophils. Author(s): Medizinische Mikrobiologie und Immunologie, AG Infektabwehrmechanismen, Ruhr-Universitat Bochum, Germany. Source: Hensler, T Koller, M Geoffroy, C Alouf, J E Konig, W Infect-Immun. 1993 March; 61(3): 1055-61 0019-9567
•
The effect of glycerol monolaurate on growth of, and production of toxic shock syndrome toxin-1 and lipase by, Staphylococcus aureus. Author(s): Microbiology Department, University of Leeds, UK. Source: Holland, K T Taylor, D Farrell, A M J-Antimicrob-Chemother. 1994 January; 33(1): 41-55 0305-7453
68
Toxic Shock Syndrome
•
The effect of topical antimicrobial agents on the production of toxic shock syndrome toxin-1. Author(s): Department of Biological Sciences, Manchester Metropolitan University. Source: Edwards Jones, V Foster, H A J-Med-Microbiol. 1994 December; 41(6): 408-13 0022-2615
•
Toxic shock syndrome associated with newly diagnosed type I diabetes. Author(s): Department of Endocrinology, Women's and Children's Hospital, North Adelaide, Australia.
[email protected] Source: Couper, J J Kallincos, N Pollard, A Honeyman, M Prager, P Harrison, L C Rischmueller, M J-Paediatr-Child-Health. 2000 June; 36(3): 279-82 1034-4810
Federal Resources on Nutrition In addition to the IBIDS, the United States Department of Health and Human Services (HHS) and the United States Department of Agriculture (USDA) provide many sources of information on general nutrition and health. Recommended resources include: •
healthfinder®, HHS’s gateway to health information, including diet and nutrition: http://www.healthfinder.gov/scripts/SearchContext.asp?topic=238&page=0
•
The United States Department of Agriculture’s Web site dedicated to nutrition information: www.nutrition.gov
•
The Food and Drug Administration’s Web site for federal food safety information: www.foodsafety.gov
•
The National Action Plan on Overweight and Obesity sponsored by the United States Surgeon General: http://www.surgeongeneral.gov/topics/obesity/
•
The Center for Food Safety and Applied Nutrition has an Internet site sponsored by the Food and Drug Administration and the Department of Health and Human Services: http://vm.cfsan.fda.gov/
•
Center for Nutrition Policy and Promotion sponsored by the United States Department of Agriculture: http://www.usda.gov/cnpp/
•
Food and Nutrition Information Center, National Agricultural Library sponsored by the United States Department of Agriculture: http://www.nal.usda.gov/fnic/
•
Food and Nutrition Service sponsored by the United States Department of Agriculture: http://www.fns.usda.gov/fns/
Additional Web Resources A number of additional Web sites offer encyclopedic information covering food and nutrition. The following is a representative sample: •
AOL: http://search.aol.com/cat.adp?id=174&layer=&from=subcats
•
Family Village: http://www.familyvillage.wisc.edu/med_nutrition.html
•
Google: http://directory.google.com/Top/Health/Nutrition/
•
Healthnotes: http://www.healthnotes.com/
Nutrition
•
Open Directory Project: http://dmoz.org/Health/Nutrition/
•
Yahoo.com: http://dir.yahoo.com/Health/Nutrition/
•
WebMDHealth: http://my.webmd.com/nutrition
•
WholeHealthMD.com: http://www.wholehealthmd.com/reflib/0,1529,00.html
69
71
CHAPTER 3. ALTERNATIVE MEDICINE AND TOXIC SHOCK SYNDROME Overview In this chapter, we will begin by introducing you to official information sources on complementary and alternative medicine (CAM) relating to toxic shock syndrome. At the conclusion of this chapter, we will provide additional sources.
National Center for Complementary and Alternative Medicine The National Center for Complementary and Alternative Medicine (NCCAM) of the National Institutes of Health (http://nccam.nih.gov/) has created a link to the National Library of Medicine’s databases to facilitate research for articles that specifically relate to toxic shock syndrome and complementary medicine. To search the database, go to the following Web site: http://www.nlm.nih.gov/nccam/camonpubmed.html. Select “CAM on PubMed.” Enter “toxic shock syndrome” (or synonyms) into the search box. Click “Go.” The following references provide information on particular aspects of complementary and alternative medicine that are related to toxic shock syndrome: •
A puzzling case of cardiac arrest. Author(s): Hannah HB. Source: British Journal of Anaesthesia. 1971 October; 43(10): 991-3. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=5115036&dopt=Abstract
•
Accumulation of platelet-activating factor acetylhydrolase in the peritoneal cavity of guinea pig after endotoxin shock. Author(s): Karasawa K, Kato H, Setaka M, Nojima S. Source: Journal of Biochemistry. 1994 August; 116(2): 368-73. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=7822256&dopt=Abstract
72
Toxic Shock Syndrome
•
Aconiti tuber (Bushi) improves microcirculatory disturbances induced by endotoxin in rats. Author(s): Zhang H, Sugiura Y, Goto Y. Source: Phytotherapy Research : Ptr. 2000 November; 14(7): 505-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=11054839&dopt=Abstract
•
Acupuncture may be associated with serious adverse events. Author(s): Ernst E, White AR. Source: Bmj (Clinical Research Ed.). 2000 February 19; 320(7233): 513-4. Review. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10678876&dopt=Abstract
•
Acute gangrene of the scrotum and penis in four hematologic patients. The usefulness of hyperbaric oxygen therapy in one case. Author(s): Radaelli F, Della Volpe A, Colombi M, Bregani P, Polli EE. Source: Cancer. 1987 October 1; 60(7): 1462-4. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=3113713&dopt=Abstract
•
Acute renal failure in Indian and Black patients. Author(s): Seedat YK, North-Coombes D, Sewdarsen M. Source: South African Medical Journal. Suid-Afrikaanse Tydskrif Vir Geneeskunde. 1975 November 1; 49(46): 1907-10. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=1198213&dopt=Abstract
•
Alveolar macrophage activation after trauma-hemorrhage and sepsis is dependent on NF-kappaB and MAPK/ERK mechanisms. Author(s): Jarrar D, Kuebler JF, Rue LW 3rd, Matalon S, Wang P, Bland KI, Chaudry IH. Source: American Journal of Physiology. Lung Cellular and Molecular Physiology. 2002 October; 283(4): L799-805. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=12225957&dopt=Abstract
•
Anti-shock effects of synthetic effective compositions of fructus aurantii immaturus. Experimental study and clinical observation. Author(s): Zhao XW, Li JX, Zhu ZR, Sun DQ, Liu SC. Source: Chinese Medical Journal. 1989 February; 102(2): 91-3. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=2570680&dopt=Abstract
•
Are corticosteroids useful in shock therapy? Author(s): Bowen JM. Source: J Am Vet Med Assoc. 1980 September 1; 177(5): 453-5. No Abstract Available. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=7440345&dopt=Abstract
Alternative Medicine 73
•
B7.2 provides co-stimulatory functions in vivo in response to staphylococcal enterotoxin B. Author(s): Muraille E, De Smedt T, Urbain J, Moser M, Leo O. Source: European Journal of Immunology. 1995 July; 25(7): 2111-4. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=7542606&dopt=Abstract
•
Beneficial effects of sanguisorbae radix in renal dysfunction caused by endotoxin in vivo. Author(s): Chen CP, Yokozawa T, Kitani K. Source: Biological & Pharmaceutical Bulletin. 1999 December; 22(12): 1327-30. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=10746165&dopt=Abstract
•
Inhalational mercury poisoning masquerading as toxic shock syndrome. Author(s): Mohan SB, Tamilarasan A, Buhl M. Source: Anaesthesia and Intensive Care. 1994 June; 22(3): 305-6. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=8085634&dopt=Abstract
•
Role of magnesium ion in the pathogenesis of toxic shock syndrome. Author(s): Kass EH, Parsonnet J, Mills JT. Source: Trans Assoc Am Physicians. 1987; 100: 158-63. No Abstract Available. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=3137706&dopt=Abstract
•
Staphylococcal toxic shock syndrome toxin 1-induced tumor necrosis factor alpha and interleukin-1 beta secretion by human peripheral blood monocytes and T lymphocytes is differentially suppressed by protein kinase inhibitors. Author(s): See RH, Chow AW. Source: Infection and Immunity. 1992 August; 60(8): 3456-9. http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=1639516&dopt=Abstract
Additional Web Resources A number of additional Web sites offer encyclopedic information covering CAM and related topics. The following is a representative sample: •
Alternative Medicine Foundation, Inc.: http://www.herbmed.org/
•
AOL: http://search.aol.com/cat.adp?id=169&layer=&from=subcats
•
Chinese Medicine: http://www.newcenturynutrition.com/
•
drkoop.com: http://www.drkoop.com/InteractiveMedicine/IndexC.html
•
Family Village: http://www.familyvillage.wisc.edu/med_altn.htm
•
Google: http://directory.google.com/Top/Health/Alternative/
•
Healthnotes: http://www.healthnotes.com/
74
Toxic Shock Syndrome
•
MedWebPlus: http://medwebplus.com/subject/Alternative_and_Complementary_Medicine
•
Open Directory Project: http://dmoz.org/Health/Alternative/
•
HealthGate: http://www.tnp.com/
•
WebMDHealth: http://my.webmd.com/drugs_and_herbs
•
WholeHealthMD.com: http://www.wholehealthmd.com/reflib/0,1529,00.html
•
Yahoo.com: http://dir.yahoo.com/Health/Alternative_Medicine/
General References A good place to find general background information on CAM is the National Library of Medicine. It has prepared within the MEDLINEplus system an information topic page dedicated to complementary and alternative medicine. To access this page, go to the MEDLINEplus site at http://www.nlm.nih.gov/medlineplus/alternativemedicine.html. This Web site provides a general overview of various topics and can lead to a number of general sources.
75
CHAPTER 4. SYNDROME
DISSERTATIONS
ON
TOXIC
SHOCK
Overview In this chapter, we will give you a bibliography on recent dissertations relating to toxic shock syndrome. We will also provide you with information on how to use the Internet to stay current on dissertations. IMPORTANT NOTE: When following the search strategy described below, you may discover non-medical dissertations that use the generic term “toxic shock syndrome” (or a synonym) in their titles. To accurately reflect the results that you might find while conducting research on toxic shock syndrome, we have not necessarily excluded non-medical dissertations in this bibliography.
Dissertations on Toxic Shock Syndrome ProQuest Digital Dissertations, the largest archive of academic dissertations available, is located at the following Web address: http://wwwlib.umi.com/dissertations. From this archive, we have compiled the following list covering dissertations devoted to toxic shock syndrome. You will see that the information provided includes the dissertation’s title, its author, and the institution with which the author is associated. The following covers recent dissertations found when using this search procedure: •
Tampon Labeling and Its Effect on Female Adolescents' Knowledge of Tampon Absorbency, Knowledge of Toxic Shock Syndrome and Tampon Usage Patterns (labeling Regulations) by Hanrahan, Susan Marie Noll, PhD from Temple University, 1992, 326 pages http://wwwlib.umi.com/dissertations/fullcit/9218075
•
The Adolescent Female's Attitude toward Menstruation and Perceptions of Toxic Shock Syndrome by Hummer, Anne Marie, PhD from The University of Toledo, 1989, 204 pages http://wwwlib.umi.com/dissertations/fullcit/8917579
76
Toxic Shock Syndrome
Keeping Current Ask the medical librarian at your library if it has full and unlimited access to the ProQuest Digital Dissertations database. From the library, you should be able to do more complete searches via http://wwwlib.umi.com/dissertations.
77
CHAPTER 5. PATENTS ON TOXIC SHOCK SYNDROME Overview Patents can be physical innovations (e.g. chemicals, pharmaceuticals, medical equipment) or processes (e.g. treatments or diagnostic procedures). The United States Patent and Trademark Office defines a patent as a grant of a property right to the inventor, issued by the Patent and Trademark Office.8 Patents, therefore, are intellectual property. For the United States, the term of a new patent is 20 years from the date when the patent application was filed. If the inventor wishes to receive economic benefits, it is likely that the invention will become commercially available within 20 years of the initial filing. It is important to understand, therefore, that an inventor’s patent does not indicate that a product or service is or will be commercially available. The patent implies only that the inventor has “the right to exclude others from making, using, offering for sale, or selling” the invention in the United States. While this relates to U.S. patents, similar rules govern foreign patents. In this chapter, we show you how to locate information on patents and their inventors. If you find a patent that is particularly interesting to you, contact the inventor or the assignee for further information. IMPORTANT NOTE: When following the search strategy described below, you may discover non-medical patents that use the generic term “toxic shock syndrome” (or a synonym) in their titles. To accurately reflect the results that you might find while conducting research on toxic shock syndrome, we have not necessarily excluded non-medical patents in this bibliography.
Patents on Toxic Shock Syndrome By performing a patent search focusing on toxic shock syndrome, you can obtain information such as the title of the invention, the names of the inventor(s), the assignee(s) or the company that owns or controls the patent, a short abstract that summarizes the patent, and a few excerpts from the description of the patent. The abstract of a patent tends to be more technical in nature, while the description is often written for the public. Full patent descriptions contain much more information than is presented here (e.g. claims, references, figures, diagrams, etc.). We will tell you how to obtain this information later in the chapter. 8Adapted from the United States Patent and Trademark Office: http://www.uspto.gov/web/offices/pac/doc/general/whatis.htm.
78
Toxic Shock Syndrome
The following is an example of the type of information that you can expect to obtain from a patent search on toxic shock syndrome: •
Absorbent article, particularly a tampon having additives that reduce toxic shock syndrome toxin production Inventor(s): Deresiewicz; Robert L. (Newton, MA), Kasper; Dennis L. (Newton, MA) Assignee(s): The Brigham and Women's Hospital, Inc. (Boston, MA) Patent Number: 6,548,552 Date filed: September 10, 1998 Abstract: An absorbent article, particularly a tampon having additives that reduce toxic shock syndrome toxin (TST-1) production is disclosed. The tampon has a combination of an effective amount of at least one oxygen inhibiting agent and an effective amount of at least one surface active agent applied to: the surface of the absorbent tampon material; the surfaces of the fibers comprising the tampon; to the tampon applicator; or any combination of the foregoing. The effective amounts of the oxygen inhibiting agent and the surface active agent are sufficient to reduce the toxin production at lease about 50%, but do not negatively affect the wearer's normal vaginal flora. Excerpt(s): This invention relates to an absorbent article, particularly a tampon having additives that reduce toxic shock syndrome toxin (TSST-1) production. Efforts to inhibit the production of toxic shock syndrome toxin (TSST-1) production are described in U.S. Pat. Nos. 5,547,985 and 5,612, 045. However, certain additives, while reducing toxic shock syndrome toxin production, will negatively impact the wearer's vaginal flora. Therefore, a need exists to provide a tampon having additives that will reduce toxic shock syndrome toxin (TSST-1) production without adversely affecting the normal vaginal flora or, if applied as a bandage, the normal flora at the relevant body site. This invention relates to an absorbent article, particularly a tampon having additives that reduce toxic shock syndrome toxin (TSST-1) production without adversely affecting a woman wearer's vaginal flora. Web site: http://www.delphion.com/details?pn=US06548552__
•
Additives to feminine products Inventor(s): Brown-Skrobot; Susan K. (Hamilton Square, NJ), Irving; Mary R. (Metuchen, NJ) Assignee(s): McNeil-PPC, Inc. (Skillman, NJ) Patent Number: 5,547,985 Date filed: November 12, 1993 Abstract: Nonabsorbent products and douche compositions for cleansing and placement within the vagina contain an amount of a compound effective to inhibit the production of toxic shock syndrome toxin-1 and Enterotoxins A, B and C when the products are brought into contact with the bacteria. The products and compositions of this invention are also effective in combatting streptococcal pyrogenic exotoxin and hemolysin production by Groups A, B, F and G streptococci. The compound is selected from the group consisting of monoesters of a polyhydric aliphatic alcohol and a C.sub.8 -C.sub.18 fatty acid; diesters of a polyhydric aliphatic alcohol and a C.sub.8 -C.sub.18 fatty acid;
Patents 79
and mixtures thereof. The monoesters and diesters have at least one hydroxyl group associated with their aliphatic alcohol residue. Excerpt(s): The present invention relates to nonabsorbent products used for intimate feminine hygiene such as douches, suppositories, gels, washes, as well as contraceptives. More particularly, the invention relates to an active component which, when incorporated into feminine hygiene products, will reduce the amount of certain toxins produced by bacteria. Many feminine hygiene and internal cleansing products are used by women predominantly in the form of liquids. More specifically, many women use liquid vaginal douches to irrigate and cleanse the vagina and prevent vaginal infections, for contraception and sterility and to promote abortion ("Feminine Hygiene Products: Why Your Advice Is Needed", U.S. Pharmacist, May, 1986, pp. 20-27, Thomas A. Gossel). Vaginal douche compositions may be made of a variety of compositions. Vinegar is the most common substance used for douching for the purpose of cleansing the vagina. Vinegar consists of approximately 4-6% acetic acid. There is, however, insufficient data to prove conclusively that vinegar is effective in altering the vaginal pH for a sufficient length of time to encourage growth of the normal vaginal flora, and thereby discourage infection. British Patent Specification No. 1,374,105, published November 13, 1974 and entitled "Effervescent Compositions" describes vaginal douche compositions containing silica gel. The compositions may be tabletted and used as denture cleaners, antacids, analgesing laxatives and vaginal douches. The compositions described contain carbon dioxide and/or oxygen generating materials, e.g., persulphate/perborate mixtures, and optimum pharmaceuticals, diluents, e.g., sodium chloride, chelating agents such as EDTA, surfactants, lubricants, flavorings and odors. Web site: http://www.delphion.com/details?pn=US05547985__ •
Contraceptive sponge and tampon Inventor(s): Leveen; Eric G. (19 Palmetto Rd., Charleston, SC 29407), Leveen; Harry H. (321 Confederate Cir., Charleston, SC 29407), Leveen; Robert F. (312 Lombard St., Philadelphia, PA 19147) Assignee(s): none reported Patent Number: 5,070,889 Date filed: November 15, 1990 Abstract: A bacteriocidal virocidal sponge containing iodine and/or chlorhexidine and a surfactant which can be used as a contraceptive and virocidal and bacteriocidal sponge positioned within a human body comprising a polyurethane open cell foam impregnated with a surfactant and iodine and/or chlorhexidine. A bactericidal tampon containing an iodophor or chlorhexidine does not induce toxic shock syndrome. Excerpt(s): In recent years there has been a serious increase in sexually transmitted disease. Sexual freedom among consenting adults has been a partial cause of this increase. In addition, oral contraceptives and a change in the mores has created a situation which has increased the number of sexual contacts, thus favoring dissemination of sexually transmitted disease. Since these factors are unlikely to change, sexually transmitted disease has now become a major public health problem. Some diseases which were formerly unassociated with sexual transmission, such as B virus hepatitis, are now known to be sexually transmitted. Other new diseases such as acquired immune deficiency syndrome (AIDS) are viral diseases which are usually transmitted sexually. A need therefore exists for all conceivable types of control
80
Toxic Shock Syndrome
measures to reverse the increasing incidence of sexually transmitted disease. The intravaginal contraceptive doughnut shaped sponge containing a spermicidal agent has become an accepted method of birth control in western society. Yet this sponge does little to halt the incidence of sexually transmitted disease which is steadily increasing. Such sponges are formed of an open cell polyurethane foam sponge impregnated with a spermicidal agent, nonoxynol-9, (U.S. Pat. No. 2,541,103). Nonoxynol is a polyethylene glycol nonylphenyl ether which is a mild surfactant. Like other non ionic surfactants it is a cytolytic agent which acts by disrupting the plasma membrane of animal cells. It is not as effective on the cell walls of bacteria which are unlike the lipid containing membranes of animal cells. Unfortunately, nonylphenoxypolyethoxyethanol is only bacteriostatic and not bacteriocidal when placed in a culture of staphlococcus aureus (TSS-S aureus). Toxic shock syndrome (TSS) is caused by the proliferation of staphlococcus aureus in absorbent tampons at the time of menstruation and in contraceptive sponges used in the absence of menstruation. Although nonoxynol does suppress colony counts of staphlococcus aureus during the first 6 hours of growth in a culture medium, the number of bacteria in the culture flask after 30 hours has been shown to be identical to that of control cultures. (Contraception 33:395 1986). Therefore, nonoxynol does not prevent the growth of staphlococci in contraceptive sponges and the absorption of the toxins from proliferating staphlococci can produce toxic shock syndrome. Thirteen cases have been reported in users of a contraceptive sponge impregnated with nonoxynol. (Int Fertil [Sweden] 30:81 1985). In all of these cases, TSS-S aureus was cultured. It has been estimated that the incidence of TSS would be 10 cases a year per 100,000 women using the sponge. To prevent TSS, contraceptive sponges must contain a bacteriocidal agent in addition to nonoxynol. The current mortality from TSS is 3% (J.A.M.A. 251:1016 1984). The death rate in contraceptive sponge users is less than that occurring with tampons where the incidence of TSS is also 10 per 100,000 menstrual users (NEJM 303:1429 1980). Even though nonoxynol is only bacteriostatic, a study of prostitutes in Bangkok, Thailand who used nonoxynol-9 intravaginal contraceptive sponges showed that these prostitutes had a lower incidence of venereal disease (chlamydial infection and gonorrhea) than those who did not use this contraceptive sponge. (J.A.M.A. 257:2308 1987). The incidence of monilia vaginitis was increased because nonoxinol is not fungicidal. The slight reduction in the incidence of venereal disease in frequently exposed prostitutes is not acceptable with regard to disease prevention and the decrease in incidence is eventually eliminated by frequency of exposure. If a contraceptive sponge could be made which contained virocidal, bactericidal and fungicidal agents in addition to the spermicide, it would completely protect against sexually transmitted disease. Such a sponge would not only protect the female from sexually transmitted disease, but would be equally protective for the male. This consideration has not been addressed by the medical literature. Bactericidal tampons would eliminate the possibility of toxic shock syndrome. Such developments would fulfill major public health needs and lead to a reduction in the rate of sexually transmitted disease. The present invention describes a bacteriocidal, virocidal and protozocical contraceptive sponge which, unlike a sponge which relies totally on a spermicidal agent which cannot prevent sexually transmitted disease, liberates a biocidal agent. The present invention preferentially liberates iodine which is useful in treating vaginal infections (vaginitis) caused by trichomonas, gonococcus, monilia and chlamydia. A vaginal absorbent tampon which cannot induce toxic shock syndrome is also described. Furthermore, such a contraceptive sponge releasing iodine in addition to nonoxynol would lower the incidence of carcinoma of the cervix which is now known to be a manifestation of the sexually transmitted papilloma virus. Iodine would also prevent the transmission of the highly prevalent genital herpes which is known to predispose to malignancy.
Patents 81
Web site: http://www.delphion.com/details?pn=US05070889__ •
Detection for Staphylococcus spp. Inventor(s): Nakagami; Satoru (Hiroshima, JP), Ubukata; Kimiko (Tokyo, JP), Yamane; Akio (Miyoshi, JP) Assignee(s): Wakunaga Seiyaku Kabushiki Kaisha (Osaka, JP) Patent Number: 5,437,978 Date filed: August 4, 1992 Abstract: The present invention discloses a primer for detecting methicillin-resistant or toxic shock syndrome toxin-1 Staphylococcus spp. comprising any one of nucleotide fragments of sequences (1) to (4):5'GAAATGACTGAACGTCCGAT (1)5'GCGATCAATGTTACCGTAGT (2)5'AGTATGGGCCAAAGTTCGAT (3)5'CACTTTGATATGTGGATCCG (4)a method and kit for detecting these bacteria using the primer. The present invention makes direct and rapid detection of MRS and/or TPS from samples possible, and enables patients with infections caused by these bacteria to be treated at an early stage. Excerpt(s): The present invention relates to a primer for detecting methicillin-resistant and/or toxic shock syndrome toxin 1 producing Staphylococcus spp., a method for detecting these bacteria using the primer, and a kit for detecting them. Staphylococcus spp. including Staphylococcus aureus as a typical bacterium, which have strong pathogenicity, are well known as causative bacteria to various infections. Since these Staphylococcus spp. are generally sensitive to.beta.-lactam series drugs, the infections can be prevented and treated with these drugs. However, a methicillin-resistant Staphylococcus sp. (abbreviated as MRS hereinafter) is so extensively resistant to the.beta.-lactam series drugs that it is difficult to treat infections caused by these methicillin-resistant bacteria. This provides serious problems that the methicillinresistant bacteria cause opportunistic infections, postoperative infections and the like in the clinical practice. Since the.beta.-lactam series drugs have high safety and wide antibacterial spectra, some of the.beta.-lactam series drugs are widely used as primary choices of drugs against various infections. The mechanism of these drugs is that binding of the.beta.-lactam series drugs to cell wall-synthesizing enzymes (penicillinbinding proteins: PBPs) which are essential for growth of bacteria results in inhibition of the growth of the bacteria. However, the methicillin-resistant bacteria have changed to produce an additional low-affinity penicillin-binding protein, PBP-2'[Hayes, at al., FEMS Microbial. Lett., 30, 119-122(1981)], which is active at.beta.-lactam concentrations that saturate normal complement of PBPs, so that these bacteria are resistant to.beta.-lactam series drugs. Web site: http://www.delphion.com/details?pn=US05437978__
82
Toxic Shock Syndrome
•
Hexahydro-5-imino-1,4-heteroazepine derivatives as inhibitors of nitric oxide synthases Inventor(s): Caldwell; Charles G. (Scotch Plains, NJ), Furman; Karla L. (Red Bank, NJ), Hagmann; William K. (Westfield, NJ), Maccoss; Malcolm (Freehold, NJ), Shah; Shrenik K. (Metuchen, NJ), Shankaran; Kothandaraman (Kendall Park, NJ) Assignee(s): Merck & Co., Inc. (Rahway, NJ) Patent Number: 6,043,358 Date filed: September 25, 1996 Abstract: Disclosed herein are compounds of Formula I and pharmaceutically acceptable salts thereof which have been found useful in the treatment of nitric oxide synthase mediated diseases and disorders, including neurodegenerative disorders, disorders of gastrointestinal motility and inflammation. These diseases and disorders include hypotension, septic shock, toxic shock syndrome, hemodialysis, IL-2 therapy such as in in cancer patients, cachexia, immunosuppression such as in transplant therapy, autoimmune and/or inflammatory indications including sunburn, eczema or psoriasis and respiratory conditions such as bronchitis, asthma, oxidant-induced lung injury and acute respiratory distress (ARDS), glomerulonephritis, restenosis, inflammatory sequelae of viral infections, myocarditis, heart failure, atherosclerosis, osteoarthritis, rheumatoid arthritis, septic arthritis, chronic or inflammatory bowel disease, ulcerative colitis, Crohn's disease, systemic lupus erythematosis (SLE), ocular conditions such as ocular hypertension, retinitis and uveitis, type 1 diabetes, insulin-dependent diabetes mellitus and cystic fibrosis. Excerpt(s): This application is directed to inhibitors of nitric oxide synthase, and in particular cyclic amidines. The emergence of nitric oxide (NO), a reactive, inorganic radical gas as a molecule contributing to important physiological and pathological processes is one of the major biological revelations of recent times. This molecule is produced under a variety of physiological and pathological conditions by cells mediating vital biological functions. Examples include endothelial cells lining the blood vessels; nitric oxide derived from these cells relaxes smooth muscle and regulates blood pressure and has significant effects on the function of circulating blood cells such as platelets and neutrophils as well as on smooth muscle, both of the blood vessels and also of other organs such as the airways. In the brain and elsewhere nitric oxide serves as a neurotransmitter in non-adrenergic non-cholinergic neurons. In these instances nitric oxide appears to be produced in small amounts on an intermittent basis in response to various endogenous molecular signals. In the immune system nitric oxide can be synthesized in much larger amounts on a protracted basis. Its production is induced by exogenous or endogenous inflammatory stimuli, notably endotoxin and cytokines elaborated by cells of the host defense system in response to infectious and inflammatory stimuli. This induced production results in prolonged nitric oxide release which contributes both to host defense processes such as the killing of bacteria and viruses as well as pathology associated with acute and chronic inflammation in a wide variety of diseases. The discovery that nitric oxide production is mediated by a unique series of three closely related enzymes, named nitric oxide synthases, which utilize the amino acid arginine and molecular oxygen as co-substrates has provided an understanding of the biochemistry of this molecule and provides distinct pharmacological targets for the inhibition of the synthesis of this mediator, which should provide significant beneficial effects in a wide variety of diseases. (iii) a Ca.sup.++ independent enzyme which is induced after activation of vascular smooth muscle, macrophages, endothelial cells, and a large number of other cells by endotoxin
Patents 83
and cytokines. Once expressed, this inducible NO synthase produces NO in relatively large amounts for long periods of time. Web site: http://www.delphion.com/details?pn=US06043358__ •
Method for removing toxic shock syndrome toxin-1 in body fluids by adsorption Inventor(s): Asahi; Takashi (Kobe, JP), Hirai; Fumiyasu (Amagasaki, JP), Maruyama; Hiroyuki (Kakogawa, JP), Ogino; Eiji (Kobe, JP), Sakogawa; Takayuki (Takasago, JP), Tani; Nobutaka (Osaka, JP) Assignee(s): Kaneka Corporation (Osaka, JP) Patent Number: 6,315,907 Date filed: October 19, 1999 Abstract: An adsorbent for toxic shock syndrome toxin-1 (TSST-1) comprising a compound which has a log P value of at least 2.50 wherein P is a partition coefficient in an octanol-water system and which is immobilized on a water-insoluble carrier; a method for removing TSST-1 body fluids by adsorption which comprises bringing a body fluid containing TSST-1 into contact with the adsorbent; an adsorber for TSST-1 comprising an adsorbent packed in a container having an inlet and an outlet for a body fluid and a means for preventing the adsorbent from flowing out of the container; and use of the adsorbent. TSST-1 in body fluids can be efficiently removed by the adsorbent. Excerpt(s): The present invention relates to an adsorbent for toxic shock syndrome toxin 1, a method for removing the toxin by adsorption, an adsorber comprising the adsorbent packed, and use of the adsorbent. The toxic shock syndrome toxin 1 (hereinafter referred to as "TSST-1") is an exotoxin composed of a soluble protein having a molecular weight of about 20-30 kDa produced by Staphylococcus aureus, and is a representative superantigen. Sepsis refers to a state that an infection exists somewhere in a body, whereby a systemic inflammatory response has occurred. If this inflammatory symptom accelerates, a shock symptom (septic shock) occurs, and organopathy (organ failure) occurs, further falling into such a grave state as multi-organ failures. The source of that infection is mainly bacteria, and the bacteria is roughly classified into Gram-positive bacteria and Gram-negative bacteria. Web site: http://www.delphion.com/details?pn=US06315907__
•
Peptides useful for reducing symptoms of toxic shock syndrome Inventor(s): Bannan; Jason D. (Thompson Station, TN), Zabriskie; John B. (New York, NY) Assignee(s): The Rockefeller University (New York, NY) Patent Number: 6,075,119 Date filed: April 7, 1997 Abstract: This invention relates to compositions and methods for eliciting an immunogenic response in mammals, including responses which provide protection against, or reduce the severity, of toxic shock from bacterial infections. More particularly it relates to peptides derived from homologous sequences of the family of staphylococcal and streptococcal toxins, which may be polymeric, and carrier-conjugates thereof, and their use to induce serum antibodies. The invention also relates to serum
84
Toxic Shock Syndrome
antibodies induced by the peptides and carrier-conjugates and their use to prevent, treat, or protect against the toxic effects of most, if not all, of the staphylococcal and streptococcal toxins.The invention also relates to diagnostic assays and kits to detect the presence of staphylococcal and streptococcal toxins, or antibodies thereto. The invention also relates isolated and purified to nucleic acids encoding the peptides of the invention and transformed host cells containing those nucleic acids. Excerpt(s): This invention relates to compositions and methods for eliciting an immunogenic response in mammals, including responses which provide protection against, or reduce the severity, of toxic shock syndrome from bacterial infections. More particularly it relates to peptides, which may be polymeric, and carrier-conjugates thereof, derived from homologous sequences of the family of staphylococcal and streptococcal pyrogenic toxins. The peptides of the invention are useful to induce serum antibodies and may also be useful in diagnostic assays. The invention also relates to antibodies induced by the peptides and/or carrier-conjugates and their use to prevent, treat, or protect against the toxic effects of bacterial toxins, including most, if not all, of the staphylococcal and streptococcal pyrogenic toxins. The invention also relates to compositions and methods to protect against, or ameliorate the effects of, autoimmune diseases which are associated with, or are the result of, the presence of staphylococcal or streptococcal toxins. The invention also relates to diagnostic assays and kits to detect the presence of staphylococcal and streptococcal pyrogenic toxins, or antibodies thereto. Web site: http://www.delphion.com/details?pn=US06075119__ •
Sanitary napkin Inventor(s): Auerbach; Sidney (246 W. End Ave., New York, NY 10023) Assignee(s): none reported Patent Number: 4,405,323 Date filed: September 8, 1981 Abstract: A tampon (10) designed to eliminate the hazards of toxic shock syndrome or dysmenorrhea by incorporating an antibacterial agent (or agent effective against other microorganisms) into the tampon (10). The antibacterial agent suspended in an adhesive is coated onto a cylindrical insert of absorptive material (12), a tubular applicator container (22), and a plunger (26). On contact with body fluids the antibacterial agent disperses, preventing development of the organisms which produce the toxins which cause toxic shock syndrome. Excerpt(s): The invention relates to sanitary napkins of the tampon type which are positioned within the vaginal vault during menstruation, and to other types of tampons used in surgical procedures at other body sites, to prevent or diminish the tendency of pathogenic organisms to cause toxic shock syndrome and dysmenorrhea. Recently, the attention of the medical community has been focused upon toxicity problems associated with the use of tampons. Generally, the problem arises as an infection due to Staphylococcus aureaus in the vagina in menstruating women who are using tampons. Medical authorities have suggested dealing with the problem by a number of techniques. These include discontinuing the use of tampons, discontinuing the use of tampons which are inserted with syringe type mechanical devices and/or alternating the use of inserted tampons with externally used absorbtive feminime napkins. Web site: http://www.delphion.com/details?pn=US04405323__
Patents 85
•
Substituted 2,3,3a,6-tetrahydro-6-oxobenzofuran derivative useful as PAF antagonist Inventor(s): Bugianesi; Robert L. (Colonia, NJ), Chang; Michael N. (Westfield, NJ), Hwang; San-Bao (Scotch Plains, NJ), Ponpipom; Mitree M. (Branchburg, NJ) Assignee(s): Merck & Co., Inc. (Rahway, NJ) Patent Number: 4,704,462 Date filed: August 22, 1985 Abstract: Substituted 2,3,3a,6-tetrahydro-6-oxobenzofuran derivatives have been prepared. These neolignans are found to have potent and specific PAF (PlateletActivating-Factor) antagonistic activities and thereby useful in the treatment of various diseases or disorders mediated by PAF, for example, pain, fever, inflammation, cardiovascular disorder, asthma, lung edema, allergic disorders, skin diseases, psoriasis, toxic shock syndrome and adult respiratory distress syndrome. Excerpt(s): Platelet-activating factor (PAF) has recently been identified as an acetyl glyceryl ether phosphorylcholine (AGEPC), i.e., 1-O-hexadecyl/octadecyl-2-O-acetyl-snglycero-3-phosphorylcholine (Hanahan, D. S. et al., J. Biol. Chem., 255: 5514, 1980). It is a potent lipid mediator of inflammation and anaphylaxis and is produced by stimulated basophils, neutrophils, platelets, macrophages, endothelial cells, and IgE-sensitized bone marrow mast cells. PAF exerts a myriad of biological actions. It induces smoothmuscle contraction, aggregration, chemotaxis, and degranulation of neutrophil and heightened metabolic activity of macrophages in vitro. It also reduces coronary blood flow and contractile force of isolated guinea pig heart, leading to cardiac anaphylaxis. In various animal models, PAF induces bronchoconstriction, hyperalgesia, hypotension, neutropenia, thrombocytopenia, increased cutaneous vascular permeability, increased hematocrit, and lysosomal enzyme secretion. In man, intradermal injection of PAF at 0.1.mu.g per site elicits a biphasic inflammatory response, which is potentiated by prostaglandin E.sub.2. Thus, PAF has been linked to various biologic activities and pathways making it one of the important mediators responsible for a variety of physiological process which are known to be associated with a large group of diseases, for example, inflammatory diseases, cardiovascular disorders, asthma, lung edema, endotoxin shock syndrome, and adult respiratory distress syndrome. The compounds of the present invention are potent and specific PAF-antagonists. They belong to the class of neolignan compounds related to piperenone, a known insect antifeeding substance, and 5-allyl-2-(3,4-dimethoxyphenyl)-3a,.alpha.-methoxy-3-methyl-2,3,3a,6-tetra hydro-6oxobenzofuran, the subject matter of copending application Ser. No. 541,806, filed Oct. 13, 1983 now U.S. Pat. No. 4,540,709. Both piperenone and the 5-allyl compound mentioned above were isolated from the Chinese herbal plant Piper futokadzsura Sieb. See K. Matsui et al., Agr. Biol. Chem. 40, 1045 (1976); ibid, 40, 1113 (1976); and Matsui et al., Tetrahedron Letters 24, 1905 (1975). Although the plant has been used in Chinese herbal medicine for the treatment of arthritic conditions, no one had successfully isolated nor identified the active substance until our work on the 5-allyl compound and the compounds of the present invention. We found these compounds to be potent and specific PAF-antagonists useful not only in the treatment of arthritic conditions but also for other diseases including asthma, hypertension, lung-edema, endotoxin shock syndrome, adult distress syndrome and the like. Accordingly, it is the object of the present invention to provide a class of novel compounds as specific PAF-antagonists. Web site: http://www.delphion.com/details?pn=US04704462__
86
Toxic Shock Syndrome
•
Substituted quinoxaline derivatives as interleukin-8 receptor antagonists Inventor(s): Carson; Kenneth G. (Needham, MA), Connor; David Thomas (Ann Arbor, MI), Li; Jie Jack (Ann Arbor, MI), Low; Joseph Edwin (Brighton, MI), Luly; Jay R. (Wellesley, MA), Miller; Steven Robert (Ann Arbor, MI), Roth; Bruce David (Plymouth, MI), Trivedi; Bharat Kalidas (Farmington Hills, MI) Assignee(s): Millennium Pharmaceuticals, Inc. (Cambridge, MA) Patent Number: 6,548,499 Date filed: October 20, 2000 Abstract: Quinoxaline compounds are described as well as methods for the preparation and pharmaceutical compositions of same, which are useful as interleukin-8 (IL-8) receptor antagonists and can be used in the treatment of a chemokine-mediated disease wherein the chemokine binds to an IL-8a (CXCR1) or b (CXCR2) receptor such as a chemokine-mediated disease selected from psoriasis, or atopic distress syndrome, arthritis, inflammatory bowel disease, Crohn's disease, ulcerative colitis, gastric ulcer, septic shock, endotoxic shock, gram-negative sepsis, toxic shock syndrome, stroke, cardiac and renal reperfusion injury, glomerulo-nephritis, or thrombosis, Alzheimer's disease, graft versus host reaction, allograft rejections, or allergic diseases. Excerpt(s): The present invention relates to novel quinoxaline compounds useful as pharmaceutical agents, to methods for their production, to pharmaceutical compositions which include these compounds and a pharmaceutical carrier, and to pharmaceutical methods of treatment. The compounds of the present invention are Interleukin-8 (IL-8) receptor antagonists. More particularly, the compounds of the present invention are useful in the treatment of a chemokine-mediated disease wherein the chemokine binds to an IL-8a (CXCR1) or b (CXCR2) receptor such as, for example, a chemokine-mediated disease selected from psoriasis, or atopic dermatitis, tumor growth and angiogenesis, asthma, chronic obstructive pulmonary disease, adult respiratory distress syndrome, arthritis, inflammatory bowel disease, Crohn's disease, ulcerative colitis, gastric ulcer, septic shock, endotoxic shock, gram-negative sepsis, toxic shock syndrome, stroke, cardiac and renal reperfusion injury, glomerulo-nephritis, or thrombosis, Alzheimer's disease, graft versus host reaction, allograft rejections, or allergic diseases. We have identified a series of quinoxalines that are IL-8 receptor antagonists and which can additionally be used in psoriasis, or atopic dermatitis, disease associated with pathological angiogenesis (i.e. cancer), asthma, chronic obstructive pulmonary disease, adult respiratory distress syndrome, arthritis, inflammatory bowel disease, Crohn's disease, ulcerative colitis, gastric ulcer, septic shock, endotoxic shock, gram-negative sepsis, toxic shock syndrome, stroke, cardiac and renal reperfusion injury, glomerulonephritis, or thrombosis, Alzheimer's disease, graft versus host reaction, allograft rejections, or allergic diseases. or a pharmaceutically acceptable salt thereof. Web site: http://www.delphion.com/details?pn=US06548499__
•
Tampon and method of making same Inventor(s): Milbrada; Edward John (West Chester, OH), Osborn, III; Thomas Ward (Cincinnati, OH) Assignee(s): The Procter & Gamble Company (Cincinnati, OH) Patent Number: 5,817,047 Date filed: March 17, 1997
Patents 87
Abstract: Absorptive pads including catamenial tampons are provided which are characterized by O.sub.2 levels sufficiently reduced so as to reduce the introduction of air into the vaginal canal with a resulting reduction in the probability of production of toxic shock syndrome exotoxin during internal use of the pads. Excerpt(s): The invention relates generally to absorptive pads for internal use including surgical and wound dressings and packings, and surgical sponges and more specifically to catamenial tampons. The invention further relates to such absorptive pads intended to reduce the introduction of air into the vaginal canal with a resulting reduction in the probability of production of toxic shock syndrome exotoxin as a result of insertion of such pads and methods for production of such pads. Toxic shock syndrome is a syndrome with a high mortality rate characterized by rapid onset of high fever, vomiting, diarrhea and rash followed by a rapid drop in blood pressure and vital organ failure. Toxic shock syndrome is associated with the presence of Staphylococcus aureus bacteria and one or more exotoxins which are produced by the bacteria. The exotoxins associated with toxic shock syndrome include Exotoxin A, B, and C, Pyrogenic Exotoxin C, Enterotoxin A, Enterotoxin B, Enterotoxin C, Staphylococcal Enterotoxin F and Toxic Shock Syndrome toxin-1. Toxic shock syndrome is not caused by the bacteria per se but rather by the toxic effects of the associated exotoxin which can pass from the vagina and other internal body cavities into the bloodstream. Toxic shock syndrome has been found to be associated with the use of absorptive pads within the vagina which may promote the growth of bacteria and the production of exotoxin in their vicinity. The syndrome has been observed with surgical dressings but appears to be particularly associated with the use of catamenial tampons. The syndrome appears to occur with elevated frequency in association with those absorptive pads which are characterized by high levels of absorbency and which accordingly are left inside the body for extended periods. Of interest to the present invention is the observation of Robbins et al., J. Clin. Microbiol., 25, 1446-1449 (1987) that the main role of tampons in toxic shock syndrome may be that of providing a fibrous surface for heavy colonization and sufficient air for toxin production. Lee et al., J. Clin. Microbiol., 25, 87-90 (1987) suggest that elevated levels of CO.sub.2 promote toxin production. Web site: http://www.delphion.com/details?pn=US05817047__ •
Trap Inventor(s): Davis; Sandra L. (3325 Cherokee Ave., San Diego, CA 92104-4412), Kielty; Michael G. (3023 Bunker Hill St., Ste. 201, San Diego, CA 92109) Assignee(s): none reported Patent Number: 5,353,811 Date filed: March 4, 1992 Abstract: The invention is made of a flexible metal rim(6) containing within its circumference plastic, triangular, pointed, curved spears(2), which move only inward. Attached to the rim(6) is a thin, hollow, rubber pocket (3), reinforced in a cage-like manner with heavier rubber(4). It can be pre-lubricated in the manner of a condom. It is inserted into the vagina by the woman wearing it by folding the pocket(3) lengthwise and pushing it into the vaginal cavity. Upon release, the pocket(3) expands slightly to fill the vaginal cavity. The flexible metal rim(6) can then be pushed upward to fit into the outer end of the vaginal opening (8). It has two small lips(1), at the top and bottom of the flexible rim(6), which are used as grips for removal. A woman can pry either lip(1) with a thumbnail or fingernail and draw the invention out of the vagina. It is disposable.
88
Toxic Shock Syndrome
It can be worn for a few hours or all night. Possibly it should not be worn for more than 24 hours, as an association between wearing it and toxic shock syndrome in some women will not have been established. A physician can be consulted as to proper insertion and care. It can be made in small, medium and large sizes to accommodate different vaginas and it can be worn by women of all ages. It can be made of several types of rubber and plastic, some more flexible than others. Excerpt(s): The nature of the invention is one of bodily harm to men during the act of rape. It is an intra-vaginal anti-rape device which consists of a thin rubber pocket, reinforced in a cage-like manner with heavier rubber, which fills the vaginal cavity and has at its open end, at the vaginal opening, a flexible metal rim containing, within its circumference, pointed, curved, plastic spears which trap a rapist's penis by embedding their points under the head of the penis upon outward movement. The object of the invention is to cause enough bodily harm to a rapist as to necessitate emergency medical treatment, possibly surgical treatment, and to prevent the spread of sexually transmitted diseases, such as Aids, and unwanted pregnancies due to rape. Men contemplating rape, after the use of this invention becomes known, might not attempt it for fear that any woman might be wearing this invention. The subject matter which we regard as the invention is an elongated pocket of thin rubber(3) reinforced with heavier rubber(4) in a cage-like manner, and fits into a woman's vagina(5), the closed end of the pocket being at the inner end of the vagina(7) and the open end of the pocket being at the outer end of the vagina(8), and that open end consisting of a circular, reinforced, flexible metal rim(6) containing within its circumference pointed, curved, plastic spears(2) which point only inward into the empty cavity of the pocket. The flexible metal rim has two lips(1), one at the upper edge and one at the lower edge of the opening of the invention. These lips(1) project slightly outward from the rim(6) and provide grips for the removal of the invention by the woman wearing it. The thumbnail or other fingernail can pry the lip(1) outward at an angle and the pocket can be drawn out of the vagina(5). The invention inserted into a woman's vagina is a weapon against the act of rape. When a woman is raped the penis of the rapist enters the vagina through the invention and is enclosed in the pocket of the invention. When the penis is pulled out the spears(2) catch it by embedding their points under the head of the penis and the spears out into the flesh, causing great pain, bleeding, a need for emergency medical treatment and possibly death. The invention described herein could be so embedded under the head of the penis that it would be pulled out of the vagina, attached to the penis, when the rapist senses pain, and it could necessitate surgical removal. The invention inserted into a woman's vagina protects her from unwanted semen, as any fluid ejaculated through a penis into the pocket of the invention would be contained therein. This would protect her from an unwanted pregnancy as a result of being raped and could protect her from the spread of Aids and other sexually transmitted diseases from a rapist who had such a disease. This could protect women from being raped by acting as a deterrent, because once this invention became known to the public, a rapist might be fearful of any woman wearing it. Rape is an act of violence and this invention is an equal and passive answer to that act. Web site: http://www.delphion.com/details?pn=US05353811__
Patents 89
•
Tumor killing effects of enterotoxins, superantigens, and related compounds Inventor(s): Terman; David S. (3183 Palmero Way, Pebble Beach, CA 93953) Assignee(s): none reported Patent Number: 6,338,845 Date filed: May 18, 1999 Abstract: Superantigens, including staphylococcal enterotoxins, are useful agents for killing tumor cells, enhancing antitumor immunity and treating cancer in a tumorbearing host. Other useful superantigens include Streptococcal pyrogenic exotoxin, toxic shock syndrome toxins, mycoplasma antigens, mycobacteria antigens, minor lymphocyte stimulating antigens, heat shock proteins, stress peptides and derivatives thereof. The immune system of a subject with cancer is contacted with tumor cells that have been transfected with a nucleic acid encoding a superantigen or biologically active polypeptide of a superantigen. Alternatively, transfected accessory cells, inmunocytes or fibroblasts are used. Expression of the superantigen in the host induces T cell proliferation leading to increased antitumor immunity and tumor cell killing. The superantigen encoding nucleic acid may be administered to the tumor in vivo to transfect tumor cells, wherein superantigen expression induces a tumoricidal immune response. Furthermore, transfected cells incubated ex vivo with an immunocyte population, particularly T lymphocytes, tumoricidally activate the population; such activated cells are then administered to the tumor-bearing host. Excerpt(s): This invention relates generally to tumoricidal compositions and methods, and more specifically to superantigens or enterotoxins derived from Staphlococcus aureus. Peptides homologous to the enterotoxins including toxic shock syndrome toxin (TSST-1), Streptococcal pyrogenic exotoxins, mycoplasma and mycobacterial species, minor lymphocyte stimulating antigens, heat shock proteins, stress peptides, mammary tumor virus peptides, homologous synthetic polypeptides, biochemically derivatized enterotoxins, genetically engineered enterotoxins and fusion proteins are also described in this application. This invention also relates to enterotoxins and homologous compounds known as superantigens expressed on the surface of lipid droplets (in adjuvant-vehicle formulations) or expressed on biologic cell surfaces as a result of enterotoxin gene transfection and used to produde a tumoricidal response in a tumor bearing host. This invention also relates to enterotoxins and related compounds administered intravenously, subcutaneously, as in adjuvant form, or used extracorporeally in free or bound form to stimulate immunocytes which are subsequently infused into tumor bearing hosts. Therapy of the neoplastic diseases has largely involved the use of chemotherapeutic agents, radiation and surgery. However, results with these measures, while beneficial in some tumors, has had only marginal or no effect in many others, while demonstrating unacceptable toxicity. Hence, there has been a quest for newer modalities to treat neoplastic diseases. Web site: http://www.delphion.com/details?pn=US06338845__
90
Toxic Shock Syndrome
Patent Applications on Toxic Shock Syndrome As of December 2000, U.S. patent applications are open to public viewing.9 Applications are patent requests which have yet to be granted. (The process to achieve a patent can take several years.) The following patent applications have been filed since December 2000 relating to toxic shock syndrome: •
Lys-pro-val dimer, formulations and applications Inventor(s): Catania, Anna P.; (Milan, IT), Lipton, James M.; (Woodland Hills, CA) Correspondence: Perkins Coie Llp; Post Office Box 1208; Seattle; WA; 98111-1208; US Patent Application Number: 20030176353 Date filed: April 29, 2003 Abstract: The present invention is directed to a system for treating uro-genital conditions. One aspect of this invention involves the treatment system comprising one or more polypeptides with a amino acid sequence including KPV (SEQ. ID. NO. 1), MEHFRWG (SEQ. ID. NO. 2) HFRWGKPV (SEQ. ID. NO. 3), SYSMEHFRWGKPV (SEQ. ID. NO. 4), for treatment of uro-genital conditions. The one or more polypeptides can also be a dimer formed from any of the amino acid sequence above. Uro-genital conditions can include infections, inflammation, or both. In one preferred embodiment of the invention, the uro-genital condition includes infection and/or inflammation of the vagina, vulva, urinary tract, penis, and/or the rectum. In another preferred embodiment of the invention, the one or more polypeptides are dissolved in a carrier. In another preferred embodiment of the invention, the one or more polypeptides are associated with a tampon for preventing toxic shock syndrome. In another preferred embodiment, the one or more polypeptides are associated with a contraceptive for prevention of sexually transmitted diseases or infections. In another preferred embodiment, the one or more polypeptides are associated with a suppository for insertion into the vagina or rectum. Excerpt(s): The present application is a utility application that claims priority to U.S. Provisional Patent Application Serial No. 60/126,233 entitled Antimicrobial Amino-Acid Sequences Derived from Alpha-Melanocyte Stimulating Hormone, filed Mar. 24, 1999. The present invention relates to the field of treatment for uro-genital conditions. Urogenital conditions or diseases commonly affect both men and women. These conditions include infections and/or inflammation of the urinary system and the genital system. For example, according to the National Institute of Child Health and Human Development (NICHD), "most women will have at least one form of vaginitis in their lifetime." Vaginitis, National Institute of Child Health and Human Development-Publications On-line, (last modified Jan. 12, 2000),
. The causes for vaginitis range from bacterial, fungal, or viral infections to irritations from chemicals in creams, sprays, or even clothing that are in contact with this area. Id. For women with bacterial and fungal infections, these infectious agents often originate from the rectal area and migrate across the perineum to reach the vagina or the urethra. Web site: http://appft1.uspto.gov/netahtml/PTO/search-bool.html
9
This has been a common practice outside the United States prior to December 2000.
Patents 91
•
Method of preventing T cell-mediated responses by the use of the major histocompatibility complex class II analog protein (map protein) from Staphylococcus aureus Inventor(s): Brown, Eric; (Houston, TX), Hook, Magnus; (Houston, TX), Lee, Lawrence; (Houston, TX) Correspondence: Larson & Taylor, Plc; 1199 North Fairfax Street; Suite 900; Alexandria; VA; 22314; US Patent Application Number: 20030108564 Date filed: January 10, 2002 Abstract: A method of immunomodulating the T cell response in Staphylococcal bacteria is provided wherein an effective amount of the Map protein from Staphylococcus aureus is administered to a host to prevent or suppress the T cell response. The present method may be utilized with either the Map protein or an effective subdomain or fragment thereof such as the Map 10 or Map 19 protein. The present invention is advantageous in that suppression or prevention of the T cell response in a host can prevent or ameliorate a wide variety of the pathogenic conditions such as T cell lymphoproliferative disease and toxic shock syndrome wherein the overstimulation of T cells needs to be suppressed or modulated. Excerpt(s): This application claims the benefit of U.S. Provisional application Serial No. 60/260,523, filed Jan. 10, 2001. The present invention relates in general to the utilization of major histocompatibility complex class II analog protein, or "Map" protein, and its biologically effective fragments and domains thereof, in therapeutic methods to combat conditions associated with T cell proliferation, and in particular to the use of the Map protein and effective or active fragments thereof, including the Map10 or Map19 protein, in methods of suppressing or modulating T cell-mediated responses where necessary to alleviate a pathogenic condition. Staphylococcus aureus (SA) is an opportunistic pathogen that can cause a wide spectrum of infections from superficial local skin infections to life-threatening systemic infections that can affect internal organs and tissues. In addition, bacterial arthritis, as well as acute and chronic osteomyelitis caused by haematogenous spread or by direct inoculation in open trauma or surgical intervention such as internal fixation or joint replacement, affect hundreds of thousands of patients each year (1-6). SA is also a major cause of infections associated with indwelling medical devices, such as catheters and prosthesis (6). The cost to society in patient care, which often involves extended hospital stays and repeated surgery, can be estimated at several billion dollars per year. With the documented emergence of multidrug resistance SA strains, the threat of this widely distributed pathogen is now appreciated and novel therapies for treatment and prevention are needed. Web site: http://appft1.uspto.gov/netahtml/PTO/search-bool.html
•
Method of using lectins for agglutination and collection of menstrual flow Inventor(s): Krivan, Howard C.; (Santa Barbara, CA), Oldham, Michael J.; (Oxnard, CA), Potter, Richard C.; (Seeley Lake, MT) Correspondence: Vorys, Sater, Seymour And Pease Llp; Suite 1111; 1828 L Street, NW; Washington; DC; 20036-5104; US Patent Application Number: 20020082571 Date filed: December 13, 2001
92
Toxic Shock Syndrome
Abstract: Menstrual discharge is coagulated by contacting with one or more lectins capable of agglutinating blood with the menstrual flow to coagulate the blood at least partially, thereby rendering it easier to control and collect. The lectins may be applied either alone, in neat or formulated form, or in conjunction with an intravaginal or extravaginal device. Toxic shock syndrome is prevented by administering one or more lectins capable of diminishing the infective capability of the microorganism causing toxic shock. Excerpt(s): This invention relates generally to methods for collecting and controlling menstrual flow and, more particularly, to the use of lectins, intravaginally or extravaginally, for agglutinating and controlling menstrual flow. Women have always had to contend with the monthly inconvenience of their reproductive cycle. Various products have been introduced over the years to deal with this problem, including external absorbent pads and internal absorbent tampons of various shapes and absorbencies, as well as non-absorbent collection devices to trap menstrual discharge in liquid form. All of these products have limitations when used, including leakage (sometimes leading to staining of clothes), odor, inconvenience, messiness, and/or the possibility of infection. These problems stem from the fact that menstrual discharge consists primarily of uncoagulated blood and, hence, is a low-viscosity fluid which flows readily (thereby contributing to leakage through or around a device), has high potential for staining (particularly for staining clothes if device leakage occurs and, also, the fingers and hands upon device insertion or removal), and is readily capable of harboring and nurturing microorganisms which are capable of propagating strong odors and even infection, such as toxic shock syndrome (TSS). As a result, it is evident that a purely mechanical device such as a pad, tampon or non-absorbent collector is limited in its effectiveness because of the fluid properties inherent in uncoagulated blood. Web site: http://appft1.uspto.gov/netahtml/PTO/search-bool.html •
Oligonucleotides for detecting bacteria and detection process Inventor(s): Fukushima, Shigeru; (Otsu-shi, JP), Nakayama, Tomoko; (Osaka, JP), Ohashi, Tetsuo; (Kyoto-shi, JP), Tada, Jun; (Muko-shi, JP) Correspondence: Birch Stewart Kolasch & Birch; PO Box 747; Falls Church; VA; 220400747; US Patent Application Number: 20030064388 Date filed: May 6, 2002 Abstract: A synthetic oligonucleotide which is complementary to a nucleotide sequence of a gene selected from the group consisting of the Shiga toxin gene of Shigella species, the ipaH gene of Shigella species and EIEC, the invE gene of Shigella species and EIEC, the araC gene of Salmonella species, the Verocytotoxin-1 gene of EHEC or VTEC, the Verocytotoxin-2 gene of EHEC or VTEC, the toxic shock syndrome toxin-1 gene of Staphylococcus aureus, the ctx gene of Vibrio cholerae, and the enterotoxin gene of Clostridium perfringens; a method for detecting a bacterial strain by amplifying a region of the above gene by PCR using the above oligonucleotides as primers and detecting the amplified region; and a kit for the detection of the bacterial strain. Excerpt(s): The present invention relates to detection of pathogenic bacteria in samples (e.g., clinical isolates and food specimens) for the purposes of diagnoses, screenings, quarantine inspections, and clinical tests. Specifically, it relates to detection of pathogens
Patents 93
associated with bacterial food poisoning and bacterial diarrhea. More specifically, it relates to detection of enteropathogenic bacteria including Shigella species, Salmonella species, enterohemorrhagic Escherichia coli or Verocytotoxin-producing Escherichia coli, Staphylococcus aureus, Vibrio cholerae, and Clostridlum perfringens. Detection of pathogenic bacteria such as Shigella species, Salmonella species, enterohemorrhagic Escherichia coli (hereinafter simply referred to as EHEC) or Verocytotoxin-producing Escherichia coli (hereinafter simply referred to as VTEC), Staphylococcus aureus, Vibrio cholerae, and Clostridium perfringens is an important task in the field of medicine and public hygiene, and various methods have been used. Conventionally, detection of a pathogenic bacterial strain involves isolation of several pathogenic bacterial colonies and identification of the species of the bacteria by serological or biochemical method. Web site: http://appft1.uspto.gov/netahtml/PTO/search-bool.html •
THERAPEUTICALLY ACTIVE COMPOUNDS BASED ON INDAZOLE BIOISOSTERE REPLACEMENT OF CATECHOL IN PDE4 INHIBITORS Inventor(s): MARFAT, ANTHONY; (MYSTIC, CT) Correspondence: Paul H Ginsburg; Pfizer Inc; 235 East 42nd Street; 20th Floor; New York; NY; 10017-5755; US Patent Application Number: 20020058687 Date filed: September 20, 1999 Abstract: Therapeutically active compositions of matter are described which are useful for treating or preventing diseases and conditions comprising inflammatory diseases including joint inflammation, Crohn's disease, and inflammatory bowel disease; respiratory diseases such as chronic obstructive pulmonary disease (COPD) including asthma, chronic bronchitis, and pulmonary emphysema; infectious diseases including endotoxic shock and toxic shock syndrome; immune diseases including systemic lupus erythematosis and psoriasis; and other diseases including bone resorption diseases and reperfusion injury; wherein said composition of matter comprises a compound which is an inhibitor of phosphodiesterase isozyme 4 (PDE4) and wherein an indazole is one essential component of said compound's overall chemical structure, and wherein said indazole constitutes a bioisosteric replacement of a catechol component or functional derivative thereof in a known compound having the same said therapeutic activity and the same remaining said components of its overall chemical structure. Included are compounds of Formula (IA) or (IB), wherein R.sup.2.sub.a and R.sup.2.sub.b are independently selected from the group consisting essentially of hydrogen and hereinafter recited substituents, provided that one, but not both of R.sup.2.sub.a and R.sup.2.sub.b must be independently selected as hydrogen, wherein said substituents comprise moieties including the following: (IC), (ID), (IE), (IF), (ILA), (ILB), (IIC), (IID), (IIE), (IIF), (IIG), (IIH), (III), (IIIA), (IIIB), (IIIC), (IIID), (IIIE), (IIIF), (IIIG), (IIIH), (IIII), (IIIJ), (IIIK), (IIIL), (IIIM), (IIIN), (IIIO), (IIIP), (IIIR), (IIIS), (IIIT), (IV), (VA), (VB), (VC), (VD), (VE.sub.a), (VE), (VF), (VG), (VH), (VI), (VJ), (VK), (VL), (VM). 1 Excerpt(s): The present invention is in the field of compositions of matter, and pharmaceutical compositions and methods of treatment utilizing one or more of said compositions of matter as the active ingredient and the active agent with respect thereto, wherein said composition of matter comprises an indazole as an essential feature of its overall chemical structure, said indazole constituting a bioisosteric replacement of a catechol or functional derivative thereof. The catechol-containing as well as the indazole-based compositions of matter have biological activity as selective inhibitors of
94
Toxic Shock Syndrome
phosphodiesterase (PDE) type IV and the production of tumor necrosis factor (TNF), and as such are useful in the treatment of asthma, chronic obstructive pulmonary disease (COPD), psoriasis, allergic rhinitis, dermatitis, Crohn's disease, arthritis, and other inflammatory diseases, AIDS, septic shock and other diseases involving the production of TNF. This invention also relates to a method of using such compounds in the treatment of the foregoing diseases in mammals, especially humans, and to pharmaceutical compositions containing such compounds. Since the recognition that cyclic adenosine phosphate (AMP) is an intracellular second messenger, E. W. Sutherland, and T. W. Rall, Pharmacol. Rev., 12, 265, (1960), inhibition of the phosphodiesterases has been a target for modulation and, accordingly, therapeutic intervention in a range of disease processes. More recently, distinct classes of PDE have been recognized, J. A. Beavo et al., TiPS, 11, 150, (1990), and their selective inhibition has led to improved drug therapy, C. D. Nicholson, M. S. Hahid, TiPS, 12, 19, (1991). More particularly, it has been recognized that inhibition of PDE type IV can lead to inhibition of inflammatory mediator release, M. W. Verghese et al., J. Mol. Cell Cardiol., 12 (Suppl. II), S 61, (1989) and airway smooth muscle relaxation (T. J. Torphy in "Directions for New Anti-Asthma Drugs," eds S. R. O'Donnell and C. G. A. Persson, 1988, 37 Birkhauser-Verlag). Thus, compounds that inhibit PDE type IV, but which have poor activity against other PDE types, would inhibit the release of inflammatory mediators and relax airway smooth muscle without causing cardiovascular effects or antiplatelet effects. Web site: http://appft1.uspto.gov/netahtml/PTO/search-bool.html
Keeping Current In order to stay informed about patents and patent applications dealing with toxic shock syndrome, you can access the U.S. Patent Office archive via the Internet at the following Web address: http://www.uspto.gov/patft/index.html. You will see two broad options: (1) Issued Patent, and (2) Published Applications. To see a list of issued patents, perform the following steps: Under “Issued Patents,” click “Quick Search.” Then, type “toxic shock syndrome” (or synonyms) into the “Term 1” box. After clicking on the search button, scroll down to see the various patents which have been granted to date on toxic shock syndrome. You can also use this procedure to view pending patent applications concerning toxic shock syndrome. Simply go back to http://www.uspto.gov/patft/index.html. Select “Quick Search” under “Published Applications.” Then proceed with the steps listed above.
95
CHAPTER 6. BOOKS ON TOXIC SHOCK SYNDROME Overview This chapter provides bibliographic book references relating to toxic shock syndrome. In addition to online booksellers such as www.amazon.com and www.bn.com, excellent sources for book titles on toxic shock syndrome include the Combined Health Information Database and the National Library of Medicine. Your local medical library also may have these titles available for loan.
Book Summaries: Federal Agencies The Combined Health Information Database collects various book abstracts from a variety of healthcare institutions and federal agencies. To access these summaries, go directly to the following hyperlink: http://chid.nih.gov/detail/detail.html. You will need to use the “Detailed Search” option. To find book summaries, use the drop boxes at the bottom of the search page where “You may refine your search by.” Select the dates and language you prefer. For the format option, select “Monograph/Book.” Now type “toxic shock syndrome” (or synonyms) into the “For these words:” box. You should check back periodically with this database which is updated every three months. The following is a typical result when searching for books on toxic shock syndrome: •
Oral and Cutaneous Manifestations of Hematogenously Disseminated Systemic Infections: A Monograph Source: Research Triangle Park, NC: Glaxo, Inc. 1993. 79 p. Contact: Available from Glaxo-Wellcome Education Resource Center. 5 Moore Drive, Research Triangle Park, NC 27709. (800) 824-2896. PRICE: Single copy free. Stock Number GVL251. Summary: This monograph describes oral and dermatologic manifestations resulting from systemic infections. Written as a continuing education tool for physicians, the monograph features 26 sections, each of which includes a description of dermatologic manifestations, other clinical features, laboratory findings, and epidemiologic factors. Diseases covered include AIDS, blastomycosis, candidiasis, coccidioidomycosis, cryptococcoses, erythema infectiousum (Fifth disease), gonococcemia, gram-negative
96
Toxic Shock Syndrome
bacterial sepsis, hand-foot-and-mouth disease, infectious mononucleosis, infective endocarditis, Kawasaki syndrome, leprosy, lyme disease, meningococcemia, Rocky Mountain spotted fever, roseola, rubella (German measles), rubeola (measles), scarlet fever, secondary (disseminated) syphilis, staphylococcal scalded skin syndrome, toxic shock syndrome, typhoid fever, varicella (chickenpox), and Vibrio vulnificus infection. Each section is illustrated with full-color photographs depicting patients with manifestations of the disease under consideration. The monograph includes a glossary of illustrations to help with diagnosis and classification. The monograph concludes with a self-test and instructions for receiving continuing medical education credits. A subject index is also included. 12 references.
Book Summaries: Online Booksellers Commercial Internet-based booksellers, such as Amazon.com and Barnes&Noble.com, offer summaries which have been supplied by each title’s publisher. Some summaries also include customer reviews. Your local bookseller may have access to in-house and commercial databases that index all published books (e.g. Books in Print). IMPORTANT NOTE: Online booksellers typically produce search results for medical and non-medical books. When searching for “toxic shock syndrome” at online booksellers’ Web sites, you may discover non-medical books that use the generic term “toxic shock syndrome” (or a synonym) in their titles. The following is indicative of the results you might find when searching for “toxic shock syndrome” (sorted alphabetically by title; follow the hyperlink to view more details at Amazon.com): •
The Official Patient's Sourcebook on Toxic Shock Syndrome by James N. Parker, Health Publica Icon Health Publications; ISBN: 0597829721; http://www.amazon.com/exec/obidos/ASIN/0597829721/icongroupinterna
•
Toxic Shock Syndrome by Brian Shmaefsky, I. Edward, Ph.d Alcamo (Editor); ISBN: 079107465X; http://www.amazon.com/exec/obidos/ASIN/079107465X/icongroupinterna
•
Toxic Shock Syndrome by Carolina V. Starr, Ellen A. Hales (Illustrator); ISBN: 1882633172; http://www.amazon.com/exec/obidos/ASIN/1882633172/icongroupinterna
•
Toxic Shock Syndrome by Merlin S. Bergdoll, P. Joan Chesney (Editor); ISBN: 0849366712; http://www.amazon.com/exec/obidos/ASIN/0849366712/icongroupinterna
•
Toxic Shock Syndrome and the Other Staphylococcal Toxicoses by Hans-Christian Mittag; ISBN: 3794511972; http://www.amazon.com/exec/obidos/ASIN/3794511972/icongroupinterna
•
Toxic shock syndrome is so rare you might forget it can happen (SuDoc HE 20.4002:T 66/4/990) by U.S. Dept of Health and Human Services; ISBN: B000109CUS; http://www.amazon.com/exec/obidos/ASIN/B000109CUS/icongroupinterna
•
Toxic Shock Syndrome: Assessment of Current Information and Future Research Needs: Report of a Study (Publication Iom, 82-02) by Instutitue of Medicine Division of Health Sciences Policy, et al; ISBN: 0309032865; http://www.amazon.com/exec/obidos/ASIN/0309032865/icongroupinterna
Books
•
97
Toxic Shock Syndrome: The Controversy #385 by Anne D'Arcy Jorgensen (1985); ISBN: 9996762939; http://www.amazon.com/exec/obidos/ASIN/9996762939/icongroupinterna
The National Library of Medicine Book Index The National Library of Medicine at the National Institutes of Health has a massive database of books published on healthcare and biomedicine. Go to the following Internet site, http://locatorplus.gov/, and then select “Search LOCATORplus.” Once you are in the search area, simply type “toxic shock syndrome” (or synonyms) into the search box, and select “books only.” From there, results can be sorted by publication date, author, or relevance. The following was recently catalogued by the National Library of Medicine:10 •
An annotated bibliography of toxic shock syndrome Author: Hirsch, Marcia Lipkind.; Year: 1985; Chiacgo, Ill.: University of Chicago, [1986], c1985
•
Contagious and non-contagious infectious diseases sourcebook: basic information about contagious diseases like measles, polio, hepatitis B, and infectious mononucleosis, and non-contagious infectious diseases like tetanus and toxic shock syndrome, and diseases occurring as secondary infections such as shingles and Reye syndrome along with vaccination, prevention, and treatment information and a section describing emerging infectious disease threats Author: Bellenir, Karen.; Year: 1980; Detroit, MI: Omnigraphics, c1996; ISBN: 0780800753 http://www.amazon.com/exec/obidos/ASIN/0780800753/icongroupinterna
•
European conference on toxic shock syndrome: proceedings of a symposium sponsored by Procter & Gamble Ltd. [et al.], held at the Royal Society of Medicine in London, 10-12 September 1997 Author: Arbuthnott, J. P.; Year: 1998; London: Royal Society of Medicine Press, c1998
•
The Toxic shock syndrome: a conference held 20-22 November 1981 Author: Institute of Medicine (U.S.); Year: 1983; Philadelphia, PA: American College of Physicians, c1982
•
Toxic shock syndrome: January 1979 through December 1982: 255 citations Author: Kenton, Charlotte.; Year: 1986; [Bethesda, Md.]: U.S. Dept. of Health and Human Services, Public Health Service, National Institutes of Health; [Washington, D.C.]: U.S. G.P.O., 1983
Chapters on Toxic Shock Syndrome In order to find chapters that specifically relate to toxic shock syndrome, an excellent source of abstracts is the Combined Health Information Database. You will need to limit your search to book chapters and toxic shock syndrome using the “Detailed Search” option. Go to the following hyperlink: http://chid.nih.gov/detail/detail.html. To find book chapters, use 10
In addition to LOCATORPlus, in collaboration with authors and publishers, the National Center for Biotechnology Information (NCBI) is currently adapting biomedical books for the Web. The books may be accessed in two ways: (1) by searching directly using any search term or phrase (in the same way as the bibliographic database PubMed), or (2) by following the links to PubMed abstracts. Each PubMed abstract has a "Books" button that displays a facsimile of the abstract in which some phrases are hypertext links. These phrases are also found in the books available at NCBI. Click on hyperlinked results in the list of books in which the phrase is found. Currently, the majority of the links are between the books and PubMed. In the future, more links will be created between the books and other types of information, such as gene and protein sequences and macromolecular structures. See http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Books.
98
Toxic Shock Syndrome
the drop boxes at the bottom of the search page where “You may refine your search by.” Select the dates and language you prefer, and the format option “Book Chapter.” Type “toxic shock syndrome” (or synonyms) into the “For these words:” box. The following is a typical result when searching for book chapters on toxic shock syndrome: •
Streptococcal Toxic Shock Syndrome Associated With Necrotizing Fasciitis Source: in Coggins, C.H.; Hancock, E.W.; Levitt, L.J., eds. Annual Review of Medicine, Volume 51, 2000. Palo Alto, CA: Annual Reviews, Inc. 2000. p. 271-288. Contact: Available from Annual Reviews. 4139 El Camino Way, P.O. Box 10139, Palo Alto, CA 94303-0139. (650) 493-4400. E-mail: [email protected]. Website: www.AnnualReviews.org. Summary: This chapter provides health professionals with information on the demographics, symptoms, signs, diagnosis, clinical course, and treatment of streptococcal toxic shock syndrome (strep TSS) with associated necrotizing fasciitis. Strep TSS is the early onset of shock and organ failure associated with any infection caused by Streptococcus pyogenes. It is a rapidly progressive process that kills 30 to 60 percent of patients in 72 to 96 hours. The initial symptoms of strep TSS depend largely on the site of primary infection. Of all patients with strep TSS, 20 percent experience an influenza like syndrome characterized by fever, chills, myalgia, and diarrhea. In patients who develop deep soft tissue infections, such as necrotizing fasciitis or intrauterine infection, severe pain is the most common initial symptom of strep TSS. Violaceous bullae, hypotension, fever, and evidence of organ failure are late clinical manifestations. Diagnosis is not difficult when all the clinical features of strep TSS are manifest; however, the signs and symptoms may be quite subtle early in the course of illness, and laboratory tests may provide valuable clues to the diagnosis. The challenge to clinicians is to make an early diagnosis and to intervene with aggressive fluid replacement, emergent surgical debridement, and general supportive measures. Superantigens such as pyrogenic exotoxin A interact with monocytes and T lymphocytes in unique ways, resulting in T cell proliferation and watershed production of monokines and lymphokines. Penicillin, though efficacious in mild S. pyogenes infection, is less effective in severe infections because of its short postantibiotic effect, inoculum effect, and reduced activity against stationary phase organisms. Emerging treatments for strep TSS include clindamycin and intravenous gamma globulin. 2 tables and 81 references. (AA-M).
99
CHAPTER 7. MULTIMEDIA ON TOXIC SHOCK SYNDROME Overview In this chapter, we show you how to keep current on multimedia sources of information on toxic shock syndrome. We start with sources that have been summarized by federal agencies, and then show you how to find bibliographic information catalogued by the National Library of Medicine.
Bibliography: Multimedia on Toxic Shock Syndrome The National Library of Medicine is a rich source of information on healthcare-related multimedia productions including slides, computer software, and databases. To access the multimedia database, go to the following Web site: http://locatorplus.gov/. Select “Search LOCATORplus.” Once in the search area, simply type in toxic shock syndrome (or synonyms). Then, in the option box provided below the search box, select “Audiovisuals and Computer Files.” From there, you can choose to sort results by publication date, author, or relevance. The following multimedia has been indexed on toxic shock syndrome: •
Toxic shock syndrome [videorecording] Source: presented by Department of Gynecology/Obstetrics, Emory University, School of Medicine; Year: 1980; Format: Videorecording; Atlanta: Emory Medical Television Network, 1980
101
CHAPTER 8. PERIODICALS AND NEWS ON TOXIC SHOCK SYNDROME Overview In this chapter, we suggest a number of news sources and present various periodicals that cover toxic shock syndrome.
News Services and Press Releases One of the simplest ways of tracking press releases on toxic shock syndrome is to search the news wires. In the following sample of sources, we will briefly describe how to access each service. These services only post recent news intended for public viewing. PR Newswire To access the PR Newswire archive, simply go to http://www.prnewswire.com/. Select your country. Type “toxic shock syndrome” (or synonyms) into the search box. You will automatically receive information on relevant news releases posted within the last 30 days. The search results are shown by order of relevance. Reuters Health The Reuters’ Medical News and Health eLine databases can be very useful in exploring news archives relating to toxic shock syndrome. While some of the listed articles are free to view, others are available for purchase for a nominal fee. To access this archive, go to http://www.reutershealth.com/en/index.html and search by “toxic shock syndrome” (or synonyms). The following was recently listed in this archive for toxic shock syndrome: •
Most US and Canadian women have protective toxic shock syndrome antibodies Source: Reuters Medical News Date: May 25, 2000
102 Toxic Shock Syndrome
The NIH Within MEDLINEplus, the NIH has made an agreement with the New York Times Syndicate, the AP News Service, and Reuters to deliver news that can be browsed by the public. Search news releases at http://www.nlm.nih.gov/medlineplus/alphanews_a.html. MEDLINEplus allows you to browse across an alphabetical index. Or you can search by date at the following Web page: http://www.nlm.nih.gov/medlineplus/newsbydate.html. Often, news items are indexed by MEDLINEplus within its search engine. Business Wire Business Wire is similar to PR Newswire. To access this archive, simply go to http://www.businesswire.com/. You can scan the news by industry category or company name. Market Wire Market Wire is more focused on technology than the other wires. To browse the latest press releases by topic, such as alternative medicine, biotechnology, fitness, healthcare, legal, nutrition, and pharmaceuticals, access Market Wire’s Medical/Health channel at http://www.marketwire.com/mw/release_index?channel=MedicalHealth. Or simply go to Market Wire’s home page at http://www.marketwire.com/mw/home, type “toxic shock syndrome” (or synonyms) into the search box, and click on “Search News.” As this service is technology oriented, you may wish to use it when searching for press releases covering diagnostic procedures or tests. Search Engines Medical news is also available in the news sections of commercial Internet search engines. See the health news page at Yahoo (http://dir.yahoo.com/Health/News_and_Media/), or you can use this Web site’s general news search page at http://news.yahoo.com/. Type in “toxic shock syndrome” (or synonyms). If you know the name of a company that is relevant to toxic shock syndrome, you can go to any stock trading Web site (such as http://www.etrade.com/) and search for the company name there. News items across various news sources are reported on indicated hyperlinks. Google offers a similar service at http://news.google.com/. BBC Covering news from a more European perspective, the British Broadcasting Corporation (BBC) allows the public free access to their news archive located at http://www.bbc.co.uk/. Search by “toxic shock syndrome” (or synonyms).
Periodicals and News
103
Academic Periodicals covering Toxic Shock Syndrome Numerous periodicals are currently indexed within the National Library of Medicine’s PubMed database that are known to publish articles relating to toxic shock syndrome. In addition to these sources, you can search for articles covering toxic shock syndrome that have been published by any of the periodicals listed in previous chapters. To find the latest studies published, go to http://www.ncbi.nlm.nih.gov/pubmed, type the name of the periodical into the search box, and click “Go.” If you want complete details about the historical contents of a journal, you can also visit the following Web site: http://www.ncbi.nlm.nih.gov/entrez/jrbrowser.cgi. Here, type in the name of the journal or its abbreviation, and you will receive an index of published articles. At http://locatorplus.gov/, you can retrieve more indexing information on medical periodicals (e.g. the name of the publisher). Select the button “Search LOCATORplus.” Then type in the name of the journal and select the advanced search option “Journal Title Search.”
105
CHAPTER 9. RESEARCHING MEDICATIONS Overview While a number of hard copy or CD-ROM resources are available for researching medications, a more flexible method is to use Internet-based databases. Broadly speaking, there are two sources of information on approved medications: public sources and private sources. We will emphasize free-to-use public sources.
U.S. Pharmacopeia Because of historical investments by various organizations and the emergence of the Internet, it has become rather simple to learn about the medications recommended for toxic shock syndrome. One such source is the United States Pharmacopeia. In 1820, eleven physicians met in Washington, D.C. to establish the first compendium of standard drugs for the United States. They called this compendium the U.S. Pharmacopeia (USP). Today, the USP is a non-profit organization consisting of 800 volunteer scientists, eleven elected officials, and 400 representatives of state associations and colleges of medicine and pharmacy. The USP is located in Rockville, Maryland, and its home page is located at http://www.usp.org/. The USP currently provides standards for over 3,700 medications. The resulting USP DI Advice for the Patient can be accessed through the National Library of Medicine of the National Institutes of Health. The database is partially derived from lists of federally approved medications in the Food and Drug Administration’s (FDA) Drug Approvals database, located at http://www.fda.gov/cder/da/da.htm. While the FDA database is rather large and difficult to navigate, the Phamacopeia is both user-friendly and free to use. It covers more than 9,000 prescription and over-the-counter medications. To access this database, simply type the following hyperlink into your Web browser: http://www.nlm.nih.gov/medlineplus/druginformation.html. To view examples of a given medication (brand names, category, description, preparation, proper use, precautions, side effects, etc.), simply follow the hyperlinks indicated within the United States Pharmacopeia (USP). Below, we have compiled a list of medications associated with toxic shock syndrome. If you would like more information on a particular medication, the provided hyperlinks will direct you to ample documentation (e.g. typical dosage, side effects, drug-interaction risks, etc.).
106 Toxic Shock Syndrome
The following drugs have been mentioned in the Pharmacopeia and other sources as being potentially applicable to toxic shock syndrome: Calcitonin •
Nasal-Systemic - U.S. Brands: Miacalcin http://www.nlm.nih.gov/medlineplus/druginfo/uspdi/203482.html
•
Systemic - U.S. Brands: Calcimar; Cibacalcin; Miacalcin http://www.nlm.nih.gov/medlineplus/druginfo/uspdi/202106.html
Headache Medicines, Ergot Derivative-Containing •
Systemic - U.S. Brands: Cafergot; Cafertine; Cafetrate; D.H.E. 45; Ercaf; ErgoCaff; Ergomar; Ergostat; Gotamine; Migergot; Wigraine http://www.nlm.nih.gov/medlineplus/druginfo/uspdi/202216.html
Spermicides •
Vaginal - U.S. Brands: Advantage 24; Because; Conceptrol Contraceptive Inserts; Conceptrol Gel; Delfen; Emko; Emko Pre-Fil; Encare; Gynol II Extra Strength Contraceptive Jelly; Gynol II Original Formula Contraceptive Jelly; Koromex Cream; Koromex Crystal Clear Gel; Koromex Fo http://www.nlm.nih.gov/medlineplus/druginfo/uspdi/202531.html
Commercial Databases In addition to the medications listed in the USP above, a number of commercial sites are available by subscription to physicians and their institutions. Or, you may be able to access these sources from your local medical library.
Mosby’s Drug Consult Mosby’s Drug Consult database (also available on CD-ROM and book format) covers 45,000 drug products including generics and international brands. It provides prescribing information, drug interactions, and patient information. Subscription information is available at the following hyperlink: http://www.mosbysdrugconsult.com/. PDRhealth The PDRhealth database is a free-to-use, drug information search engine that has been written for the public in layman’s terms. It contains FDA-approved drug information adapted from the Physicians’ Desk Reference (PDR) database. PDRhealth can be searched by brand name, generic name, or indication. It features multiple drug interactions reports. Search PDRhealth at http://www.pdrhealth.com/drug_info/index.html. Other Web Sites Drugs.com (www.drugs.com) reproduces the information in the Pharmacopeia as well as commercial information. You may also want to consider the Web site of the Medical Letter,
Researching Medications
107
Inc. (http://www.medletter.com/) which allows users to download articles on various drugs and therapeutics for a nominal fee. If you have any questions about a medical treatment, the FDA may have an office near you. Look for their number in the blue pages of the phone book. You can also contact the FDA through its toll-free number, 1-888-INFO-FDA (1-888-463-6332), or on the World Wide Web at www.fda.gov.
109
APPENDICES
111
APPENDIX A. PHYSICIAN RESOURCES Overview In this chapter, we focus on databases and Internet-based guidelines and information resources created or written for a professional audience.
NIH Guidelines Commonly referred to as “clinical” or “professional” guidelines, the National Institutes of Health publish physician guidelines for the most common diseases. Publications are available at the following by relevant Institute11: •
Office of the Director (OD); guidelines consolidated across agencies available at http://www.nih.gov/health/consumer/conkey.htm
•
National Institute of General Medical Sciences (NIGMS); fact sheets available at http://www.nigms.nih.gov/news/facts/
•
National Library of Medicine (NLM); extensive encyclopedia (A.D.A.M., Inc.) with guidelines: http://www.nlm.nih.gov/medlineplus/healthtopics.html
•
National Cancer Institute (NCI); guidelines available at http://www.cancer.gov/cancerinfo/list.aspx?viewid=5f35036e-5497-4d86-8c2c714a9f7c8d25
•
National Eye Institute (NEI); guidelines available at http://www.nei.nih.gov/order/index.htm
•
National Heart, Lung, and Blood Institute (NHLBI); guidelines available at http://www.nhlbi.nih.gov/guidelines/index.htm
•
National Human Genome Research Institute (NHGRI); research available at http://www.genome.gov/page.cfm?pageID=10000375
•
National Institute on Aging (NIA); guidelines available at http://www.nia.nih.gov/health/
11
These publications are typically written by one or more of the various NIH Institutes.
112 Toxic Shock Syndrome
•
National Institute on Alcohol Abuse and Alcoholism (NIAAA); guidelines available at http://www.niaaa.nih.gov/publications/publications.htm
•
National Institute of Allergy and Infectious Diseases (NIAID); guidelines available at http://www.niaid.nih.gov/publications/
•
National Institute of Arthritis and Musculoskeletal and Skin Diseases (NIAMS); fact sheets and guidelines available at http://www.niams.nih.gov/hi/index.htm
•
National Institute of Child Health and Human Development (NICHD); guidelines available at http://www.nichd.nih.gov/publications/pubskey.cfm
•
National Institute on Deafness and Other Communication Disorders (NIDCD); fact sheets and guidelines at http://www.nidcd.nih.gov/health/
•
National Institute of Dental and Craniofacial Research (NIDCR); guidelines available at http://www.nidr.nih.gov/health/
•
National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK); guidelines available at http://www.niddk.nih.gov/health/health.htm
•
National Institute on Drug Abuse (NIDA); guidelines available at http://www.nida.nih.gov/DrugAbuse.html
•
National Institute of Environmental Health Sciences (NIEHS); environmental health information available at http://www.niehs.nih.gov/external/facts.htm
•
National Institute of Mental Health (NIMH); guidelines available at http://www.nimh.nih.gov/practitioners/index.cfm
•
National Institute of Neurological Disorders and Stroke (NINDS); neurological disorder information pages available at http://www.ninds.nih.gov/health_and_medical/disorder_index.htm
•
National Institute of Nursing Research (NINR); publications on selected illnesses at http://www.nih.gov/ninr/news-info/publications.html
•
National Institute of Biomedical Imaging and Bioengineering; general information at http://grants.nih.gov/grants/becon/becon_info.htm
•
Center for Information Technology (CIT); referrals to other agencies based on keyword searches available at http://kb.nih.gov/www_query_main.asp
•
National Center for Complementary and Alternative Medicine (NCCAM); health information available at http://nccam.nih.gov/health/
•
National Center for Research Resources (NCRR); various information directories available at http://www.ncrr.nih.gov/publications.asp
•
Office of Rare Diseases; various fact sheets available at http://rarediseases.info.nih.gov/html/resources/rep_pubs.html
•
Centers for Disease Control and Prevention; various fact sheets on infectious diseases available at http://www.cdc.gov/publications.htm
Physician Resources
113
NIH Databases In addition to the various Institutes of Health that publish professional guidelines, the NIH has designed a number of databases for professionals.12 Physician-oriented resources provide a wide variety of information related to the biomedical and health sciences, both past and present. The format of these resources varies. Searchable databases, bibliographic citations, full-text articles (when available), archival collections, and images are all available. The following are referenced by the National Library of Medicine:13 •
Bioethics: Access to published literature on the ethical, legal, and public policy issues surrounding healthcare and biomedical research. This information is provided in conjunction with the Kennedy Institute of Ethics located at Georgetown University, Washington, D.C.: http://www.nlm.nih.gov/databases/databases_bioethics.html
•
HIV/AIDS Resources: Describes various links and databases dedicated to HIV/AIDS research: http://www.nlm.nih.gov/pubs/factsheets/aidsinfs.html
•
NLM Online Exhibitions: Describes “Exhibitions in the History of Medicine”: http://www.nlm.nih.gov/exhibition/exhibition.html. Additional resources for historical scholarship in medicine: http://www.nlm.nih.gov/hmd/hmd.html
•
Biotechnology Information: Access to public databases. The National Center for Biotechnology Information conducts research in computational biology, develops software tools for analyzing genome data, and disseminates biomedical information for the better understanding of molecular processes affecting human health and disease: http://www.ncbi.nlm.nih.gov/
•
Population Information: The National Library of Medicine provides access to worldwide coverage of population, family planning, and related health issues, including family planning technology and programs, fertility, and population law and policy: http://www.nlm.nih.gov/databases/databases_population.html
•
Cancer Information: Access to cancer-oriented databases: http://www.nlm.nih.gov/databases/databases_cancer.html
•
Profiles in Science: Offering the archival collections of prominent twentieth-century biomedical scientists to the public through modern digital technology: http://www.profiles.nlm.nih.gov/
•
Chemical Information: Provides links to various chemical databases and references: http://sis.nlm.nih.gov/Chem/ChemMain.html
•
Clinical Alerts: Reports the release of findings from the NIH-funded clinical trials where such release could significantly affect morbidity and mortality: http://www.nlm.nih.gov/databases/alerts/clinical_alerts.html
•
Space Life Sciences: Provides links and information to space-based research (including NASA): http://www.nlm.nih.gov/databases/databases_space.html
•
MEDLINE: Bibliographic database covering the fields of medicine, nursing, dentistry, veterinary medicine, the healthcare system, and the pre-clinical sciences: http://www.nlm.nih.gov/databases/databases_medline.html
12 Remember, for the general public, the National Library of Medicine recommends the databases referenced in MEDLINEplus (http://medlineplus.gov/ or http://www.nlm.nih.gov/medlineplus/databases.html). 13 See http://www.nlm.nih.gov/databases/databases.html.
114 Toxic Shock Syndrome
•
Toxicology and Environmental Health Information (TOXNET): Databases covering toxicology and environmental health: http://sis.nlm.nih.gov/Tox/ToxMain.html
•
Visible Human Interface: Anatomically detailed, three-dimensional representations of normal male and female human bodies: http://www.nlm.nih.gov/research/visible/visible_human.html
The NLM Gateway14 The NLM (National Library of Medicine) Gateway is a Web-based system that lets users search simultaneously in multiple retrieval systems at the U.S. National Library of Medicine (NLM). It allows users of NLM services to initiate searches from one Web interface, providing one-stop searching for many of NLM’s information resources or databases.15 To use the NLM Gateway, simply go to the search site at http://gateway.nlm.nih.gov/gw/Cmd. Type “toxic shock syndrome” (or synonyms) into the search box and click “Search.” The results will be presented in a tabular form, indicating the number of references in each database category. Results Summary Category Journal Articles Books / Periodicals / Audio Visual Consumer Health Meeting Abstracts Other Collections Total
Items Found 12735 121 863 53 0 13772
HSTAT16 HSTAT is a free, Web-based resource that provides access to full-text documents used in healthcare decision-making.17 These documents include clinical practice guidelines, quickreference guides for clinicians, consumer health brochures, evidence reports and technology assessments from the Agency for Healthcare Research and Quality (AHRQ), as well as AHRQ’s Put Prevention Into Practice.18 Simply search by “toxic shock syndrome” (or synonyms) at the following Web site: http://text.nlm.nih.gov.
14
Adapted from NLM: http://gateway.nlm.nih.gov/gw/Cmd?Overview.x.
15
The NLM Gateway is currently being developed by the Lister Hill National Center for Biomedical Communications (LHNCBC) at the National Library of Medicine (NLM) of the National Institutes of Health (NIH). 16 Adapted from HSTAT: http://www.nlm.nih.gov/pubs/factsheets/hstat.html. 17 18
The HSTAT URL is http://hstat.nlm.nih.gov/.
Other important documents in HSTAT include: the National Institutes of Health (NIH) Consensus Conference Reports and Technology Assessment Reports; the HIV/AIDS Treatment Information Service (ATIS) resource documents; the Substance Abuse and Mental Health Services Administration's Center for Substance Abuse Treatment (SAMHSA/CSAT) Treatment Improvement Protocols (TIP) and Center for Substance Abuse Prevention (SAMHSA/CSAP) Prevention Enhancement Protocols System (PEPS); the Public Health Service (PHS) Preventive Services Task Force's Guide to Clinical Preventive Services; the independent, nonfederal Task Force on Community Services’ Guide to Community Preventive Services; and the Health Technology Advisory Committee (HTAC) of the Minnesota Health Care Commission (MHCC) health technology evaluations.
Physician Resources
115
Coffee Break: Tutorials for Biologists19 Coffee Break is a general healthcare site that takes a scientific view of the news and covers recent breakthroughs in biology that may one day assist physicians in developing treatments. Here you will find a collection of short reports on recent biological discoveries. Each report incorporates interactive tutorials that demonstrate how bioinformatics tools are used as a part of the research process. Currently, all Coffee Breaks are written by NCBI staff.20 Each report is about 400 words and is usually based on a discovery reported in one or more articles from recently published, peer-reviewed literature.21 This site has new articles every few weeks, so it can be considered an online magazine of sorts. It is intended for general background information. You can access the Coffee Break Web site at the following hyperlink: http://www.ncbi.nlm.nih.gov/Coffeebreak/.
Other Commercial Databases In addition to resources maintained by official agencies, other databases exist that are commercial ventures addressing medical professionals. Here are some examples that may interest you: •
CliniWeb International: Index and table of contents to selected clinical information on the Internet; see http://www.ohsu.edu/cliniweb/.
•
Medical World Search: Searches full text from thousands of selected medical sites on the Internet; see http://www.mwsearch.com/.
19 Adapted 20
from http://www.ncbi.nlm.nih.gov/Coffeebreak/Archive/FAQ.html.
The figure that accompanies each article is frequently supplied by an expert external to NCBI, in which case the source of the figure is cited. The result is an interactive tutorial that tells a biological story. 21 After a brief introduction that sets the work described into a broader context, the report focuses on how a molecular understanding can provide explanations of observed biology and lead to therapies for diseases. Each vignette is accompanied by a figure and hypertext links that lead to a series of pages that interactively show how NCBI tools and resources are used in the research process.
117
APPENDIX B. PATIENT RESOURCES Overview Official agencies, as well as federally funded institutions supported by national grants, frequently publish a variety of guidelines written with the patient in mind. These are typically called “Fact Sheets” or “Guidelines.” They can take the form of a brochure, information kit, pamphlet, or flyer. Often they are only a few pages in length. Since new guidelines on toxic shock syndrome can appear at any moment and be published by a number of sources, the best approach to finding guidelines is to systematically scan the Internet-based services that post them.
Patient Guideline Sources The remainder of this chapter directs you to sources which either publish or can help you find additional guidelines on topics related to toxic shock syndrome. Due to space limitations, these sources are listed in a concise manner. Do not hesitate to consult the following sources by either using the Internet hyperlink provided, or, in cases where the contact information is provided, contacting the publisher or author directly. The National Institutes of Health The NIH gateway to patients is located at http://health.nih.gov/. From this site, you can search across various sources and institutes, a number of which are summarized below. Topic Pages: MEDLINEplus The National Library of Medicine has created a vast and patient-oriented healthcare information portal called MEDLINEplus. Within this Internet-based system are “health topic pages” which list links to available materials relevant to toxic shock syndrome. To access this system, log on to http://www.nlm.nih.gov/medlineplus/healthtopics.html. From there you can either search using the alphabetical index or browse by broad topic areas. Recently, MEDLINEplus listed the following when searched for “toxic shock syndrome”:
118 Toxic Shock Syndrome
•
Other guides Menstruation and Premenstrual Syndrome http://www.nlm.nih.gov/medlineplus/menstruationandpremenstrualsyndrome.ht l Ovarian Cysts http://www.nlm.nih.gov/medlineplus/ovariancysts.html Staphylococcal Infections http://www.nlm.nih.gov/medlineplus/staphylococcalinfections.html Streptococcal Infections http://www.nlm.nih.gov/medlineplus/streptococcalinfections.html
Within the health topic page dedicated to toxic shock syndrome, the following was listed: •
General/Overviews Menstruation Source: American College of Obstetricians and Gynecologists http://www.medem.com/medlb/article_detaillb.cfm?article_ID=ZZZJVXZ887C&s ub_cat=328 Menstruation and the Menstrual Cycle Source: National Women's Health Information Center http://www.4woman.org/faq/menstru.htm Premenstrual Syndrome Source: Mayo Foundation for Medical Education and Research http://www.mayoclinic.com/invoke.cfm?id=DS00134
•
Diagnosis/Symptoms Estrogen Tests Source: American Association for Clinical Chemistry http://www.labtestsonline.org/understanding/analytes/estrogen/test.html FSH (Follicle-Stimulating Hormone) Test Source: American Association for Clinical Chemistry http://www.labtestsonline.org/understanding/analytes/fsh/test.html Menstrual Cycle Problems: Self-Care Flowcharts Source: American Academy of Family Physicians http://familydoctor.org/538.xml
•
Treatment Dilation and Curettage http://www.nlm.nih.gov/medlineplus/tutorials/dilationandcurettageloader.html PMS: What You Can Do to Ease Your Symptoms Source: American Academy of Family Physicians http://familydoctor.org/141.xml
Patient Resources
•
119
Specific Conditions/Aspects Amenorrhea: When Menstruation Goes Away Source: Mayo Foundation for Medical Education and Research http://www.mayoclinic.com/invoke.cfm?id=HQ00224 Dysmenorrhea Source: University of Utah, Health Sciences Center http://www.med.utah.edu/healthinfo/adult/gynonc/dysmen.htm Fast Facts about Premature Ovarian Failure Source: National Institute of Child Health and Human Development http://www.nichd.nih.gov/publications/pubs/pof/sub1.htm Hormonal Causes of Ovulatory Disorders Source: Resolve http://www.resolve.org/main/national/treatment/diagnosis/thyroid.jsp?name=t reatment&tag=diagnosis Is PMDD Real? Source: American Psychological Association http://www.apa.org/monitor/oct02/pmdd.html Menorrhagia Source: Mayo Foundation for Medical Education and Research http://www.mayoclinic.com/invoke.cfm?id=DS00394 Menorrhagia Source: University of Utah, Health Sciences Center http://www.med.utah.edu/healthinfo/adult/women/menor.htm Menstrual Hygiene Products Source: American College of Obstetricians and Gynecologists http://www.medem.com/MedLB/article_detaillb.cfm?article_ID=ZZZV9LN187C &sub_cat=328 Mittelschmerz Source: Mayo Foundation for Medical Education and Research http://www.mayoclinic.com/invoke.cfm?id=DS00507 Premenstrual Dysphoric Disorder (PMDD) Source: American Psychiatric Association http://www.medem.com/MedLB/article_detaillb.cfm?article_ID=ZZZF9KNGTRC &sub_cat=304 Premenstrual Dysphoric Disorder: A Guide for Patients and Families http://www.psychguides.com/DinW%2520PMDD.pdf Tampon Safety: TSS Now Rare, but Women Still Should Take Care Source: Food and Drug Administration http://www.fda.gov/fdac/features/2000/200_tss.html Vaginal Bleeding: An Interview with a Mayo Clinic Specialist Source: Mayo Foundation for Medical Education and Research http://www.mayoclinic.com/invoke.cfm?id=HO00159
120 Toxic Shock Syndrome
•
Children All about Menstruation Source: Nemours Foundation http://kidshealth.org/kid/grow/body_stuff/menstruation.html Menstruation: A Parents' Guide for Preparing Daughters Source: Mayo Foundation for Medical Education and Research http://www.mayoclinic.com/invoke.cfm?id=FL00040
•
Organizations American College of Obstetricians and Gynecologists http://www.acog.org/ National Institute of Child Health and Human Development http://www.nichd.nih.gov/ National Women's Health Information Center Source: Dept. of Health and Human Services http://www.4woman.gov/
•
Pictures/Diagrams Atlas of the Body: Female Reproductive Organs Source: American Medical Association http://www.medem.com/MedLb/article_detaillb.cfm?article_ID=ZZZ8QKJ56JC&s ub_cat=2
•
Research Irregular Periods in Young Women Could Be Warning Sign for Later Osteoporosis Source: National Institute of Child Health and Human Development http://www.nih.gov/news/pr/may2002/nichd-29.htm
•
Teenagers All about Menstruation Source: Nemours Foundation http://kidshealth.org/teen/sexual_health/girls/menstruation.html Coping with Common Period Problems Source: Nemours Foundation http://kidshealth.org/teen/sexual_health/girls/menstrual_problems.html
You may also choose to use the search utility provided by MEDLINEplus at the following Web address: http://www.nlm.nih.gov/medlineplus/. Simply type a keyword into the search box and click “Search.” This utility is similar to the NIH search utility, with the exception that it only includes materials that are linked within the MEDLINEplus system (mostly patient-oriented information). It also has the disadvantage of generating unstructured results. We recommend, therefore, that you use this method only if you have a very targeted search.
Patient Resources
121
Healthfinder™ Healthfinder™ is sponsored by the U.S. Department of Health and Human Services and offers links to hundreds of other sites that contain healthcare information. This Web site is located at http://www.healthfinder.gov. Again, keyword searches can be used to find guidelines. The following was recently found in this database: •
On The Teen Scene: TSS-Reducing The Risk Summary: The risk of toxic shock syndrome, a potentially fatal disease, can be reduced significantly through proper tampon use. Guidelines for lowering risk and choosing the appropriate tampon are provided. Source: U.S. Food and Drug Administration http://www.healthfinder.gov/scripts/recordpass.asp?RecordType=0&RecordID=575
•
Tampons and Toxic Shock Syndrome Summary: Links to information from the US Food and Drug Administration (FDA) and other government agency web sites that provide information about the regulation of tampons, their relation to toxic shock Source: U.S. Food and Drug Administration http://www.healthfinder.gov/scripts/recordpass.asp?RecordType=0&RecordID=4565 The NIH Search Utility
The NIH search utility allows you to search for documents on over 100 selected Web sites that comprise the NIH-WEB-SPACE. Each of these servers is “crawled” and indexed on an ongoing basis. Your search will produce a list of various documents, all of which will relate in some way to toxic shock syndrome. The drawbacks of this approach are that the information is not organized by theme and that the references are often a mix of information for professionals and patients. Nevertheless, a large number of the listed Web sites provide useful background information. We can only recommend this route, therefore, for relatively rare or specific disorders, or when using highly targeted searches. To use the NIH search utility, visit the following Web page: http://search.nih.gov/index.html. Additional Web Sources A number of Web sites are available to the public that often link to government sites. These can also point you in the direction of essential information. The following is a representative sample: •
AOL: http://search.aol.com/cat.adp?id=168&layer=&from=subcats
•
Family Village: http://www.familyvillage.wisc.edu/specific.htm
•
Google: http://directory.google.com/Top/Health/Conditions_and_Diseases/
•
Med Help International: http://www.medhelp.org/HealthTopics/A.html
•
Open Directory Project: http://dmoz.org/Health/Conditions_and_Diseases/
•
Yahoo.com: http://dir.yahoo.com/Health/Diseases_and_Conditions/
122 Toxic Shock Syndrome
•
WebMDHealth: http://my.webmd.com/health_topics
Finding Associations There are several Internet directories that provide lists of medical associations with information on or resources relating to toxic shock syndrome. By consulting all of associations listed in this chapter, you will have nearly exhausted all sources for patient associations concerned with toxic shock syndrome. The National Health Information Center (NHIC) The National Health Information Center (NHIC) offers a free referral service to help people find organizations that provide information about toxic shock syndrome. For more information, see the NHIC’s Web site at http://www.health.gov/NHIC/ or contact an information specialist by calling 1-800-336-4797. Directory of Health Organizations The Directory of Health Organizations, provided by the National Library of Medicine Specialized Information Services, is a comprehensive source of information on associations. The Directory of Health Organizations database can be accessed via the Internet at http://www.sis.nlm.nih.gov/Dir/DirMain.html. It is composed of two parts: DIRLINE and Health Hotlines. The DIRLINE database comprises some 10,000 records of organizations, research centers, and government institutes and associations that primarily focus on health and biomedicine. To access DIRLINE directly, go to the following Web site: http://dirline.nlm.nih.gov/. Simply type in “toxic shock syndrome” (or a synonym), and you will receive information on all relevant organizations listed in the database. Health Hotlines directs you to toll-free numbers to over 300 organizations. You can access this database directly at http://www.sis.nlm.nih.gov/hotlines/. On this page, you are given the option to search by keyword or by browsing the subject list. When you have received your search results, click on the name of the organization for its description and contact information. The Combined Health Information Database Another comprehensive source of information on healthcare associations is the Combined Health Information Database. Using the “Detailed Search” option, you will need to limit your search to “Organizations” and “toxic shock syndrome”. Type the following hyperlink into your Web browser: http://chid.nih.gov/detail/detail.html. To find associations, use the drop boxes at the bottom of the search page where “You may refine your search by.” For publication date, select “All Years.” Then, select your preferred language and the format option “Organization Resource Sheet.” Type “toxic shock syndrome” (or synonyms) into the “For these words:” box. You should check back periodically with this database since it is updated every three months.
Patient Resources
123
The National Organization for Rare Disorders, Inc. The National Organization for Rare Disorders, Inc. has prepared a Web site that provides, at no charge, lists of associations organized by health topic. You can access this database at the following Web site: http://www.rarediseases.org/search/orgsearch.html. Type “toxic shock syndrome” (or a synonym) into the search box, and click “Submit Query.”
125
APPENDIX C. FINDING MEDICAL LIBRARIES Overview In this Appendix, we show you how to quickly find a medical library in your area.
Preparation Your local public library and medical libraries have interlibrary loan programs with the National Library of Medicine (NLM), one of the largest medical collections in the world. According to the NLM, most of the literature in the general and historical collections of the National Library of Medicine is available on interlibrary loan to any library. If you would like to access NLM medical literature, then visit a library in your area that can request the publications for you.22
Finding a Local Medical Library The quickest method to locate medical libraries is to use the Internet-based directory published by the National Network of Libraries of Medicine (NN/LM). This network includes 4626 members and affiliates that provide many services to librarians, health professionals, and the public. To find a library in your area, simply visit http://nnlm.gov/members/adv.html or call 1-800-338-7657.
Medical Libraries in the U.S. and Canada In addition to the NN/LM, the National Library of Medicine (NLM) lists a number of libraries with reference facilities that are open to the public. The following is the NLM’s list and includes hyperlinks to each library’s Web site. These Web pages can provide information on hours of operation and other restrictions. The list below is a small sample of
22
Adapted from the NLM: http://www.nlm.nih.gov/psd/cas/interlibrary.html.
126 Toxic Shock Syndrome
libraries recommended by the National Library of Medicine (sorted alphabetically by name of the U.S. state or Canadian province where the library is located)23: •
Alabama: Health InfoNet of Jefferson County (Jefferson County Library Cooperative, Lister Hill Library of the Health Sciences), http://www.uab.edu/infonet/
•
Alabama: Richard M. Scrushy Library (American Sports Medicine Institute)
•
Arizona: Samaritan Regional Medical Center: The Learning Center (Samaritan Health System, Phoenix, Arizona), http://www.samaritan.edu/library/bannerlibs.htm
•
California: Kris Kelly Health Information Center (St. Joseph Health System, Humboldt), http://www.humboldt1.com/~kkhic/index.html
•
California: Community Health Library of Los Gatos, http://www.healthlib.org/orgresources.html
•
California: Consumer Health Program and Services (CHIPS) (County of Los Angeles Public Library, Los Angeles County Harbor-UCLA Medical Center Library) - Carson, CA, http://www.colapublib.org/services/chips.html
•
California: Gateway Health Library (Sutter Gould Medical Foundation)
•
California: Health Library (Stanford University Medical Center), http://wwwmed.stanford.edu/healthlibrary/
•
California: Patient Education Resource Center - Health Information and Resources (University of California, San Francisco), http://sfghdean.ucsf.edu/barnett/PERC/default.asp
•
California: Redwood Health Library (Petaluma Health Care District), http://www.phcd.org/rdwdlib.html
•
California: Los Gatos PlaneTree Health Library, http://planetreesanjose.org/
•
California: Sutter Resource Library (Sutter Hospitals Foundation, Sacramento), http://suttermedicalcenter.org/library/
•
California: Health Sciences Libraries (University of California, Davis), http://www.lib.ucdavis.edu/healthsci/
•
California: ValleyCare Health Library & Ryan Comer Cancer Resource Center (ValleyCare Health System, Pleasanton), http://gaelnet.stmarysca.edu/other.libs/gbal/east/vchl.html
•
California: Washington Community Health Resource Library (Fremont), http://www.healthlibrary.org/
•
Colorado: William V. Gervasini Memorial Library (Exempla Healthcare), http://www.saintjosephdenver.org/yourhealth/libraries/
•
Connecticut: Hartford Hospital Health Science Libraries (Hartford Hospital), http://www.harthosp.org/library/
•
Connecticut: Healthnet: Connecticut Consumer Health Information Center (University of Connecticut Health Center, Lyman Maynard Stowe Library), http://library.uchc.edu/departm/hnet/
23
Abstracted from http://www.nlm.nih.gov/medlineplus/libraries.html.
Finding Medical Libraries
127
•
Connecticut: Waterbury Hospital Health Center Library (Waterbury Hospital, Waterbury), http://www.waterburyhospital.com/library/consumer.shtml
•
Delaware: Consumer Health Library (Christiana Care Health System, Eugene du Pont Preventive Medicine & Rehabilitation Institute, Wilmington), http://www.christianacare.org/health_guide/health_guide_pmri_health_info.cfm
•
Delaware: Lewis B. Flinn Library (Delaware Academy of Medicine, Wilmington), http://www.delamed.org/chls.html
•
Georgia: Family Resource Library (Medical College of Georgia, Augusta), http://cmc.mcg.edu/kids_families/fam_resources/fam_res_lib/frl.htm
•
Georgia: Health Resource Center (Medical Center of Central Georgia, Macon), http://www.mccg.org/hrc/hrchome.asp
•
Hawaii: Hawaii Medical Library: Consumer Health Information Service (Hawaii Medical Library, Honolulu), http://hml.org/CHIS/
•
Idaho: DeArmond Consumer Health Library (Kootenai Medical Center, Coeur d’Alene), http://www.nicon.org/DeArmond/index.htm
•
Illinois: Health Learning Center of Northwestern Memorial Hospital (Chicago), http://www.nmh.org/health_info/hlc.html
•
Illinois: Medical Library (OSF Saint Francis Medical Center, Peoria), http://www.osfsaintfrancis.org/general/library/
•
Kentucky: Medical Library - Services for Patients, Families, Students & the Public (Central Baptist Hospital, Lexington), http://www.centralbap.com/education/community/library.cfm
•
Kentucky: University of Kentucky - Health Information Library (Chandler Medical Center, Lexington), http://www.mc.uky.edu/PatientEd/
•
Louisiana: Alton Ochsner Medical Foundation Library (Alton Ochsner Medical Foundation, New Orleans), http://www.ochsner.org/library/
•
Louisiana: Louisiana State University Health Sciences Center Medical LibraryShreveport, http://lib-sh.lsuhsc.edu/
•
Maine: Franklin Memorial Hospital Medical Library (Franklin Memorial Hospital, Farmington), http://www.fchn.org/fmh/lib.htm
•
Maine: Gerrish-True Health Sciences Library (Central Maine Medical Center, Lewiston), http://www.cmmc.org/library/library.html
•
Maine: Hadley Parrot Health Science Library (Eastern Maine Healthcare, Bangor), http://www.emh.org/hll/hpl/guide.htm
•
Maine: Maine Medical Center Library (Maine Medical Center, Portland), http://www.mmc.org/library/
•
Maine: Parkview Hospital (Brunswick), http://www.parkviewhospital.org/
•
Maine: Southern Maine Medical Center Health Sciences Library (Southern Maine Medical Center, Biddeford), http://www.smmc.org/services/service.php3?choice=10
•
Maine: Stephens Memorial Hospital’s Health Information Library (Western Maine Health, Norway), http://www.wmhcc.org/Library/
128 Toxic Shock Syndrome
•
Manitoba, Canada: Consumer & Patient Health Information Service (University of Manitoba Libraries), http://www.umanitoba.ca/libraries/units/health/reference/chis.html
•
Manitoba, Canada: J.W. Crane Memorial Library (Deer Lodge Centre, Winnipeg), http://www.deerlodge.mb.ca/crane_library/about.asp
•
Maryland: Health Information Center at the Wheaton Regional Library (Montgomery County, Dept. of Public Libraries, Wheaton Regional Library), http://www.mont.lib.md.us/healthinfo/hic.asp
•
Massachusetts: Baystate Medical Center Library (Baystate Health System), http://www.baystatehealth.com/1024/
•
Massachusetts: Boston University Medical Center Alumni Medical Library (Boston University Medical Center), http://med-libwww.bu.edu/library/lib.html
•
Massachusetts: Lowell General Hospital Health Sciences Library (Lowell General Hospital, Lowell), http://www.lowellgeneral.org/library/HomePageLinks/WWW.htm
•
Massachusetts: Paul E. Woodard Health Sciences Library (New England Baptist Hospital, Boston), http://www.nebh.org/health_lib.asp
•
Massachusetts: St. Luke’s Hospital Health Sciences Library (St. Luke’s Hospital, Southcoast Health System, New Bedford), http://www.southcoast.org/library/
•
Massachusetts: Treadwell Library Consumer Health Reference Center (Massachusetts General Hospital), http://www.mgh.harvard.edu/library/chrcindex.html
•
Massachusetts: UMass HealthNet (University of Massachusetts Medical School, Worchester), http://healthnet.umassmed.edu/
•
Michigan: Botsford General Hospital Library - Consumer Health (Botsford General Hospital, Library & Internet Services), http://www.botsfordlibrary.org/consumer.htm
•
Michigan: Helen DeRoy Medical Library (Providence Hospital and Medical Centers), http://www.providence-hospital.org/library/
•
Michigan: Marquette General Hospital - Consumer Health Library (Marquette General Hospital, Health Information Center), http://www.mgh.org/center.html
•
Michigan: Patient Education Resouce Center - University of Michigan Cancer Center (University of Michigan Comprehensive Cancer Center, Ann Arbor), http://www.cancer.med.umich.edu/learn/leares.htm
•
Michigan: Sladen Library & Center for Health Information Resources - Consumer Health Information (Detroit), http://www.henryford.com/body.cfm?id=39330
•
Montana: Center for Health Information (St. Patrick Hospital and Health Sciences Center, Missoula)
•
National: Consumer Health Library Directory (Medical Library Association, Consumer and Patient Health Information Section), http://caphis.mlanet.org/directory/index.html
•
National: National Network of Libraries of Medicine (National Library of Medicine) provides library services for health professionals in the United States who do not have access to a medical library, http://nnlm.gov/
•
National: NN/LM List of Libraries Serving the Public (National Network of Libraries of Medicine), http://nnlm.gov/members/
Finding Medical Libraries
129
•
Nevada: Health Science Library, West Charleston Library (Las Vegas-Clark County Library District, Las Vegas), http://www.lvccld.org/special_collections/medical/index.htm
•
New Hampshire: Dartmouth Biomedical Libraries (Dartmouth College Library, Hanover), http://www.dartmouth.edu/~biomed/resources.htmld/conshealth.htmld/
•
New Jersey: Consumer Health Library (Rahway Hospital, Rahway), http://www.rahwayhospital.com/library.htm
•
New Jersey: Dr. Walter Phillips Health Sciences Library (Englewood Hospital and Medical Center, Englewood), http://www.englewoodhospital.com/links/index.htm
•
New Jersey: Meland Foundation (Englewood Hospital and Medical Center, Englewood), http://www.geocities.com/ResearchTriangle/9360/
•
New York: Choices in Health Information (New York Public Library) - NLM Consumer Pilot Project participant, http://www.nypl.org/branch/health/links.html
•
New York: Health Information Center (Upstate Medical University, State University of New York, Syracuse), http://www.upstate.edu/library/hic/
•
New York: Health Sciences Library (Long Island Jewish Medical Center, New Hyde Park), http://www.lij.edu/library/library.html
•
New York: ViaHealth Medical Library (Rochester General Hospital), http://www.nyam.org/library/
•
Ohio: Consumer Health Library (Akron General Medical Center, Medical & Consumer Health Library), http://www.akrongeneral.org/hwlibrary.htm
•
Oklahoma: The Health Information Center at Saint Francis Hospital (Saint Francis Health System, Tulsa), http://www.sfh-tulsa.com/services/healthinfo.asp
•
Oregon: Planetree Health Resource Center (Mid-Columbia Medical Center, The Dalles), http://www.mcmc.net/phrc/
•
Pennsylvania: Community Health Information Library (Milton S. Hershey Medical Center, Hershey), http://www.hmc.psu.edu/commhealth/
•
Pennsylvania: Community Health Resource Library (Geisinger Medical Center, Danville), http://www.geisinger.edu/education/commlib.shtml
•
Pennsylvania: HealthInfo Library (Moses Taylor Hospital, Scranton), http://www.mth.org/healthwellness.html
•
Pennsylvania: Hopwood Library (University of Pittsburgh, Health Sciences Library System, Pittsburgh), http://www.hsls.pitt.edu/guides/chi/hopwood/index_html
•
Pennsylvania: Koop Community Health Information Center (College of Physicians of Philadelphia), http://www.collphyphil.org/kooppg1.shtml
•
Pennsylvania: Learning Resources Center - Medical Library (Susquehanna Health System, Williamsport), http://www.shscares.org/services/lrc/index.asp
•
Pennsylvania: Medical Library (UPMC Health System, Pittsburgh), http://www.upmc.edu/passavant/library.htm
•
Quebec, Canada: Medical Library (Montreal General Hospital), http://www.mghlib.mcgill.ca/
130 Toxic Shock Syndrome
•
South Dakota: Rapid City Regional Hospital Medical Library (Rapid City Regional Hospital), http://www.rcrh.org/Services/Library/Default.asp
•
Texas: Houston HealthWays (Houston Academy of Medicine-Texas Medical Center Library), http://hhw.library.tmc.edu/
•
Washington: Community Health Library (Kittitas Valley Community Hospital), http://www.kvch.com/
•
Washington: Southwest Washington Medical Center Library (Southwest Washington Medical Center, Vancouver), http://www.swmedicalcenter.com/body.cfm?id=72
131
ONLINE GLOSSARIES The Internet provides access to a number of free-to-use medical dictionaries. The National Library of Medicine has compiled the following list of online dictionaries: •
ADAM Medical Encyclopedia (A.D.A.M., Inc.), comprehensive medical reference: http://www.nlm.nih.gov/medlineplus/encyclopedia.html
•
MedicineNet.com Medical Dictionary (MedicineNet, Inc.): http://www.medterms.com/Script/Main/hp.asp
•
Merriam-Webster Medical Dictionary (Inteli-Health, Inc.): http://www.intelihealth.com/IH/
•
Multilingual Glossary of Technical and Popular Medical Terms in Eight European Languages (European Commission) - Danish, Dutch, English, French, German, Italian, Portuguese, and Spanish: http://allserv.rug.ac.be/~rvdstich/eugloss/welcome.html
•
On-line Medical Dictionary (CancerWEB): http://cancerweb.ncl.ac.uk/omd/
•
Rare Diseases Terms (Office of Rare Diseases): http://ord.aspensys.com/asp/diseases/diseases.asp
•
Technology Glossary (National Library of Medicine) - Health Care Technology: http://www.nlm.nih.gov/nichsr/ta101/ta10108.htm
Beyond these, MEDLINEplus contains a very patient-friendly encyclopedia covering every aspect of medicine (licensed from A.D.A.M., Inc.). The ADAM Medical Encyclopedia can be accessed at http://www.nlm.nih.gov/medlineplus/encyclopedia.html. ADAM is also available on commercial Web sites such as drkoop.com (http://www.drkoop.com/) and Web MD (http://my.webmd.com/adam/asset/adam_disease_articles/a_to_z/a). The NIH suggests the following Web sites in the ADAM Medical Encyclopedia when searching for information on toxic shock syndrome: •
Basic Guidelines for Toxic Shock Syndrome Toxic shock syndrome Web site: http://www.nlm.nih.gov/medlineplus/ency/article/000653.htm Tss Web site: http://www.nlm.nih.gov/medlineplus/ency/article/000653.htm
•
Signs & Symptoms for Toxic Shock Syndrome Agitation Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003212.htm Alopecia Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003246.htm Arthralgia Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003261.htm
132 Toxic Shock Syndrome
Chills Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003091.htm Diarrhea Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003126.htm Dysphagia Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003115.htm Edema Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003103.htm Erythema Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003220.htm Fever Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003090.htm Headache Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003024.htm Hepatosplenomegaly Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003275.htm Hypotension Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003083.htm Low blood pressure Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003083.htm Malaise Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003089.htm Menorrhagia Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003263.htm Myalgia Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003178.htm Nausea, vomiting Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003117.htm Oliguria Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003147.htm Photophobia Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003041.htm Rash Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003220.htm
Online Glossaries 133
Rigors Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003091.htm Seizures Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003200.htm Skin rash Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003220.htm Syncope Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003092.htm Vaginal discharge Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003158.htm Vomiting Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003117.htm •
Diagnostics and Tests for Toxic Shock Syndrome ALT Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003473.htm AST Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003472.htm Bilirubin Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003479.htm Blood culture Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003744.htm Blood pressure Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003398.htm BUN Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003474.htm Calcitonin Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003699.htm CBC Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003642.htm Chest X-ray Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003804.htm CPK Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003503.htm Creatinine Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003475.htm
134 Toxic Shock Syndrome
Differential Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003657.htm ECG Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003868.htm LDH Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003471.htm Serum antibodies Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003333.htm SGOT Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003472.htm SGPT Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003473.htm Urinalysis Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003579.htm X-ray Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003337.htm •
Background Topics for Toxic Shock Syndrome Acute Web site: http://www.nlm.nih.gov/medlineplus/ency/article/002215.htm Cardiovascular Web site: http://www.nlm.nih.gov/medlineplus/ency/article/002310.htm Electrolytes Web site: http://www.nlm.nih.gov/medlineplus/ency/article/002350.htm Foley catheter Web site: http://www.nlm.nih.gov/medlineplus/ency/article/003981.htm Hepatic Web site: http://www.nlm.nih.gov/medlineplus/ency/article/002378.htm Intravenous Web site: http://www.nlm.nih.gov/medlineplus/ency/article/002383.htm Mucous membrane Web site: http://www.nlm.nih.gov/medlineplus/ency/article/002264.htm Renal Web site: http://www.nlm.nih.gov/medlineplus/ency/article/002289.htm Respiratory Web site: http://www.nlm.nih.gov/medlineplus/ency/article/002290.htm
Online Glossaries 135
Shock Web site: http://www.nlm.nih.gov/medlineplus/ency/article/000039.htm
Online Dictionary Directories The following are additional online directories compiled by the National Library of Medicine, including a number of specialized medical dictionaries: •
Medical Dictionaries: Medical & Biological (World Health Organization): http://www.who.int/hlt/virtuallibrary/English/diction.htm#Medical
•
MEL-Michigan Electronic Library List of Online Health and Medical Dictionaries (Michigan Electronic Library): http://mel.lib.mi.us/health/health-dictionaries.html
•
Patient Education: Glossaries (DMOZ Open Directory Project): http://dmoz.org/Health/Education/Patient_Education/Glossaries/
•
Web of Online Dictionaries (Bucknell University): http://www.yourdictionary.com/diction5.html#medicine
137
TOXIC SHOCK SYNDROME DICTIONARY The definitions below are derived from official public sources, including the National Institutes of Health [NIH] and the European Union [EU]. Abdomen: That portion of the body that lies between the thorax and the pelvis. [NIH] Abdominal: Having to do with the abdomen, which is the part of the body between the chest and the hips that contains the pancreas, stomach, intestines, liver, gallbladder, and other organs. [NIH] Abdominal Pain: Sensation of discomfort, distress, or agony in the abdominal region. [NIH] Abscess: A localized, circumscribed collection of pus. [NIH] Acetylcholine: A neurotransmitter. Acetylcholine in vertebrates is the major transmitter at neuromuscular junctions, autonomic ganglia, parasympathetic effector junctions, a subset of sympathetic effector junctions, and at many sites in the central nervous system. It is generally not used as an administered drug because it is broken down very rapidly by cholinesterases, but it is useful in some ophthalmological applications. [NIH] Acrylonitrile: A highly poisonous compound used widely in the manufacture of plastics, adhesives and synthetic rubber. [NIH] Actin: Essential component of the cell skeleton. [NIH] Acute renal: A condition in which the kidneys suddenly stop working. In most cases, kidneys can recover from almost complete loss of function. [NIH] Adenine: A purine base and a fundamental unit of adenine nucleotides. [NIH] Adenosine: A nucleoside that is composed of adenine and d-ribose. Adenosine or adenosine derivatives play many important biological roles in addition to being components of DNA and RNA. Adenosine itself is a neurotransmitter. [NIH] Adjuvant: A substance which aids another, such as an auxiliary remedy; in immunology, nonspecific stimulator (e.g., BCG vaccine) of the immune response. [EU] Adoptive Transfer: Form of passive immunization where previously sensitized immunologic agents (cells or serum) are transferred to non-immune recipients. When transfer of cells is used as a therapy for the treatment of neoplasms, it is called adoptive immunotherapy (immunotherapy, adoptive). [NIH] Adrenergic: Activated by, characteristic of, or secreting epinephrine or substances with similar activity; the term is applied to those nerve fibres that liberate norepinephrine at a synapse when a nerve impulse passes, i.e., the sympathetic fibres. [EU] Adsorption: The condensation of gases, liquids, or dissolved substances on the surfaces of solids. It includes adsorptive phenomena of bacteria and viruses as well as of tissues treated with exogenous drugs and chemicals. [NIH] Adsorptive: It captures volatile compounds by binding them to agents such as activated carbon or adsorptive resins. [NIH] Adverse Effect: An unwanted side effect of treatment. [NIH] Aerobic: In biochemistry, reactions that need oxygen to happen or happen when oxygen is present. [NIH] Affinity: 1. Inherent likeness or relationship. 2. A special attraction for a specific element, organ, or structure. 3. Chemical affinity; the force that binds atoms in molecules; the
138 Toxic Shock Syndrome
tendency of substances to combine by chemical reaction. 4. The strength of noncovalent chemical binding between two substances as measured by the dissociation constant of the complex. 5. In immunology, a thermodynamic expression of the strength of interaction between a single antigen-binding site and a single antigenic determinant (and thus of the stereochemical compatibility between them), most accurately applied to interactions among simple, uniform antigenic determinants such as haptens. Expressed as the association constant (K litres mole -1), which, owing to the heterogeneity of affinities in a population of antibody molecules of a given specificity, actually represents an average value (mean intrinsic association constant). 6. The reciprocal of the dissociation constant. [EU] Agonist: In anatomy, a prime mover. In pharmacology, a drug that has affinity for and stimulates physiologic activity at cell receptors normally stimulated by naturally occurring substances. [EU] Airway: A device for securing unobstructed passage of air into and out of the lungs during general anesthesia. [NIH] Algorithms: A procedure consisting of a sequence of algebraic formulas and/or logical steps to calculate or determine a given task. [NIH] Alleles: Mutually exclusive forms of the same gene, occupying the same locus on homologous chromosomes, and governing the same biochemical and developmental process. [NIH] Allergen: An antigenic substance capable of producing immediate-type hypersensitivity (allergy). [EU] Allergic Rhinitis: Inflammation of the nasal mucous membrane associated with hay fever; fits may be provoked by substances in the working environment. [NIH] Allium: A genus of liliaceous herbs containing onions (Allium cepa), garlic (Allium sativum), and others; many produce pungent, often bacteriostatic and physiologically active compounds and are used as food, condiment, and medicament, the latter in traditional medicine. [NIH] Allograft: An organ or tissue transplant between two humans. [NIH] Alpha Particles: Positively charged particles composed of two protons and two neutrons, i.e., helium nuclei, emitted during disintegration of very heavy isotopes; a beam of alpha particles or an alpha ray has very strong ionizing power, but weak penetrability. [NIH] Alternative medicine: Practices not generally recognized by the medical community as standard or conventional medical approaches and used instead of standard treatments. Alternative medicine includes the taking of dietary supplements, megadose vitamins, and herbal preparations; the drinking of special teas; and practices such as massage therapy, magnet therapy, spiritual healing, and meditation. [NIH] Alveoli: Tiny air sacs at the end of the bronchioles in the lungs. [NIH] Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining protein conformation. [NIH] Amino Acids: Organic compounds that generally contain an amino (-NH2) and a carboxyl (COOH) group. Twenty alpha-amino acids are the subunits which are polymerized to form proteins. [NIH] Amino Acids: Organic compounds that generally contain an amino (-NH2) and a carboxyl (COOH) group. Twenty alpha-amino acids are the subunits which are polymerized to form proteins. [NIH] Amplification: The production of additional copies of a chromosomal DNA sequence,
Dictionary 139
found as either intrachromosomal or extrachromosomal DNA. [NIH] Anaerobic: 1. Lacking molecular oxygen. 2. Growing, living, or occurring in the absence of molecular oxygen; pertaining to an anaerobe. [EU] Anaesthesia: Loss of feeling or sensation. Although the term is used for loss of tactile sensibility, or of any of the other senses, it is applied especially to loss of the sensation of pain, as it is induced to permit performance of surgery or other painful procedures. [EU] Anal: Having to do with the anus, which is the posterior opening of the large bowel. [NIH] Analog: In chemistry, a substance that is similar, but not identical, to another. [NIH] Analogous: Resembling or similar in some respects, as in function or appearance, but not in origin or development;. [EU] Analytes: A component of a test sample the presence of which has to be demonstrated. The term "analyte" includes where appropriate formed from the analyte during the analyses. [NIH]
Anaphylatoxins: The family of peptides C3a, C4a, C5a, and C5a des-arginine produced in the serum during complement activation. They produce smooth muscle contraction, mast cell histamine release, affect platelet aggregation, and act as mediators of the local inflammatory process. The order of anaphylatoxin activity from strongest to weakest is C5a, C3a, C4a, and C5a des-arginine. The latter is the so-called "classical" anaphylatoxin but shows no spasmogenic activity though it contains some chemotactic ability. [NIH] Anaphylaxis: An acute hypersensitivity reaction due to exposure to a previously encountered antigen. The reaction may include rapidly progressing urticaria, respiratory distress, vascular collapse, systemic shock, and death. [NIH] Anatomical: Pertaining to anatomy, or to the structure of the organism. [EU] Anemia: A reduction in the number of circulating erythrocytes or in the quantity of hemoglobin. [NIH] Anergy: Absence of immune response to particular substances. [NIH] Anesthesia: A state characterized by loss of feeling or sensation. This depression of nerve function is usually the result of pharmacologic action and is induced to allow performance of surgery or other painful procedures. [NIH] Angiogenesis: Blood vessel formation. Tumor angiogenesis is the growth of blood vessels from surrounding tissue to a solid tumor. This is caused by the release of chemicals by the tumor. [NIH] Animal model: An animal with a disease either the same as or like a disease in humans. Animal models are used to study the development and progression of diseases and to test new treatments before they are given to humans. Animals with transplanted human cancers or other tissues are called xenograft models. [NIH] Annealing: The spontaneous alignment of two single DNA strands to form a double helix. [NIH]
Anorexia: Lack or loss of appetite for food. Appetite is psychologic, dependent on memory and associations. Anorexia can be brought about by unattractive food, surroundings, or company. [NIH] Antagonism: Interference with, or inhibition of, the growth of a living organism by another living organism, due either to creation of unfavorable conditions (e. g. exhaustion of food supplies) or to production of a specific antibiotic substance (e. g. penicillin). [NIH] Antibacterial: A substance that destroys bacteria or suppresses their growth or reproduction. [EU]
140 Toxic Shock Syndrome
Antibiotic: A drug used to treat infections caused by bacteria and other microorganisms. [NIH]
Antibodies: Immunoglobulin molecules having a specific amino acid sequence by virtue of which they interact only with the antigen that induced their synthesis in cells of the lymphoid series (especially plasma cells), or with an antigen closely related to it. [NIH] Antibody: A type of protein made by certain white blood cells in response to a foreign substance (antigen). Each antibody can bind to only a specific antigen. The purpose of this binding is to help destroy the antigen. Antibodies can work in several ways, depending on the nature of the antigen. Some antibodies destroy antigens directly. Others make it easier for white blood cells to destroy the antigen. [NIH] Anticoagulant: A drug that helps prevent blood clots from forming. Also called a blood thinner. [NIH] Antigen: Any substance which is capable, under appropriate conditions, of inducing a specific immune response and of reacting with the products of that response, that is, with specific antibody or specifically sensitized T-lymphocytes, or both. Antigens may be soluble substances, such as toxins and foreign proteins, or particulate, such as bacteria and tissue cells; however, only the portion of the protein or polysaccharide molecule known as the antigenic determinant (q.v.) combines with antibody or a specific receptor on a lymphocyte. Abbreviated Ag. [EU] Antigen-Antibody Complex: The complex formed by the binding of antigen and antibody molecules. The deposition of large antigen-antibody complexes leading to tissue damage causes immune complex diseases. [NIH] Antigen-presenting cell: APC. A cell that shows antigen on its surface to other cells of the immune system. This is an important part of an immune response. [NIH] Anti-infective: An agent that so acts. [EU] Anti-inflammatory: Having to do with reducing inflammation. [NIH] Antimicrobial: Killing microorganisms, or suppressing their multiplication or growth. [EU] Antiseptic: A substance that inhibits the growth and development of microorganisms without necessarily killing them. [EU] Antiviral: Destroying viruses or suppressing their replication. [EU] Anus: The opening of the rectum to the outside of the body. [NIH] Apoptosis: One of the two mechanisms by which cell death occurs (the other being the pathological process of necrosis). Apoptosis is the mechanism responsible for the physiological deletion of cells and appears to be intrinsically programmed. It is characterized by distinctive morphologic changes in the nucleus and cytoplasm, chromatin cleavage at regularly spaced sites, and the endonucleolytic cleavage of genomic DNA (DNA fragmentation) at internucleosomal sites. This mode of cell death serves as a balance to mitosis in regulating the size of animal tissues and in mediating pathologic processes associated with tumor growth. [NIH] Arachidonic Acid: An unsaturated, essential fatty acid. It is found in animal and human fat as well as in the liver, brain, and glandular organs, and is a constituent of animal phosphatides. It is formed by the synthesis from dietary linoleic acid and is a precursor in the biosynthesis of prostaglandins, thromboxanes, and leukotrienes. [NIH] Arginine: An essential amino acid that is physiologically active in the L-form. [NIH] Arterial: Pertaining to an artery or to the arteries. [EU] Arteries: The vessels carrying blood away from the heart. [NIH]
Dictionary 141
Arterioles: The smallest divisions of the arteries located between the muscular arteries and the capillaries. [NIH] Articular: Of or pertaining to a joint. [EU] Aseptic: Free from infection or septic material; sterile. [EU] Aspergillosis: Infections with fungi of the genus Aspergillus. [NIH] Aspiration: The act of inhaling. [NIH] Assay: Determination of the amount of a particular constituent of a mixture, or of the biological or pharmacological potency of a drug. [EU] Astringent: Causing contraction, usually locally after topical application. [EU] Asymptomatic: Having no signs or symptoms of disease. [NIH] Atmospheric Pressure: The pressure at any point in an atmosphere due solely to the weight of the atmospheric gases above the point concerned. [NIH] Atopic: Pertaining to an atopen or to atopy; allergic. [EU] Atrophy: Decrease in the size of a cell, tissue, organ, or multiple organs, associated with a variety of pathological conditions such as abnormal cellular changes, ischemia, malnutrition, or hormonal changes. [NIH] Attenuated: Strain with weakened or reduced virulence. [NIH] Atypical: Irregular; not conformable to the type; in microbiology, applied specifically to strains of unusual type. [EU] Autodigestion: Autolysis; a condition found in disease of the stomach: the stomach wall is digested by the gastric juice. [NIH] Autoimmune disease: A condition in which the body recognizes its own tissues as foreign and directs an immune response against them. [NIH] Autoimmunity: Process whereby the immune system reacts against the body's own tissues. Autoimmunity may produce or be caused by autoimmune diseases. [NIH] Autopsy: Postmortem examination of the body. [NIH] Back Pain: Acute or chronic pain located in the posterior regions of the trunk, including the thoracic, lumbar, sacral, or adjacent regions. [NIH] Bacteremia: The presence of viable bacteria circulating in the blood. Fever, chills, tachycardia, and tachypnea are common acute manifestations of bacteremia. The majority of cases are seen in already hospitalized patients, most of whom have underlying diseases or procedures which render their bloodstreams susceptible to invasion. [NIH] Bacteria: Unicellular prokaryotic microorganisms which generally possess rigid cell walls, multiply by cell division, and exhibit three principal forms: round or coccal, rodlike or bacillary, and spiral or spirochetal. [NIH] Bacterial Infections: Infections by bacteria, general or unspecified. [NIH] Bacterial toxin: A toxic substance, made by bacteria, that can be modified to kill specific tumor cells without harming normal cells. [NIH] Bactericidal: Substance lethal to bacteria; substance capable of killing bacteria. [NIH] Bacteriophage: A virus whose host is a bacterial cell; A virus that exclusively infects bacteria. It generally has a protein coat surrounding the genome (DNA or RNA). One of the coliphages most extensively studied is the lambda phage, which is also one of the most important. [NIH] Bacteriostatic: 1. Inhibiting the growth or multiplication of bacteria. 2. An agent that inhibits
142 Toxic Shock Syndrome
the growth or multiplication of bacteria. [EU] Bacterium: Microscopic organism which may have a spherical, rod-like, or spiral unicellular or non-cellular body. Bacteria usually reproduce through asexual processes. [NIH] Base: In chemistry, the nonacid part of a salt; a substance that combines with acids to form salts; a substance that dissociates to give hydroxide ions in aqueous solutions; a substance whose molecule or ion can combine with a proton (hydrogen ion); a substance capable of donating a pair of electrons (to an acid) for the formation of a coordinate covalent bond. [EU] Basophils: Granular leukocytes characterized by a relatively pale-staining, lobate nucleus and cytoplasm containing coarse dark-staining granules of variable size and stainable by basic dyes. [NIH] Benign: Not cancerous; does not invade nearby tissue or spread to other parts of the body. [NIH]
Beta-Glucosidase: An enzyme that catalyzes the hydrolysis of terminal non-reducing residues in beta-D-glucosides with release of beta-glucose. EC 3.2.1.21. [NIH] Beta-Thromboglobulin: A platelet-specific protein which is released when platelets aggregate. Elevated plasma levels have been reported after deep venous thrombosis, preeclampsia, myocardial infarction with mural thrombosis, and myeloproliferative disorders. Measurement of beta-thromboglobulin in biological fluids by radioimmunoassay is used for the diagnosis and assessment of progress of thromboembolic disorders. [NIH] Bilateral: Affecting both the right and left side of body. [NIH] Bile: An emulsifying agent produced in the liver and secreted into the duodenum. Its composition includes bile acids and salts, cholesterol, and electrolytes. It aids digestion of fats in the duodenum. [NIH] Biliary: Having to do with the liver, bile ducts, and/or gallbladder. [NIH] Biliary Tract: The gallbladder and its ducts. [NIH] Binding Sites: The reactive parts of a macromolecule that directly participate in its specific combination with another molecule. [NIH] Biochemical: Relating to biochemistry; characterized by, produced by, or involving chemical reactions in living organisms. [EU] Biopsy: Removal and pathologic examination of specimens in the form of small pieces of tissue from the living body. [NIH] Biotechnology: Body of knowledge related to the use of organisms, cells or cell-derived constituents for the purpose of developing products which are technically, scientifically and clinically useful. Alteration of biologic function at the molecular level (i.e., genetic engineering) is a central focus; laboratory methods used include transfection and cloning technologies, sequence and structure analysis algorithms, computer databases, and gene and protein structure function analysis and prediction. [NIH] Bioterrorism: The use of biological agents in terrorism. This includes the malevolent use of bacteria, viruses, or toxins against people, animals, or plants. [NIH] Biphasic: Having two phases; having both a sporophytic and a gametophytic phase in the life cycle. [EU] Bladder: The organ that stores urine. [NIH] Blastomycosis: A fungal infection that may appear in two forms: 1) a primary lesion characterized by the formation of a small cutaneous nodule and small nodules along the lymphatics that may heal within several months; and 2) chronic granulomatous lesions characterized by thick crusts, warty growths, and unusual vascularity and infection in the
Dictionary 143
middle or upper lobes of the lung. [NIH] Blister: Visible accumulations of fluid within or beneath the epidermis. [NIH] Blood Cell Count: A count of the number of leukocytes and erythrocytes per unit volume in a sample of venous blood. A complete blood count (CBC) also includes measurement of the hemoglobin, hematocrit, and erythrocyte indices. [NIH] Blood Glucose: Glucose in blood. [NIH] Blood Platelets: Non-nucleated disk-shaped cells formed in the megakaryocyte and found in the blood of all mammals. They are mainly involved in blood coagulation. [NIH] Blood pressure: The pressure of blood against the walls of a blood vessel or heart chamber. Unless there is reference to another location, such as the pulmonary artery or one of the heart chambers, it refers to the pressure in the systemic arteries, as measured, for example, in the forearm. [NIH] Blood vessel: A tube in the body through which blood circulates. Blood vessels include a network of arteries, arterioles, capillaries, venules, and veins. [NIH] Blot: To transfer DNA, RNA, or proteins to an immobilizing matrix such as nitrocellulose. [NIH]
Body Fluids: Liquid components of living organisms. [NIH] Bone Marrow: The soft tissue filling the cavities of bones. Bone marrow exists in two types, yellow and red. Yellow marrow is found in the large cavities of large bones and consists mostly of fat cells and a few primitive blood cells. Red marrow is a hematopoietic tissue and is the site of production of erythrocytes and granular leukocytes. Bone marrow is made up of a framework of connective tissue containing branching fibers with the frame being filled with marrow cells. [NIH] Bone Resorption: Bone loss due to osteoclastic activity. [NIH] Bowel: The long tube-shaped organ in the abdomen that completes the process of digestion. There is both a small and a large bowel. Also called the intestine. [NIH] Bradykinin: A nonapeptide messenger that is enzymatically produced from kallidin in the blood where it is a potent but short-lived agent of arteriolar dilation and increased capillary permeability. Bradykinin is also released from mast cells during asthma attacks, from gut walls as a gastrointestinal vasodilator, from damaged tissues as a pain signal, and may be a neurotransmitter. [NIH] Branch: Most commonly used for branches of nerves, but applied also to other structures. [NIH]
Breakdown: A physical, metal, or nervous collapse. [NIH] Breast Implants: Implants used to reconstruct and/or cosmetically enhance the female breast. They have an outer shell or envelope of silicone elastomer and are filled with either saline or silicone gel. The outer shell may be either smooth or textured. [NIH] Broad-spectrum: Effective against a wide range of microorganisms; said of an antibiotic. [EU] Bronchi: The larger air passages of the lungs arising from the terminal bifurcation of the trachea. [NIH] Bronchial: Pertaining to one or more bronchi. [EU] Bronchioles: The tiny branches of air tubes in the lungs. [NIH] Bronchitis: Inflammation (swelling and reddening) of the bronchi. [NIH] Bronchoconstriction: Diminution of the caliber of a bronchus physiologically or as a result of pharmacological intervention. [NIH]
144 Toxic Shock Syndrome
Bronchus: A large air passage that leads from the trachea (windpipe) to the lung. [NIH] Buccal: Pertaining to or directed toward the cheek. In dental anatomy, used to refer to the buccal surface of a tooth. [EU] Burns: Injuries to tissues caused by contact with heat, steam, chemicals (burns, chemical), electricity (burns, electric), or the like. [NIH] Burns, Electric: Burns produced by contact with electric current or from a sudden discharge of electricity. [NIH] Bypass: A surgical procedure in which the doctor creates a new pathway for the flow of body fluids. [NIH] Cachexia: General ill health, malnutrition, and weight loss, usually associated with chronic disease. [NIH] Calcium: A basic element found in nearly all organized tissues. It is a member of the alkaline earth family of metals with the atomic symbol Ca, atomic number 20, and atomic weight 40. Calcium is the most abundant mineral in the body and combines with phosphorus to form calcium phosphate in the bones and teeth. It is essential for the normal functioning of nerves and muscles and plays a role in blood coagulation (as factor IV) and in many enzymatic processes. [NIH] Candidiasis: Infection with a fungus of the genus Candida. It is usually a superficial infection of the moist cutaneous areas of the body, and is generally caused by C. albicans; it most commonly involves the skin (dermatocandidiasis), oral mucous membranes (thrush, def. 1), respiratory tract (bronchocandidiasis), and vagina (vaginitis). Rarely there is a systemic infection or endocarditis. Called also moniliasis, candidosis, oidiomycosis, and formerly blastodendriosis. [EU] Candidosis: An infection caused by an opportunistic yeasts that tends to proliferate and become pathologic when the environment is favorable and the host resistance is weakened. [NIH]
Cantharidin: A toxic compound, isolated from the Spanish fly or blistering beetle (Lytta (Cantharis) vesicatoria) and other insects. It is a potent and specific inhibitor of protein phosphatases 1 (PP1) and 2A (PP2A). This compound can produce severe skin inflammation, and is extremely toxic if ingested orally. [NIH] Capsular: Cataract which is initiated by an opacification at the surface of the lens. [NIH] Carbohydrate: An aldehyde or ketone derivative of a polyhydric alcohol, particularly of the pentahydric and hexahydric alcohols. They are so named because the hydrogen and oxygen are usually in the proportion to form water, (CH2O)n. The most important carbohydrates are the starches, sugars, celluloses, and gums. They are classified into mono-, di-, tri-, polyand heterosaccharides. [EU] Carbon Dioxide: A colorless, odorless gas that can be formed by the body and is necessary for the respiration cycle of plants and animals. [NIH] Carboxy: Cannabinoid. [NIH] Carboxymethylcellulose: It is used as an emulsifier, thickener, suspending agent, etc., in cosmetics and pharmaceuticals; in research as a culture medium; in chromatography as a stabilizer for reagents; and therapeutically as a bulk laxative with antacid properties. [NIH] Carboxy-terminal: The end of any polypeptide or protein that bears a free carboxyl group. [NIH]
Carcinogenic: Producing carcinoma. [EU] Carcinoma: Cancer that begins in the skin or in tissues that line or cover internal organs. [NIH]
Dictionary 145
Cardiac: Having to do with the heart. [NIH] Cardiac arrest: A sudden stop of heart function. [NIH] Cardiovascular: Having to do with the heart and blood vessels. [NIH] Case report: A detailed report of the diagnosis, treatment, and follow-up of an individual patient. Case reports also contain some demographic information about the patient (for example, age, gender, ethnic origin). [NIH] Catechol: A chemical originally isolated from a type of mimosa tree. Catechol is used as an astringent, an antiseptic, and in photography, electroplating, and making other chemicals. It can also be man-made. [NIH] Catheters: A small, flexible tube that may be inserted into various parts of the body to inject or remove liquids. [NIH] Caudal: Denoting a position more toward the cauda, or tail, than some specified point of reference; same as inferior, in human anatomy. [EU] Causal: Pertaining to a cause; directed against a cause. [EU] Cefazolin: Semisynthetic cephalosporin analog with broad-spectrum antibiotic action due to inhibition of bacterial cell wall synthesis. It attains high serum levels and is excreted quickly via the urine. [NIH] Cell: The individual unit that makes up all of the tissues of the body. All living things are made up of one or more cells. [NIH] Cell Death: The termination of the cell's ability to carry out vital functions such as metabolism, growth, reproduction, responsiveness, and adaptability. [NIH] Cell Division: The fission of a cell. [NIH] Cell proliferation: An increase in the number of cells as a result of cell growth and cell division. [NIH] Cellobiose: A disaccharide consisting of two glucose units in beta (1-4) glycosidic linkage. Obtained from the partial hydrolysis of cellulose. [NIH] Cellulitis: An acute, diffuse, and suppurative inflammation of loose connective tissue, particularly the deep subcutaneous tissues, and sometimes muscle, which is most commonly seen as a result of infection of a wound, ulcer, or other skin lesions. [NIH] Cellulose: A polysaccharide with glucose units linked as in cellobiose. It is the chief constituent of plant fibers, cotton being the purest natural form of the substance. As a raw material, it forms the basis for many derivatives used in chromatography, ion exchange materials, explosives manufacturing, and pharmaceutical preparations. [NIH] Central Nervous System: The main information-processing organs of the nervous system, consisting of the brain, spinal cord, and meninges. [NIH] Central Nervous System Infections: Pathogenic infections of the brain, spinal cord, and meninges. DNA virus infections; RNA virus infections; bacterial infections; mycoplasma infections; Spirochaetales infections; fungal infections; protozoan infections; helminthiasis; and prion diseases may involve the central nervous system as a primary or secondary process. [NIH] Centrifugation: A method of separating organelles or large molecules that relies upon differential sedimentation through a preformed density gradient under the influence of a gravitational field generated in a centrifuge. [NIH] Cerebral: Of or pertaining of the cerebrum or the brain. [EU] Cerebrum: The largest part of the brain. It is divided into two hemispheres, or halves, called
146 Toxic Shock Syndrome
the cerebral hemispheres. The cerebrum controls muscle functions of the body and also controls speech, emotions, reading, writing, and learning. [NIH] Cervical: Relating to the neck, or to the neck of any organ or structure. Cervical lymph nodes are located in the neck; cervical cancer refers to cancer of the uterine cervix, which is the lower, narrow end (the "neck") of the uterus. [NIH] Cervix: The lower, narrow end of the uterus that forms a canal between the uterus and vagina. [NIH] Chelating Agents: Organic chemicals that form two or more coordination bonds with a central metal ion. Heterocyclic rings are formed with the central metal atom as part of the ring. Some biological systems form metal chelates, e.g., the iron-binding porphyrin group of hemoglobin and the magnesium-binding chlorophyll of plants. (From Hawley's Condensed Chemical Dictionary, 12th ed) They are used chemically to remove ions from solutions, medicinally against microorganisms, to treat metal poisoning, and in chemotherapy protocols. [NIH] Chemokines: Class of pro-inflammatory cytokines that have the ability to attract and activate leukocytes. They can be divided into at least three structural branches: C (chemokines, C), CC (chemokines, CC), and CXC (chemokines, CXC), according to variations in a shared cysteine motif. [NIH] Chemotactic Factors: Chemical substances that attract or repel cells or organisms. The concept denotes especially those factors released as a result of tissue injury, invasion, or immunologic activity, that attract leukocytes, macrophages, or other cells to the site of infection or insult. [NIH] Chemotaxis: The movement of cells or organisms toward or away from a substance in response to its concentration gradient. [NIH] Chemotherapy: Treatment with anticancer drugs. [NIH] Chickenpox: A mild, highly contagious virus characterized by itchy blisters all over the body. [NIH] Chlamydia: A genus of the family Chlamydiaceae whose species cause a variety of diseases in vertebrates including humans, mice, and swine. Chlamydia species are gram-negative and produce glycogen. The type species is Chlamydia trachomatis. [NIH] Chlorhexidine: Disinfectant and topical anti-infective agent used also as mouthwash to prevent oral plaque. [NIH] Chlorophyll: Porphyrin derivatives containing magnesium that act to convert light energy in photosynthetic organisms. [NIH] Cholera: An acute diarrheal disease endemic in India and Southeast Asia whose causative agent is vibrio cholerae. This condition can lead to severe dehydration in a matter of hours unless quickly treated. [NIH] Cholesterol: The principal sterol of all higher animals, distributed in body tissues, especially the brain and spinal cord, and in animal fats and oils. [NIH] Cholinergic: Resembling acetylcholine in pharmacological action; stimulated by or releasing acetylcholine or a related compound. [EU] Chorioretinitis: Inflammation of the choroid in which the sensory retina becomes edematous and opaque. The inflammatory cells and exudate may burst through the sensory retina to cloud the vitreous body. [NIH] Choroid: The thin, highly vascular membrane covering most of the posterior of the eye between the retina and sclera. [NIH]
Dictionary 147
Chromatin: The material of chromosomes. It is a complex of DNA, histones, and nonhistone proteins (chromosomal proteins, non-histone) found within the nucleus of a cell. [NIH] Chromosomal: Pertaining to chromosomes. [EU] Chromosome: Part of a cell that contains genetic information. Except for sperm and eggs, all human cells contain 46 chromosomes. [NIH] Chronic: A disease or condition that persists or progresses over a long period of time. [NIH] Chronic Disease: Disease or ailment of long duration. [NIH] Chronic Obstructive Pulmonary Disease: Collective term for chronic bronchitis and emphysema. [NIH] Chronic renal: Slow and progressive loss of kidney function over several years, often resulting in end-stage renal disease. People with end-stage renal disease need dialysis or transplantation to replace the work of the kidneys. [NIH] Ciprofloxacin: A carboxyfluoroquinoline antimicrobial agent that is effective against a wide range of microorganisms. It has been successfully and safely used in the treatment of resistant respiratory, skin, bone, joint, gastrointestinal, urinary, and genital infections. [NIH] Clindamycin: An antibacterial agent that is a semisynthetic analog of lincomycin. [NIH] Clinical trial: A research study that tests how well new medical treatments or other interventions work in people. Each study is designed to test new methods of screening, prevention, diagnosis, or treatment of a disease. [NIH] Clone: The term "clone" has acquired a new meaning. It is applied specifically to the bits of inserted foreign DNA in the hybrid molecules of the population. Each inserted segment originally resided in the DNA of a complex genome amid millions of other DNA segment. [NIH]
Cloning: The production of a number of genetically identical individuals; in genetic engineering, a process for the efficient replication of a great number of identical DNA molecules. [NIH] Coagulation: 1. The process of clot formation. 2. In colloid chemistry, the solidification of a sol into a gelatinous mass; an alteration of a disperse phase or of a dissolved solid which causes the separation of the system into a liquid phase and an insoluble mass called the clot or curd. Coagulation is usually irreversible. 3. In surgery, the disruption of tissue by physical means to form an amorphous residuum, as in electrocoagulation and photocoagulation. [EU] Coccidioidomycosis: An infectious disease caused by a fungus, Coccidioides immitis, that is prevalent in the western United States and is acquired by inhalation of dust containing the spores. [NIH] Codons: Any triplet of nucleotides (coding unit) in DNA or RNA (if RNA is the carrier of primary genetic information as in some viruses) that codes for particular amino acid or signals the beginning or end of the message. [NIH] Cofactor: A substance, microorganism or environmental factor that activates or enhances the action of another entity such as a disease-causing agent. [NIH] Colitis: Inflammation of the colon. [NIH] Collagen: A polypeptide substance comprising about one third of the total protein in mammalian organisms. It is the main constituent of skin, connective tissue, and the organic substance of bones and teeth. Different forms of collagen are produced in the body but all consist of three alpha-polypeptide chains arranged in a triple helix. Collagen is differentiated from other fibrous proteins, such as elastin, by the content of proline,
148 Toxic Shock Syndrome
hydroxyproline, and hydroxylysine; by the absence of tryptophan; and particularly by the high content of polar groups which are responsible for its swelling properties. [NIH] Collapse: 1. A state of extreme prostration and depression, with failure of circulation. 2. Abnormal falling in of the walls of any part of organ. [EU] Complement: A term originally used to refer to the heat-labile factor in serum that causes immune cytolysis, the lysis of antibody-coated cells, and now referring to the entire functionally related system comprising at least 20 distinct serum proteins that is the effector not only of immune cytolysis but also of other biologic functions. Complement activation occurs by two different sequences, the classic and alternative pathways. The proteins of the classic pathway are termed 'components of complement' and are designated by the symbols C1 through C9. C1 is a calcium-dependent complex of three distinct proteins C1q, C1r and C1s. The proteins of the alternative pathway (collectively referred to as the properdin system) and complement regulatory proteins are known by semisystematic or trivial names. Fragments resulting from proteolytic cleavage of complement proteins are designated with lower-case letter suffixes, e.g., C3a. Inactivated fragments may be designated with the suffix 'i', e.g. C3bi. Activated components or complexes with biological activity are designated by a bar over the symbol e.g. C1 or C4b,2a. The classic pathway is activated by the binding of C1 to classic pathway activators, primarily antigen-antibody complexes containing IgM, IgG1, IgG3; C1q binds to a single IgM molecule or two adjacent IgG molecules. The alternative pathway can be activated by IgA immune complexes and also by nonimmunologic materials including bacterial endotoxins, microbial polysaccharides, and cell walls. Activation of the classic pathway triggers an enzymatic cascade involving C1, C4, C2 and C3; activation of the alternative pathway triggers a cascade involving C3 and factors B, D and P. Both result in the cleavage of C5 and the formation of the membrane attack complex. Complement activation also results in the formation of many biologically active complement fragments that act as anaphylatoxins, opsonins, or chemotactic factors. [EU] Complementary and alternative medicine: CAM. Forms of treatment that are used in addition to (complementary) or instead of (alternative) standard treatments. These practices are not considered standard medical approaches. CAM includes dietary supplements, megadose vitamins, herbal preparations, special teas, massage therapy, magnet therapy, spiritual healing, and meditation. [NIH] Complementary medicine: Practices not generally recognized by the medical community as standard or conventional medical approaches and used to enhance or complement the standard treatments. Complementary medicine includes the taking of dietary supplements, megadose vitamins, and herbal preparations; the drinking of special teas; and practices such as massage therapy, magnet therapy, spiritual healing, and meditation. [NIH] Computational Biology: A field of biology concerned with the development of techniques for the collection and manipulation of biological data, and the use of such data to make biological discoveries or predictions. This field encompasses all computational methods and theories applicable to molecular biology and areas of computer-based techniques for solving biological problems including manipulation of models and datasets. [NIH] Conception: The onset of pregnancy, marked by implantation of the blastocyst; the formation of a viable zygote. [EU] Cone: One of the special retinal receptor elements which are presumed to be primarily concerned with perception of light and color stimuli when the eye is adapted to light. [NIH] Congestion: Excessive or abnormal accumulation of blood in a part. [EU] Conjunctiva: The mucous membrane that lines the inner surface of the eyelids and the anterior part of the sclera. [NIH]
Dictionary 149
Connective Tissue: Tissue that supports and binds other tissues. It consists of connective tissue cells embedded in a large amount of extracellular matrix. [NIH] Connective Tissue: Tissue that supports and binds other tissues. It consists of connective tissue cells embedded in a large amount of extracellular matrix. [NIH] Constipation: Infrequent or difficult evacuation of feces. [NIH] Constitutional: 1. Affecting the whole constitution of the body; not local. 2. Pertaining to the constitution. [EU] Contraception: Use of agents, devices, methods, or procedures which diminish the likelihood of or prevent conception. [NIH] Contraceptive: An agent that diminishes the likelihood of or prevents conception. [EU] Contraindications: Any factor or sign that it is unwise to pursue a certain kind of action or treatment, e. g. giving a general anesthetic to a person with pneumonia. [NIH] Coordination: Muscular or motor regulation or the harmonious cooperation of muscles or groups of muscles, in a complex action or series of actions. [NIH] Cornea: The transparent part of the eye that covers the iris and the pupil and allows light to enter the inside. [NIH] Coronary: Encircling in the manner of a crown; a term applied to vessels; nerves, ligaments, etc. The term usually denotes the arteries that supply the heart muscle and, by extension, a pathologic involvement of them. [EU] Coronary Thrombosis: Presence of a thrombus in a coronary artery, often causing a myocardial infarction. [NIH] Corpus: The body of the uterus. [NIH] Cortex: The outer layer of an organ or other body structure, as distinguished from the internal substance. [EU] Corticosteroids: Hormones that have antitumor activity in lymphomas and lymphoid leukemias; in addition, corticosteroids (steroids) may be used for hormone replacement and for the management of some of the complications of cancer and its treatment. [NIH] Cortisone: A natural steroid hormone produced in the adrenal gland. It can also be made in the laboratory. Cortisone reduces swelling and can suppress immune responses. [NIH] Cranial: Pertaining to the cranium, or to the anterior (in animals) or superior (in humans) end of the body. [EU] Craniocerebral Trauma: Traumatic injuries involving the cranium and intracranial structures (i.e., brain; cranial nerves; meninges; and other structures). Injuries may be classified by whether or not the skull is penetrated (i.e., penetrating vs. nonpenetrating) or whether there is an associated hemorrhage. [NIH] Croup: A condition characterized by resonant barking cough, hoarseness and persistant stridor and caused by allergy, foreign body, infection, or neoplasm. It occurs chiefly in infants and children. [NIH] Crystallization: The formation of crystals; conversion to a crystalline form. [EU] Curative: Tending to overcome disease and promote recovery. [EU] Curettage: Removal of tissue with a curette, a spoon-shaped instrument with a sharp edge. [NIH]
Cutaneous: Having to do with the skin. [NIH] Cyclic: Pertaining to or occurring in a cycle or cycles; the term is applied to chemical compounds that contain a ring of atoms in the nucleus. [EU]
150 Toxic Shock Syndrome
Cyst: A sac or capsule filled with fluid. [NIH] Cysteine: A thiol-containing non-essential amino acid that is oxidized to form cystine. [NIH] Cytokine: Small but highly potent protein that modulates the activity of many cell types, including T and B cells. [NIH] Cytoplasm: The protoplasm of a cell exclusive of that of the nucleus; it consists of a continuous aqueous solution (cytosol) and the organelles and inclusions suspended in it (phaneroplasm), and is the site of most of the chemical activities of the cell. [EU] Databases, Bibliographic: Extensive collections, reputedly complete, of references and citations to books, articles, publications, etc., generally on a single subject or specialized subject area. Databases can operate through automated files, libraries, or computer disks. The concept should be differentiated from factual databases which is used for collections of data and facts apart from bibliographic references to them. [NIH] Degenerative: Undergoing degeneration : tending to degenerate; having the character of or involving degeneration; causing or tending to cause degeneration. [EU] Deletion: A genetic rearrangement through loss of segments of DNA (chromosomes), bringing sequences, which are normally separated, into close proximity. [NIH] Denaturation: Rupture of the hydrogen bonds by heating a DNA solution and then cooling it rapidly causes the two complementary strands to separate. [NIH] Dendrites: Extensions of the nerve cell body. They are short and branched and receive stimuli from other neurons. [NIH] Density: The logarithm to the base 10 of the opacity of an exposed and processed film. [NIH] Dermatitis: Any inflammation of the skin. [NIH] Desquamation: The shedding of epithelial elements, chiefly of the skin, in scales or small sheets; exfoliation. [EU] Detergents: Purifying or cleansing agents, usually salts of long-chain aliphatic bases or acids, that exert cleansing (oil-dissolving) and antimicrobial effects through a surface action that depends on possessing both hydrophilic and hydrophobic properties. [NIH] Deuterium: Deuterium. The stable isotope of hydrogen. It has one neutron and one proton in the nucleus. [NIH] Dexamethasone: (11 beta,16 alpha)-9-Fluoro-11,17,21-trihydroxy-16-methylpregna-1,4diene-3,20-dione. An anti-inflammatory glucocorticoid used either in the free alcohol or esterified form in treatment of conditions that respond generally to cortisone. [NIH] Diabetes Mellitus: A heterogeneous group of disorders that share glucose intolerance in common. [NIH] Diagnostic procedure: A method used to identify a disease. [NIH] Dialyzer: A part of the hemodialysis machine. (See hemodialysis under dialysis.) The dialyzer has two sections separated by a membrane. One section holds dialysate. The other holds the patient's blood. [NIH] Diarrhea: Passage of excessively liquid or excessively frequent stools. [NIH] Diastolic: Of or pertaining to the diastole. [EU] Dietary Fats: Fats present in food, especially in animal products such as meat, meat products, butter, ghee. They are present in lower amounts in nuts, seeds, and avocados. [NIH]
Diffusion: The tendency of a gas or solute to pass from a point of higher pressure or concentration to a point of lower pressure or concentration and to distribute itself
Dictionary 151
throughout the available space; a major mechanism of biological transport. [NIH] Digestion: The process of breakdown of food for metabolism and use by the body. [NIH] Dilatation: The act of dilating. [NIH] Dilution: A diluted or attenuated medicine; in homeopathy, the diffusion of a given quantity of a medicinal agent in ten or one hundred times the same quantity of water. [NIH] Diploid: Having two sets of chromosomes. [NIH] Direct: 1. Straight; in a straight line. 2. Performed immediately and without the intervention of subsidiary means. [EU] Discrimination: The act of qualitative and/or quantitative differentiation between two or more stimuli. [NIH] Dissociation: 1. The act of separating or state of being separated. 2. The separation of a molecule into two or more fragments (atoms, molecules, ions, or free radicals) produced by the absorption of light or thermal energy or by solvation. 3. In psychology, a defense mechanism in which a group of mental processes are segregated from the rest of a person's mental activity in order to avoid emotional distress, as in the dissociative disorders (q.v.), or in which an idea or object is segregated from its emotional significance; in the first sense it is roughly equivalent to splitting, in the second, to isolation. 4. A defect of mental integration in which one or more groups of mental processes become separated off from normal consciousness and, thus separated, function as a unitary whole. [EU] Distal: Remote; farther from any point of reference; opposed to proximal. In dentistry, used to designate a position on the dental arch farther from the median line of the jaw. [EU] Dorsal: 1. Pertaining to the back or to any dorsum. 2. Denoting a position more toward the back surface than some other object of reference; same as posterior in human anatomy; superior in the anatomy of quadrupeds. [EU] Douche: A procedure in which water or a medicated solution is used to clean the vagina and cervix. [NIH] Douching: A jet or current of water, sometimes a dissolved medicating or cleansing agent, applied to a body part, organ or cavity for medicinal or hygienic purposes. [EU] Drug Interactions: The action of a drug that may affect the activity, metabolism, or toxicity of another drug. [NIH] Dura mater: The outermost, toughest, and most fibrous of the three membranes (meninges) covering the brain and spinal cord; called also pachymeninx. [EU] Dyes: Chemical substances that are used to stain and color other materials. The coloring may or may not be permanent. Dyes can also be used as therapeutic agents and test reagents in medicine and scientific research. [NIH] Dysmenorrhea: Painful menstruation. [NIH] Eczema: A pruritic papulovesicular dermatitis occurring as a reaction to many endogenous and exogenous agents (Dorland, 27th ed). [NIH] Edema: Excessive amount of watery fluid accumulated in the intercellular spaces, most commonly present in subcutaneous tissue. [NIH] Effector: It is often an enzyme that converts an inactive precursor molecule into an active second messenger. [NIH] Efficacy: The extent to which a specific intervention, procedure, regimen, or service produces a beneficial result under ideal conditions. Ideally, the determination of efficacy is based on the results of a randomized control trial. [NIH]
152 Toxic Shock Syndrome
Ehrlichiosis: A tick-borne disease characterized by fever, headache, myalgias, anorexia, and occasionally rash. In humans the disease is caused by Ehrlichia chaffeensis, in dogs it is caused by E. canis, and in horses, E. equi. [NIH] Ejaculation: The release of semen through the penis during orgasm. [NIH] Elastin: The protein that gives flexibility to tissues. [NIH] Electrocoagulation: Electrosurgical procedures used to treat hemorrhage (e.g., bleeding ulcers) and to ablate tumors, mucosal lesions, and refractory arrhythmias. [NIH] Electrolyte: A substance that dissociates into ions when fused or in solution, and thus becomes capable of conducting electricity; an ionic solute. [EU] Electrons: Stable elementary particles having the smallest known negative charge, present in all elements; also called negatrons. Positively charged electrons are called positrons. The numbers, energies and arrangement of electrons around atomic nuclei determine the chemical identities of elements. Beams of electrons are called cathode rays or beta rays, the latter being a high-energy biproduct of nuclear decay. [NIH] Electroplating: Coating with a metal or alloy by electrolysis. [NIH] Embryo: The prenatal stage of mammalian development characterized by rapid morphological changes and the differentiation of basic structures. [NIH] Emollient: Softening or soothing; called also malactic. [EU] Emphysema: A pathological accumulation of air in tissues or organs. [NIH] Empiric: Empirical; depending upon experience or observation alone, without using scientific method or theory. [EU] Emulsion: A preparation of one liquid distributed in small globules throughout the body of a second liquid. The dispersed liquid is the discontinuous phase, and the dispersion medium is the continuous phase. When oil is the dispersed liquid and an aqueous solution is the continuous phase, it is known as an oil-in-water emulsion, whereas when water or aqueous solution is the dispersed phase and oil or oleaginous substance is the continuous phase, it is known as a water-in-oil emulsion. Pharmaceutical emulsions for which official standards have been promulgated include cod liver oil emulsion, cod liver oil emulsion with malt, liquid petrolatum emulsion, and phenolphthalein in liquid petrolatum emulsion. [EU] Encephalitis: Inflammation of the brain due to infection, autoimmune processes, toxins, and other conditions. Viral infections (see encephalitis, viral) are a relatively frequent cause of this condition. [NIH] Encephalomyelitis: A general term indicating inflammation of the brain and spinal cord, often used to indicate an infectious process, but also applicable to a variety of autoimmune and toxic-metabolic conditions. There is significant overlap regarding the usage of this term and encephalitis in the literature. [NIH] Encephalopathy: A disorder of the brain that can be caused by disease, injury, drugs, or chemicals. [NIH] Endocarditis: Exudative and proliferative inflammatory alterations of the endocardium, characterized by the presence of vegetations on the surface of the endocardium or in the endocardium itself, and most commonly involving a heart valve, but sometimes affecting the inner lining of the cardiac chambers or the endocardium elsewhere. It may occur as a primary disorder or as a complication of or in association with another disease. [EU] Endocardium: The innermost layer of the heart, comprised of endothelial cells. [NIH] Endometrial: Having to do with the endometrium (the layer of tissue that lines the uterus). [NIH]
Dictionary 153
Endometrium: The layer of tissue that lines the uterus. [NIH] Endothelial cell: The main type of cell found in the inside lining of blood vessels, lymph vessels, and the heart. [NIH] Endothelium: A layer of epithelium that lines the heart, blood vessels (endothelium, vascular), lymph vessels (endothelium, lymphatic), and the serous cavities of the body. [NIH] Endothelium-derived: Small molecule that diffuses to the adjacent muscle layer and relaxes it. [NIH] Endotoxic: Of, relating to, or acting as an endotoxin (= a heat-stable toxin, associated with the outer membranes of certain gram-negative bacteria. Endotoxins are not secreted and are released only when the cells are disrupted). [EU] Endotoxin: Toxin from cell walls of bacteria. [NIH] End-stage renal: Total chronic kidney failure. When the kidneys fail, the body retains fluid and harmful wastes build up. A person with ESRD needs treatment to replace the work of the failed kidneys. [NIH] Enteritis: Inflammation of the intestine, applied chiefly to inflammation of the small intestine; see also enterocolitis. [EU] Enterocolitis: Inflammation of the intestinal mucosa of the small and large bowel. [NIH] Enterotoxins: Substances that are toxic to the intestinal tract causing vomiting, diarrhea, etc.; most common enterotoxins are produced by bacteria. [NIH] Environmental Health: The science of controlling or modifying those conditions, influences, or forces surrounding man which relate to promoting, establishing, and maintaining health. [NIH]
Enzymatic: Phase where enzyme cuts the precursor protein. [NIH] Enzyme: A protein that speeds up chemical reactions in the body. [NIH] Enzyme-Linked Immunosorbent Assay: An immunoassay utilizing an antibody labeled with an enzyme marker such as horseradish peroxidase. While either the enzyme or the antibody is bound to an immunosorbent substrate, they both retain their biologic activity; the change in enzyme activity as a result of the enzyme-antibody-antigen reaction is proportional to the concentration of the antigen and can be measured spectrophotometrically or with the naked eye. Many variations of the method have been developed. [NIH] Eosinophilia: Abnormal increase in eosinophils in the blood, tissues or organs. [NIH] Eosinophils: Granular leukocytes with a nucleus that usually has two lobes connected by a slender thread of chromatin, and cytoplasm containing coarse, round granules that are uniform in size and stainable by eosin. [NIH] Epidemic: Occurring suddenly in numbers clearly in excess of normal expectancy; said especially of infectious diseases but applied also to any disease, injury, or other healthrelated event occurring in such outbreaks. [EU] Epidemiologic Factors: Events, characteristics, or other definable entities that have the potential to bring about a change in a health condition or other defined outcome. [NIH] Epidemiological: Relating to, or involving epidemiology. [EU] Epidermal: Pertaining to or resembling epidermis. Called also epidermic or epidermoid. [EU] Epidermis: Nonvascular layer of the skin. It is made up, from within outward, of five layers: 1) basal layer (stratum basale epidermidis); 2) spinous layer (stratum spinosum epidermidis); 3) granular layer (stratum granulosum epidermidis); 4) clear layer (stratum
154 Toxic Shock Syndrome
lucidum epidermidis); and 5) horny layer (stratum corneum epidermidis). [NIH] Epinephrine: The active sympathomimetic hormone from the adrenal medulla in most species. It stimulates both the alpha- and beta- adrenergic systems, causes systemic vasoconstriction and gastrointestinal relaxation, stimulates the heart, and dilates bronchi and cerebral vessels. It is used in asthma and cardiac failure and to delay absorption of local anesthetics. [NIH] Epithelial: Refers to the cells that line the internal and external surfaces of the body. [NIH] Epithelial Cells: Cells that line the inner and outer surfaces of the body. [NIH] Epithelium: One or more layers of epithelial cells, supported by the basal lamina, which covers the inner or outer surfaces of the body. [NIH] Epitope: A molecule or portion of a molecule capable of binding to the combining site of an antibody. For every given antigenic determinant, the body can construct a variety of antibody-combining sites, some of which fit almost perfectly, and others which barely fit. [NIH]
Erectile: The inability to get or maintain an erection for satisfactory sexual intercourse. Also called impotence. [NIH] Erythema: Redness of the skin produced by congestion of the capillaries. This condition may result from a variety of causes. [NIH] Erythema Multiforme: A skin and mucous membrane disease characterized by an eruption of macules, papules, nodules, vesicles, and/or bullae with characteristic "bull's-eye" lesions usually occurring on the dorsal aspect of the hands and forearms. [NIH] Erythema Nodosum: An erythematous eruption commonly associated with drug reactions or infection and characterized by inflammatory nodules that are usually tender, multiple, and bilateral. These nodules are located predominantly on the shins with less common occurrence on the thighs and forearms. They undergo characteristic color changes ending in temporary bruise-like areas. This condition usually subsides in 3-6 weeks without scarring or atrophy. [NIH] Erythrocytes: Red blood cells. Mature erythrocytes are non-nucleated, biconcave disks containing hemoglobin whose function is to transport oxygen. [NIH] Estrogen: One of the two female sex hormones. [NIH] Ether: One of a class of organic compounds in which any two organic radicals are attached directly to a single oxygen atom. [NIH] Exfoliation: A falling off in scales or layers. [EU] Exhaustion: The feeling of weariness of mind and body. [NIH] Exogenous: Developed or originating outside the organism, as exogenous disease. [EU] Exotoxin: Toxic substance excreted by living bacterial cells. [NIH] Extensor: A muscle whose contraction tends to straighten a limb; the antagonist of a flexor. [NIH]
Extracellular: Outside a cell or cells. [EU] Extracellular Matrix: A meshwork-like substance found within the extracellular space and in association with the basement membrane of the cell surface. It promotes cellular proliferation and provides a supporting structure to which cells or cell lysates in culture dishes adhere. [NIH] Family Planning: Programs or services designed to assist the family in controlling reproduction by either improving or diminishing fertility. [NIH]
Dictionary 155
Fasciitis: Inflammation of the fascia. There are three major types: 1) Eosinophilic fasciitis, an inflammatory reaction with eosinophilia, producing hard thickened skin with an orangepeel configuration suggestive of scleroderma and considered by some a variant of scleroderma; 2) Necrotizing fasciitis, a serious fulminating infection (usually by a beta hemolytic Streptococcus) causing extensive necrosis of superficial fascia; 3) Nodular/Pseudosarcomatous/Proliferative fasciitis, characterized by a rapid growth of fibroblasts with mononuclear inflammatory cells and proliferating capillaries in soft tissue, often the forearm; it is not malignant but is sometimes mistaken for fibrosarcoma. [NIH] Fat: Total lipids including phospholipids. [NIH] Fatigue: The state of weariness following a period of exertion, mental or physical, characterized by a decreased capacity for work and reduced efficiency to respond to stimuli. [NIH]
Fatty acids: A major component of fats that are used by the body for energy and tissue development. [NIH] Febrile: Pertaining to or characterized by fever. [EU] Fibrin: A protein derived from fibrinogen in the presence of thrombin, which forms part of the blood clot. [NIH] Fibrinogen: Plasma glycoprotein clotted by thrombin, composed of a dimer of three nonidentical pairs of polypeptide chains (alpha, beta, gamma) held together by disulfide bonds. Fibrinogen clotting is a sol-gel change involving complex molecular arrangements: whereas fibrinogen is cleaved by thrombin to form polypeptides A and B, the proteolytic action of other enzymes yields different fibrinogen degradation products. [NIH] Fibroblasts: Connective tissue cells which secrete an extracellular matrix rich in collagen and other macromolecules. [NIH] Fibrosarcoma: A type of soft tissue sarcoma that begins in fibrous tissue, which holds bones, muscles, and other organs in place. [NIH] Fibrosis: Any pathological condition where fibrous connective tissue invades any organ, usually as a consequence of inflammation or other injury. [NIH] Fixation: 1. The act or operation of holding, suturing, or fastening in a fixed position. 2. The condition of being held in a fixed position. 3. In psychiatry, a term with two related but distinct meanings : (1) arrest of development at a particular stage, which like regression (return to an earlier stage), if temporary is a normal reaction to setbacks and difficulties but if protracted or frequent is a cause of developmental failures and emotional problems, and (2) a close and suffocating attachment to another person, especially a childhood figure, such as one's mother or father. Both meanings are derived from psychoanalytic theory and refer to 'fixation' of libidinal energy either in a specific erogenous zone, hence fixation at the oral, anal, or phallic stage, or in a specific object, hence mother or father fixation. 4. The use of a fixative (q.v.) to preserve histological or cytological specimens. 5. In chemistry, the process whereby a substance is removed from the gaseous or solution phase and localized, as in carbon dioxide fixation or nitrogen fixation. 6. In ophthalmology, direction of the gaze so that the visual image of the object falls on the fovea centralis. 7. In film processing, the chemical removal of all undeveloped salts of the film emulsion, leaving only the developed silver to form a permanent image. [EU] Flagellum: A whiplike appendage of a cell. It can function either as an organ of locomotion or as a device for moving the fluid surrounding the cell. [NIH] Flatus: Gas passed through the rectum. [NIH] Fluorescence: The property of emitting radiation while being irradiated. The radiation emitted is usually of longer wavelength than that incident or absorbed, e.g., a substance can
156 Toxic Shock Syndrome
be irradiated with invisible radiation and emit visible light. X-ray fluorescence is used in diagnosis. [NIH] Fold: A plication or doubling of various parts of the body. [NIH] Follicles: Shafts through which hair grows. [NIH] Foramen: A natural hole of perforation, especially one in a bone. [NIH] Forearm: The part between the elbow and the wrist. [NIH] Fovea: The central part of the macula that provides the sharpest vision. [NIH] Frontal Sinus: One of the paired, but seldom symmetrical, air spaces located between the inner and outer compact layers of the frontal bone. [NIH] FSH: A gonadotropic hormone found in the pituitary tissues of mammals. It regulates the metabolic activity of ovarian granulosa cells and testicular Sertoli cells, induces maturation of Graafian follicles in the ovary, and promotes the development of the germinal cells in the testis. [NIH] Fungi: A kingdom of eukaryotic, heterotrophic organisms that live as saprobes or parasites, including mushrooms, yeasts, smuts, molds, etc. They reproduce either sexually or asexually, and have life cycles that range from simple to complex. Filamentous fungi refer to those that grow as multicelluar colonies (mushrooms and molds). [NIH] Fungus: A general term used to denote a group of eukaryotic protists, including mushrooms, yeasts, rusts, moulds, smuts, etc., which are characterized by the absence of chlorophyll and by the presence of a rigid cell wall composed of chitin, mannans, and sometimes cellulose. They are usually of simple morphological form or show some reversible cellular specialization, such as the formation of pseudoparenchymatous tissue in the fruiting body of a mushroom. The dimorphic fungi grow, according to environmental conditions, as moulds or yeasts. [EU] Ganglion: 1. A knot, or knotlike mass. 2. A general term for a group of nerve cell bodies located outside the central nervous system; occasionally applied to certain nuclear groups within the brain or spinal cord, e.g. basal ganglia. 3. A benign cystic tumour occurring on a aponeurosis or tendon, as in the wrist or dorsum of the foot; it consists of a thin fibrous capsule enclosing a clear mucinous fluid. [EU] Gangrene: Death and putrefaction of tissue usually due to a loss of blood supply. [NIH] Gangrenous: A circumscribed, deep-seated, suppurative inflammation of the subcutaneous tissue of the eyelid discharging pus from several points. [NIH] Gas: Air that comes from normal breakdown of food. The gases are passed out of the body through the rectum (flatus) or the mouth (burp). [NIH] Gastric: Having to do with the stomach. [NIH] Gastrointestinal: Refers to the stomach and intestines. [NIH] Gelatin: A product formed from skin, white connective tissue, or bone collagen. It is used as a protein food adjuvant, plasma substitute, hemostatic, suspending agent in pharmaceutical preparations, and in the manufacturing of capsules and suppositories. [NIH] Gels: Colloids with a solid continuous phase and liquid as the dispersed phase; gels may be unstable when, due to temperature or other cause, the solid phase liquifies; the resulting colloid is called a sol. [NIH] Gene: The functional and physical unit of heredity passed from parent to offspring. Genes are pieces of DNA, and most genes contain the information for making a specific protein. [NIH]
Gene Expression: The phenotypic manifestation of a gene or genes by the processes of gene
Dictionary 157
action. [NIH] Genetic Code: The specifications for how information, stored in nucleic acid sequence (base sequence), is translated into protein sequence (amino acid sequence). The start, stop, and order of amino acids of a protein is specified by consecutive triplets of nucleotides called codons (codon). [NIH] Genetic Engineering: Directed modification of the gene complement of a living organism by such techniques as altering the DNA, substituting genetic material by means of a virus, transplanting whole nuclei, transplanting cell hybrids, etc. [NIH] Genetic testing: Analyzing DNA to look for a genetic alteration that may indicate an increased risk for developing a specific disease or disorder. [NIH] Genital: Pertaining to the genitalia. [EU] Genomics: The systematic study of the complete DNA sequences (genome) of organisms. [NIH]
Gestation: The period of development of the young in viviparous animals, from the time of fertilization of the ovum until birth. [EU] Gland: An organ that produces and releases one or more substances for use in the body. Some glands produce fluids that affect tissues or organs. Others produce hormones or participate in blood production. [NIH] Glomerular: Pertaining to or of the nature of a glomerulus, especially a renal glomerulus. [EU]
Glomeruli: Plural of glomerulus. [NIH] Glomerulonephritis: Glomerular disease characterized by an inflammatory reaction, with leukocyte infiltration and cellular proliferation of the glomeruli, or that appears to be the result of immune glomerular injury. [NIH] Glomerulus: A tiny set of looping blood vessels in the nephron where blood is filtered in the kidney. [NIH] Glucocorticoid: A compound that belongs to the family of compounds called corticosteroids (steroids). Glucocorticoids affect metabolism and have anti-inflammatory and immunosuppressive effects. They may be naturally produced (hormones) or synthetic (drugs). [NIH] Glucose: D-Glucose. A primary source of energy for living organisms. It is naturally occurring and is found in fruits and other parts of plants in its free state. It is used therapeutically in fluid and nutrient replacement. [NIH] Glycerol: A trihydroxy sugar alcohol that is an intermediate in carbohydrate and lipid metabolism. It is used as a solvent, emollient, pharmaceutical agent, and sweetening agent. [NIH]
Glycine: A non-essential amino acid. It is found primarily in gelatin and silk fibroin and used therapeutically as a nutrient. It is also a fast inhibitory neurotransmitter. [NIH] Glycogen: A sugar stored in the liver and muscles. It releases glucose into the blood when cells need it for energy. Glycogen is the chief source of stored fuel in the body. [NIH] Glycoprotein: A protein that has sugar molecules attached to it. [NIH] Goats: Any of numerous agile, hollow-horned ruminants of the genus Capra, closely related to the sheep. [NIH] Gonadal: Pertaining to a gonad. [EU] Gonadotropic: Stimulating the gonads; applied to hormones of the anterior pituitary which influence the gonads. [EU]
158 Toxic Shock Syndrome
Gonorrhea: Acute infectious disease characterized by primary invasion of the urogenital tract. The etiologic agent, Neisseria gonorrhoeae, was isolated by Neisser in 1879. [NIH] Governing Board: The group in which legal authority is vested for the control of healthrelated institutions and organizations. [NIH] Gp120: 120-kD HIV envelope glycoprotein which is involved in the binding of the virus to its membrane receptor, the CD4 molecule, found on the surface of certain cells in the body. [NIH]
Graft: Healthy skin, bone, or other tissue taken from one part of the body and used to replace diseased or injured tissue removed from another part of the body. [NIH] Gram-negative: Losing the stain or decolorized by alcohol in Gram's method of staining, a primary characteristic of bacteria having a cell wall composed of a thin layer of peptidoglycan covered by an outer membrane of lipoprotein and lipopolysaccharide. [EU] Gram-Negative Bacteria: Bacteria which lose crystal violet stain but are stained pink when treated by Gram's method. [NIH] Gram-positive: Retaining the stain or resisting decolorization by alcohol in Gram's method of staining, a primary characteristic of bacteria whose cell wall is composed of a thick layer of peptidologlycan with attached teichoic acids. [EU] Growth: The progressive development of a living being or part of an organism from its earliest stage to maturity. [NIH] Guanylate Cyclase: An enzyme that catalyzes the conversion of GTP to 3',5'-cyclic GMP and pyrophosphate. It also acts on ITP and dGTP. (From Enzyme Nomenclature, 1992) EC 4.6.1.2. [NIH] Haptens: Small antigenic determinants capable of eliciting an immune response only when coupled to a carrier. Haptens bind to antibodies but by themselves cannot elicit an antibody response. [NIH] Headache: Pain in the cranial region that may occur as an isolated and benign symptom or as a manifestation of a wide variety of conditions including subarachnoid hemorrhage; craniocerebral trauma; central nervous system infections; intracranial hypertension; and other disorders. In general, recurrent headaches that are not associated with a primary disease process are referred to as headache disorders (e.g., migraine). [NIH] Headache Disorders: Common conditions characterized by persistent or recurrent headaches. Headache syndrome classification systems may be based on etiology (e.g., vascular headache, post-traumatic headaches, etc.), temporal pattern (e.g., cluster headache, paroxysmal hemicrania, etc.), and precipitating factors (e.g., cough headache). [NIH] Health Behavior: Behaviors expressed by individuals to protect, maintain or promote their health status. For example, proper diet, and appropriate exercise are activities perceived to influence health status. Life style is closely associated with health behavior and factors influencing life style are socioeconomic, educational, and cultural. [NIH] Health Status: The level of health of the individual, group, or population as subjectively assessed by the individual or by more objective measures. [NIH] Heart failure: Loss of pumping ability by the heart, often accompanied by fatigue, breathlessness, and excess fluid accumulation in body tissues. [NIH] Hematocrit: Measurement of the volume of packed red cells in a blood specimen by centrifugation. The procedure is performed using a tube with graduated markings or with automated blood cell counters. It is used as an indicator of erythrocyte status in disease. For example, anemia shows a low hematocrit, polycythemia, high values. [NIH] Hemodialysis: The use of a machine to clean wastes from the blood after the kidneys have
Dictionary 159
failed. The blood travels through tubes to a dialyzer, which removes wastes and extra fluid. The cleaned blood then flows through another set of tubes back into the body. [NIH] Hemoglobin: One of the fractions of glycosylated hemoglobin A1c. Glycosylated hemoglobin is formed when linkages of glucose and related monosaccharides bind to hemoglobin A and its concentration represents the average blood glucose level over the previous several weeks. HbA1c levels are used as a measure of long-term control of plasma glucose (normal, 4 to 6 percent). In controlled diabetes mellitus, the concentration of glycosylated hemoglobin A is within the normal range, but in uncontrolled cases the level may be 3 to 4 times the normal conentration. Generally, complications are substantially lower among patients with Hb levels of 7 percent or less than in patients with HbA1c levels of 9 percent or more. [NIH] Hemoglobin A: Normal adult human hemoglobin. The globin moiety consists of two alpha and two beta chains. [NIH] Hemolysins: Substances, usually of biological origin, that destroy blood cells; they may be antibodies or other immunologic factors, toxins, enzymes, etc.; hemotoxins are toxic to blood in general, including the clotting mechanism; hematotoxins may refer to the hematopoietic system. [NIH] Hemolytic: A disease that affects the blood and blood vessels. It destroys red blood cells, cells that cause the blood to clot, and the lining of blood vessels. HUS is often caused by the Escherichia coli bacterium in contaminated food. People with HUS may develop acute renal failure. [NIH] Hemorrhage: Bleeding or escape of blood from a vessel. [NIH] Hepatitis: Inflammation of the liver and liver disease involving degenerative or necrotic alterations of hepatocytes. [NIH] Hepatobiliary: Pertaining to the liver and the bile or the biliary ducts. [EU] Hepatocytes: The main structural component of the liver. They are specialized epithelial cells that are organized into interconnected plates called lobules. [NIH] Hepatomegaly: Enlargement of the liver. [NIH] Heredity: 1. The genetic transmission of a particular quality or trait from parent to offspring. 2. The genetic constitution of an individual. [EU] Herpes: Any inflammatory skin disease caused by a herpesvirus and characterized by the formation of clusters of small vesicles. When used alone, the term may refer to herpes simplex or to herpes zoster. [EU] Herpes Zoster: Acute vesicular inflammation. [NIH] Heterogeneity: The property of one or more samples or populations which implies that they are not identical in respect of some or all of their parameters, e. g. heterogeneity of variance. [NIH]
Histamine: 1H-Imidazole-4-ethanamine. A depressor amine derived by enzymatic decarboxylation of histidine. It is a powerful stimulant of gastric secretion, a constrictor of bronchial smooth muscle, a vasodilator, and also a centrally acting neurotransmitter. [NIH] Histidine: An essential amino acid important in a number of metabolic processes. It is required for the production of histamine. [NIH] Histocompatibility: The degree of antigenic similarity between the tissues of different individuals, which determines the acceptance or rejection of allografts. [NIH] Hoarseness: An unnaturally deep or rough quality of voice. [NIH] Homogeneous: Consisting of or composed of similar elements or ingredients; of a uniform
160 Toxic Shock Syndrome
quality throughout. [EU] Homologous: Corresponding in structure, position, origin, etc., as (a) the feathers of a bird and the scales of a fish, (b) antigen and its specific antibody, (c) allelic chromosomes. [EU] Hormone: A substance in the body that regulates certain organs. Hormones such as gastrin help in breaking down food. Some hormones come from cells in the stomach and small intestine. [NIH] Horseradish Peroxidase: An enzyme isolated from horseradish which is able to act as an antigen. It is frequently used as a histochemical tracer for light and electron microscopy. Its antigenicity has permitted its use as a combined antigen and marker in experimental immunology. [NIH] Host: Any animal that receives a transplanted graft. [NIH] Humoral: Of, relating to, proceeding from, or involving a bodily humour - now often used of endocrine factors as opposed to neural or somatic. [EU] Humour: 1. A normal functioning fluid or semifluid of the body (as the blood, lymph or bile) especially of vertebrates. 2. A secretion that is itself an excitant of activity (as certain hormones). [EU] Hybrid: Cross fertilization between two varieties or, more usually, two species of vines, see also crossing. [NIH] Hybridization: The genetic process of crossbreeding to produce a hybrid. Hybrid nucleic acids can be formed by nucleic acid hybridization of DNA and RNA molecules. Protein hybridization allows for hybrid proteins to be formed from polypeptide chains. [NIH] Hydrogen: The first chemical element in the periodic table. It has the atomic symbol H, atomic number 1, and atomic weight 1. It exists, under normal conditions, as a colorless, odorless, tasteless, diatomic gas. Hydrogen ions are protons. Besides the common H1 isotope, hydrogen exists as the stable isotope deuterium and the unstable, radioactive isotope tritium. [NIH] Hydrolysis: The process of cleaving a chemical compound by the addition of a molecule of water. [NIH] Hydroxylysine: A hydroxylated derivative of the amino acid lysine that is present in certain collagens. [NIH] Hydroxyproline: A hydroxylated form of the imino acid proline. A deficiency in ascorbic acid can result in impaired hydroxyproline formation. [NIH] Hygienic: Pertaining to hygiene, or conducive to health. [EU] Hyperalgesia: Excessive sensitiveness or sensibility to pain. [EU] Hyperbaric: Characterized by greater than normal pressure or weight; applied to gases under greater than atmospheric pressure, as hyperbaric oxygen, or to a solution of greater specific gravity than another taken as a standard of reference. [EU] Hyperbaric oxygen: Oxygen that is at an atmospheric pressure higher than the pressure at sea level. Breathing hyperbaric oxygen to enhance the effectiveness of radiation therapy is being studied. [NIH] Hypersensitivity: Altered reactivity to an antigen, which can result in pathologic reactions upon subsequent exposure to that particular antigen. [NIH] Hypertension: Persistently high arterial blood pressure. Currently accepted threshold levels are 140 mm Hg systolic and 90 mm Hg diastolic pressure. [NIH] Hypoglycemia: Abnormally low blood sugar [NIH]
Dictionary 161
Hypotension: Abnormally low blood pressure. [NIH] Hysterectomy: Excision of the uterus. [NIH] Id: The part of the personality structure which harbors the unconscious instinctive desires and strivings of the individual. [NIH] Immune response: The activity of the immune system against foreign substances (antigens). [NIH]
Immune Sera: Serum that contains antibodies. It is obtained from an animal that has been immunized either by antigen injection or infection with microorganisms containing the antigen. [NIH] Immune system: The organs, cells, and molecules responsible for the recognition and disposal of foreign ("non-self") material which enters the body. [NIH] Immunity: Nonsusceptibility to the invasive or pathogenic microorganisms or to the toxic effect of antigenic substances. [NIH]
effects
of
foreign
Immunization: Deliberate stimulation of the host's immune response. Active immunization involves administration of antigens or immunologic adjuvants. Passive immunization involves administration of immune sera or lymphocytes or their extracts (e.g., transfer factor, immune RNA) or transplantation of immunocompetent cell producing tissue (thymus or bone marrow). [NIH] Immunoassay: Immunochemical assay or detection of a substance by serologic or immunologic methods. Usually the substance being studied serves as antigen both in antibody production and in measurement of antibody by the test substance. [NIH] Immunocompromised: Having a weakened immune system caused by certain diseases or treatments. [NIH] Immunodeficiency: The decreased ability of the body to fight infection and disease. [NIH] Immunogenic: Producing immunity; evoking an immune response. [EU] Immunoglobulin: A protein that acts as an antibody. [NIH] Immunologic: The ability of the antibody-forming system to recall a previous experience with an antigen and to respond to a second exposure with the prompt production of large amounts of antibody. [NIH] Immunologic Factors: Biologically active substances whose activities affect or play a role in the functioning of the immune system. [NIH] Immunology: The study of the body's immune system. [NIH] Immunotherapy: Manipulation of the host's immune system in treatment of disease. It includes both active and passive immunization as well as immunosuppressive therapy to prevent graft rejection. [NIH] Impairment: In the context of health experience, an impairment is any loss or abnormality of psychological, physiological, or anatomical structure or function. [NIH] In situ: In the natural or normal place; confined to the site of origin without invasion of neighbouring tissues. [EU] In vitro: In the laboratory (outside the body). The opposite of in vivo (in the body). [NIH] In vivo: In the body. The opposite of in vitro (outside the body or in the laboratory). [NIH] Incision: A cut made in the body during surgery. [NIH] Incubated: Grown in the laboratory under controlled conditions. (For instance, white blood cells can be grown in special conditions so that they attack specific cancer cells when returned to the body.) [NIH]
162 Toxic Shock Syndrome
Indicative: That indicates; that points out more or less exactly; that reveals fairly clearly. [EU] Induction: The act or process of inducing or causing to occur, especially the production of a specific morphogenetic effect in the developing embryo through the influence of evocators or organizers, or the production of anaesthesia or unconsciousness by use of appropriate agents. [EU] Infarction: A pathological process consisting of a sudden insufficient blood supply to an area, which results in necrosis of that area. It is usually caused by a thrombus, an embolus, or a vascular torsion. [NIH] Infection: 1. Invasion and multiplication of microorganisms in body tissues, which may be clinically unapparent or result in local cellular injury due to competitive metabolism, toxins, intracellular replication, or antigen-antibody response. The infection may remain localized, subclinical, and temporary if the body's defensive mechanisms are effective. A local infection may persist and spread by extension to become an acute, subacute, or chronic clinical infection or disease state. A local infection may also become systemic when the microorganisms gain access to the lymphatic or vascular system. 2. An infectious disease. [EU]
Infectious Mononucleosis: A common, acute infection usually caused by the Epstein-Barr virus (Human herpesvirus 4). There is an increase in mononuclear white blood cells and other atypical lymphocytes, generalized lymphadenopathy, splenomegaly, and occasionally hepatomegaly with hepatitis. [NIH] Infiltration: The diffusion or accumulation in a tissue or cells of substances not normal to it or in amounts of the normal. Also, the material so accumulated. [EU] Inflammation: A pathological process characterized by injury or destruction of tissues caused by a variety of cytologic and chemical reactions. It is usually manifested by typical signs of pain, heat, redness, swelling, and loss of function. [NIH] Inflammatory bowel disease: A general term that refers to the inflammation of the colon and rectum. Inflammatory bowel disease includes ulcerative colitis and Crohn's disease. [NIH]
Influenza: An acute viral infection involving the respiratory tract. It is marked by inflammation of the nasal mucosa, the pharynx, and conjunctiva, and by headache and severe, often generalized, myalgia. [NIH] Infusion: A method of putting fluids, including drugs, into the bloodstream. Also called intravenous infusion. [NIH] Ingestion: Taking into the body by mouth [NIH] Inhalation: The drawing of air or other substances into the lungs. [EU] Initiation: Mutation induced by a chemical reactive substance causing cell changes; being a step in a carcinogenic process. [NIH] Inoculum: The spores or tissues of a pathogen that serve to initiate disease in a plant. [NIH] Inorganic: Pertaining to substances not of organic origin. [EU] Insulin: A protein hormone secreted by beta cells of the pancreas. Insulin plays a major role in the regulation of glucose metabolism, generally promoting the cellular utilization of glucose. It is also an important regulator of protein and lipid metabolism. Insulin is used as a drug to control insulin-dependent diabetes mellitus. [NIH] Insulin-dependent diabetes mellitus: A disease characterized by high levels of blood glucose resulting from defects in insulin secretion, insulin action, or both. Autoimmune, genetic, and environmental factors are involved in the development of type I diabetes. [NIH] Intensive Care: Advanced and highly specialized care provided to medical or surgical
Dictionary 163
patients whose conditions are life-threatening and require comprehensive care and constant monitoring. It is usually administered in specially equipped units of a health care facility. [NIH]
Interleukin-1: A soluble factor produced by monocytes, macrophages, and other cells which activates T-lymphocytes and potentiates their response to mitogens or antigens. IL-1 consists of two distinct forms, IL-1 alpha and IL-1 beta which perform the same functions but are distinct proteins. The biological effects of IL-1 include the ability to replace macrophage requirements for T-cell activation. The factor is distinct from interleukin-2. [NIH] Interleukin-10: Factor that is a coregulator of mast cell growth. It is produced by T-cells and B-cells and shows extensive homology with the Epstein-Barr virus BCRFI gene. [NIH] Interleukin-2: Chemical mediator produced by activated T lymphocytes and which regulates the proliferation of T cells, as well as playing a role in the regulation of NK cell activity. [NIH] Interleukin-4: Soluble factor produced by activated T-lymphocytes that causes proliferation and differentiation of B-cells. Interleukin-4 induces the expression of class II major histocompatibility complex and Fc receptors on B-cells. It also acts on T-lymphocytes, mast cell lines, and several other hematopoietic lineage cells including granulocyte, megakaryocyte, and erythroid precursors, as well as macrophages. [NIH] Interleukin-8: A cytokine that activates neutrophils and attracts neutrophils and Tlymphocytes. It is released by several cell types including monocytes, macrophages, Tlymphocytes, fibroblasts, endothelial cells, and keratinocytes by an inflammatory stimulus. IL-8 is a member of the beta-thromboglobulin superfamily and structurally related to platelet factor 4. [NIH] Intermittent: Occurring at separated intervals; having periods of cessation of activity. [EU] Interstitial: Pertaining to or situated between parts or in the interspaces of a tissue. [EU] Intestinal: Having to do with the intestines. [NIH] Intestine: A long, tube-shaped organ in the abdomen that completes the process of digestion. There is both a large intestine and a small intestine. Also called the bowel. [NIH] Intracellular: Inside a cell. [NIH] Intraocular: Within the eye. [EU] Intraocular pressure: Pressure of the fluid inside the eye; normal IOP varies among individuals. [NIH] Intravascular: Within a vessel or vessels. [EU] Intravenous: IV. Into a vein. [NIH] Intrinsic: Situated entirely within or pertaining exclusively to a part. [EU] Invasive: 1. Having the quality of invasiveness. 2. Involving puncture or incision of the skin or insertion of an instrument or foreign material into the body; said of diagnostic techniques. [EU]
Iodine: A nonmetallic element of the halogen group that is represented by the atomic symbol I, atomic number 53, and atomic weight of 126.90. It is a nutritionally essential element, especially important in thyroid hormone synthesis. In solution, it has anti-infective properties and is used topically. [NIH] Ions: An atom or group of atoms that have a positive or negative electric charge due to a gain (negative charge) or loss (positive charge) of one or more electrons. Atoms with a positive charge are known as cations; those with a negative charge are anions. [NIH] Ischemia: Deficiency of blood in a part, due to functional constriction or actual obstruction
164 Toxic Shock Syndrome
of a blood vessel. [EU] Joint: The point of contact between elements of an animal skeleton with the parts that surround and support it. [NIH] Kb: A measure of the length of DNA fragments, 1 Kb = 1000 base pairs. The largest DNA fragments are up to 50 kilobases long. [NIH] Keratin: A class of fibrous proteins or scleroproteins important both as structural proteins and as keys to the study of protein conformation. The family represents the principal constituent of epidermis, hair, nails, horny tissues, and the organic matrix of tooth enamel. Two major conformational groups have been characterized, alpha-keratin, whose peptide backbone forms an alpha-helix, and beta-keratin, whose backbone forms a zigzag or pleated sheet structure. [NIH] Keratinocytes: Epidermal cells which synthesize keratin and undergo characteristic changes as they move upward from the basal layers of the epidermis to the cornified (horny) layer of the skin. Successive stages of differentiation of the keratinocytes forming the epidermal layers are basal cell, spinous or prickle cell, and the granular cell. [NIH] Kinetic: Pertaining to or producing motion. [EU] Labile: 1. Gliding; moving from point to point over the surface; unstable; fluctuating. 2. Chemically unstable. [EU] Laceration: 1. The act of tearing. 2. A torn, ragged, mangled wound. [EU] Large Intestine: The part of the intestine that goes from the cecum to the rectum. The large intestine absorbs water from stool and changes it from a liquid to a solid form. The large intestine is 5 feet long and includes the appendix, cecum, colon, and rectum. Also called colon. [NIH] Laxative: An agent that acts to promote evacuation of the bowel; a cathartic or purgative. [EU]
Lectins: Protein or glycoprotein substances, usually of plant origin, that bind to sugar moieties in cell walls or membranes and thereby change the physiology of the membrane to cause agglutination, mitosis, or other biochemical changes in the cell. [NIH] Lens: The transparent, double convex (outward curve on both sides) structure suspended between the aqueous and vitreous; helps to focus light on the retina. [NIH] Leprosy: A chronic granulomatous infection caused by Mycobacterium leprae. The granulomatous lesions are manifested in the skin, the mucous membranes, and the peripheral nerves. Two polar or principal types are lepromatous and tuberculoid. [NIH] Lesion: An area of abnormal tissue change. [NIH] Lethal: Deadly, fatal. [EU] Leukocytes: White blood cells. These include granular leukocytes (basophils, eosinophils, and neutrophils) as well as non-granular leukocytes (lymphocytes and monocytes). [NIH] Library Services: Services offered to the library user. They include reference and circulation. [NIH]
Life cycle: The successive stages through which an organism passes from fertilized ovum or spore to the fertilized ovum or spore of the next generation. [NIH] Ligaments: Shiny, flexible bands of fibrous tissue connecting together articular extremities of bones. They are pliant, tough, and inextensile. [NIH] Ligands: A RNA simulation method developed by the MIT. [NIH] Lincomycin: (2S-trans)-Methyl 6,8-dideoxy-6-(((1-methyl-4-propyl-2pyrrolidinyl)carbonyl)amino)-1-thio-D-erythro-alpha-D-galacto-octopyranoside. An
Dictionary 165
antibiotic produced by Streptomyces lincolnensis var. lincolnensis. It has been used in the treatment of staphylococcal, streptococcal, and Bacteroides fragilis infections. [NIH] Linkage: The tendency of two or more genes in the same chromosome to remain together from one generation to the next more frequently than expected according to the law of independent assortment. [NIH] Lip: Either of the two fleshy, full-blooded margins of the mouth. [NIH] Lipase: An enzyme of the hydrolase class that catalyzes the reaction of triacylglycerol and water to yield diacylglycerol and a fatty acid anion. It is produced by glands on the tongue and by the pancreas and initiates the digestion of dietary fats. (From Dorland, 27th ed) EC 3.1.1.3. [NIH] Lipectomy: Removal of localized subcutaneous fat deposits by suction curettage or blunt cannulization in the cosmetic correction of obesity and other esthetic contour defects. [NIH] Lipid: Fat. [NIH] Lipopolysaccharide: Substance consisting of polysaccaride and lipid. [NIH] Lipoprotein: Any of the lipid-protein complexes in which lipids are transported in the blood; lipoprotein particles consist of a spherical hydrophobic core of triglycerides or cholesterol esters surrounded by an amphipathic monolayer of phospholipids, cholesterol, and apolipoproteins; the four principal classes are high-density, low-density, and very-lowdensity lipoproteins and chylomicrons. [EU] Liver: A large, glandular organ located in the upper abdomen. The liver cleanses the blood and aids in digestion by secreting bile. [NIH] Localization: The process of determining or marking the location or site of a lesion or disease. May also refer to the process of keeping a lesion or disease in a specific location or site. [NIH] Localized: Cancer which has not metastasized yet. [NIH] Lubricants: Oily or slippery substances. [NIH] Lumbar: Pertaining to the loins, the part of the back between the thorax and the pelvis. [EU] Lupus: A form of cutaneous tuberculosis. It is seen predominantly in women and typically involves the nasal, buccal, and conjunctival mucosa. [NIH] Lyme Disease: An infectious disease caused by a spirochete, Borrelia burgdorferi, which is transmitted chiefly by Ixodes dammini and pacificus ticks in the United States and Ixodes ricinis in Europe. It is a disease with early and late cutaneous manifestations plus involvement of the nervous system, heart, eye, and joints in variable combinations. The disease was formerly known as Lyme arthritis and first discovered at Old Lyme, Connecticut. [NIH] Lymph: The almost colorless fluid that travels through the lymphatic system and carries cells that help fight infection and disease. [NIH] Lymph node: A rounded mass of lymphatic tissue that is surrounded by a capsule of connective tissue. Also known as a lymph gland. Lymph nodes are spread out along lymphatic vessels and contain many lymphocytes, which filter the lymphatic fluid (lymph). [NIH]
Lymphadenopathy: Disease or swelling of the lymph nodes. [NIH] Lymphatic: The tissues and organs, including the bone marrow, spleen, thymus, and lymph nodes, that produce and store cells that fight infection and disease. [NIH] Lymphatic system: The tissues and organs that produce, store, and carry white blood cells that fight infection and other diseases. This system includes the bone marrow, spleen,
166 Toxic Shock Syndrome
thymus, lymph nodes and a network of thin tubes that carry lymph and white blood cells. These tubes branch, like blood vessels, into all the tissues of the body. [NIH] Lymphocyte: A white blood cell. Lymphocytes have a number of roles in the immune system, including the production of antibodies and other substances that fight infection and diseases. [NIH] Lymphoid: Referring to lymphocytes, a type of white blood cell. Also refers to tissue in which lymphocytes develop. [NIH] Lymphokines: Soluble protein factors generated by activated lymphocytes that affect other cells, primarily those involved in cellular immunity. [NIH] Lymphoproliferative: Disorders characterized by proliferation of lymphoid tissue, general or unspecified. [NIH] Lytic: 1. Pertaining to lysis or to a lysin. 2. Producing lysis. [EU] Macrophage: A type of white blood cell that surrounds and kills microorganisms, removes dead cells, and stimulates the action of other immune system cells. [NIH] Macrophage Activation: The process of altering the morphology and functional activity of macrophages so that they become avidly phagocytic. It is initiated by lymphokines, such as the macrophage activation factor (MAF) and the macrophage migration-inhibitory factor (MMIF), immune complexes, C3b, and various peptides, polysaccharides, and immunologic adjuvants. [NIH] Maculopapular: Both macular and papular, as an eruption consisting of both macules and papules; sometimes erroneously used to designate a papule that is only slightly elevated. [EU]
Major Histocompatibility Complex: The genetic region which contains the loci of genes which determine the structure of the serologically defined (SD) and lymphocyte-defined (LD) transplantation antigens, genes which control the structure of the immune responseassociated (Ia) antigens, the immune response (Ir) genes which control the ability of an animal to respond immunologically to antigenic stimuli, and genes which determine the structure and/or level of the first four components of complement. [NIH] Malignancy: A cancerous tumor that can invade and destroy nearby tissue and spread to other parts of the body. [NIH] Malignant: Cancerous; a growth with a tendency to invade and destroy nearby tissue and spread to other parts of the body. [NIH] Malignant tumor: A tumor capable of metastasizing. [NIH] Malnutrition: A condition caused by not eating enough food or not eating a balanced diet. [NIH]
Mammary: Pertaining to the mamma, or breast. [EU] Manifest: Being the part or aspect of a phenomenon that is directly observable : concretely expressed in behaviour. [EU] Man-made: Ionizing radiation emitted by artificial or concentrated natural, radioactive material or resulting from the operation of high voltage apparatus, such as X-ray apparatus or particle accelerators, of nuclear reactors, or from nuclear explosions. [NIH] Mastitis: Inflammatory disease of the breast, or mammary gland. [NIH] Mediate: Indirect; accomplished by the aid of an intervening medium. [EU] Mediator: An object or substance by which something is mediated, such as (1) a structure of the nervous system that transmits impulses eliciting a specific response; (2) a chemical substance (transmitter substance) that induces activity in an excitable tissue, such as nerve
Dictionary 167
or muscle; or (3) a substance released from cells as the result of the interaction of antigen with antibody or by the action of antigen with a sensitized lymphocyte. [EU] Medicament: A medicinal substance or agent. [EU] MEDLINE: An online database of MEDLARS, the computerized bibliographic Medical Literature Analysis and Retrieval System of the National Library of Medicine. [NIH] Melanin: The substance that gives the skin its color. [NIH] Membrane: A very thin layer of tissue that covers a surface. [NIH] Meninges: The three membranes that cover and protect the brain and spinal cord. [NIH] Meningitis: Inflammation of the meninges. When it affects the dura mater, the disease is termed pachymeningitis; when the arachnoid and pia mater are involved, it is called leptomeningitis, or meningitis proper. [EU] Menstruation: The normal physiologic discharge through the vagina of blood and mucosal tissues from the nonpregnant uterus. [NIH] Mental Health: The state wherein the person is well adjusted. [NIH] Mercury: A silver metallic element that exists as a liquid at room temperature. It has the atomic symbol Hg (from hydrargyrum, liquid silver), atomic number 80, and atomic weight 200.59. Mercury is used in many industrial applications and its salts have been employed therapeutically as purgatives, antisyphilitics, disinfectants, and astringents. It can be absorbed through the skin and mucous membranes which leads to mercury poisoning. Because of its toxicity, the clinical use of mercury and mercurials is diminishing. [NIH] Methicillin Resistance: Non-susceptibility of a microbe to the action of methicillin, a semisynthetic penicillin derivative. [NIH] MI: Myocardial infarction. Gross necrosis of the myocardium as a result of interruption of the blood supply to the area; it is almost always caused by atherosclerosis of the coronary arteries, upon which coronary thrombosis is usually superimposed. [NIH] Microbe: An organism which cannot be observed with the naked eye; e. g. unicellular animals, lower algae, lower fungi, bacteria. [NIH] Microbiological: Pertaining to microbiology : the science that deals with microorganisms, including algae, bacteria, fungi, protozoa and viruses. [EU] Microbiology: The study of microorganisms such as fungi, bacteria, algae, archaea, and viruses. [NIH] Microorganism: An organism that can be seen only through a microscope. Microorganisms include bacteria, protozoa, algae, and fungi. Although viruses are not considered living organisms, they are sometimes classified as microorganisms. [NIH] Micro-organism: An organism which cannot be observed with the naked eye; e. g. unicellular animals, lower algae, lower fungi, bacteria. [NIH] Microscopy: The application of microscope magnification to the study of materials that cannot be properly seen by the unaided eye. [NIH] Migration: The systematic movement of genes between populations of the same species, geographic race, or variety. [NIH] Mitochondrial Swelling: Increase in volume of mitochondria due to an influx of fluid; it occurs in hypotonic solutions due to osmotic pressure and in isotonic solutions as a result of altered permeability of the membranes of respiring mitochondria. [NIH] Mitosis: A method of indirect cell division by means of which the two daughter nuclei normally receive identical complements of the number of chromosomes of the somatic cells
168 Toxic Shock Syndrome
of the species. [NIH] Modification: A change in an organism, or in a process in an organism, that is acquired from its own activity or environment. [NIH] Molecular: Of, pertaining to, or composed of molecules : a very small mass of matter. [EU] Molecule: A chemical made up of two or more atoms. The atoms in a molecule can be the same (an oxygen molecule has two oxygen atoms) or different (a water molecule has two hydrogen atoms and one oxygen atom). Biological molecules, such as proteins and DNA, can be made up of many thousands of atoms. [NIH] Monitor: An apparatus which automatically records such physiological signs as respiration, pulse, and blood pressure in an anesthetized patient or one undergoing surgical or other procedures. [NIH] Monoclonal: An antibody produced by culturing a single type of cell. It therefore consists of a single species of immunoglobulin molecules. [NIH] Monoclonal antibodies: Laboratory-produced substances that can locate and bind to cancer cells wherever they are in the body. Many monoclonal antibodies are used in cancer detection or therapy; each one recognizes a different protein on certain cancer cells. Monoclonal antibodies can be used alone, or they can be used to deliver drugs, toxins, or radioactive material directly to a tumor. [NIH] Monocyte: A type of white blood cell. [NIH] Monokines: Soluble mediators of the immune response that are neither antibodies nor complement. They are produced largely, but not exclusively, by monocytes and macrophages. [NIH] Mononuclear: A cell with one nucleus. [NIH] Morphological: Relating to the configuration or the structure of live organs. [NIH] Morphology: The science of the form and structure of organisms (plants, animals, and other forms of life). [NIH] Motility: The ability to move spontaneously. [EU] Mucosa: A mucous membrane, or tunica mucosa. [EU] Mucus: The viscous secretion of mucous membranes. It contains mucin, white blood cells, water, inorganic salts, and exfoliated cells. [NIH] Multidrug resistance: Adaptation of tumor cells to anticancer drugs in ways that make the drugs less effective. [NIH] Multiple Myeloma: A malignant tumor of plasma cells usually arising in the bone marrow; characterized by diffuse involvement of the skeletal system, hyperglobulinemia, Bence-Jones proteinuria, and anemia. [NIH] Muscle Contraction: A process leading to shortening and/or development of tension in muscle tissue. Muscle contraction occurs by a sliding filament mechanism whereby actin filaments slide inward among the myosin filaments. [NIH] Musculoskeletal System: Themuscles, bones, and cartilage of the body. [NIH] Myalgia: Pain in a muscle or muscles. [EU] Mycoplasma: A genus of gram-negative, facultatively anaerobic bacteria bounded by a plasma membrane only. Its organisms are parasites and pathogens, found on the mucous membranes of humans, animals, and birds. [NIH] Myelin: The fatty substance that covers and protects nerves. [NIH] Myocardial Reperfusion: Generally, restoration of blood supply to heart tissue which is
Dictionary 169
ischemic due to decrease in normal blood supply. The decrease may result from any source including atherosclerotic obstruction, narrowing of the artery, or surgical clamping. Reperfusion can be induced to treat ischemia. Methods include chemical dissolution of an occluding thrombus, administration of vasodilator drugs, angioplasty, catheterization, and artery bypass graft surgery. However, it is thought that reperfusion can itself further damage the ischemic tissue, causing myocardial reperfusion injury. [NIH] Myocardial Reperfusion Injury: Functional, metabolic, or structural changes in ischemic heart muscle thought to result from reperfusion to the ischemic areas. Changes can be fatal to muscle cells and may include edema with explosive cell swelling and disintegration, sarcolemma disruption, fragmentation of mitochondria, contraction band necrosis, enzyme washout, and calcium overload. Other damage may include hemorrhage and ventricular arrhythmias. One possible mechanism of damage is thought to be oxygen free radicals. Treatment currently includes the introduction of scavengers of oxygen free radicals, and injury is thought to be prevented by warm blood cardioplegic infusion prior to reperfusion. [NIH]
Myocarditis: Inflammation of the myocardium; inflammation of the muscular walls of the heart. [EU] Myocardium: The muscle tissue of the heart composed of striated, involuntary muscle known as cardiac muscle. [NIH] Myosin: Chief protein in muscle and the main constituent of the thick filaments of muscle fibers. In conjunction with actin, it is responsible for the contraction and relaxation of muscles. [NIH] Myositis: Inflammation of a voluntary muscle. [EU] Nasal Mucosa: The mucous membrane lining the nasal cavity. [NIH] Necrosis: A pathological process caused by the progressive degradative action of enzymes that is generally associated with severe cellular trauma. It is characterized by mitochondrial swelling, nuclear flocculation, uncontrolled cell lysis, and ultimately cell death. [NIH] Need: A state of tension or dissatisfaction felt by an individual that impels him to action toward a goal he believes will satisfy the impulse. [NIH] Neonatal: Pertaining to the first four weeks after birth. [EU] Neonatal period: The first 4 weeks after birth. [NIH] Neoplasia: Abnormal and uncontrolled cell growth. [NIH] Neoplasm: A new growth of benign or malignant tissue. [NIH] Neoplastic: Pertaining to or like a neoplasm (= any new and abnormal growth); pertaining to neoplasia (= the formation of a neoplasm). [EU] Nephritis: Inflammation of the kidney; a focal or diffuse proliferative or destructive process which may involve the glomerulus, tubule, or interstitial renal tissue. [EU] Nerve: A cordlike structure of nervous tissue that connects parts of the nervous system with other tissues of the body and conveys nervous impulses to, or away from, these tissues. [NIH] Nervous System: The entire nerve apparatus composed of the brain, spinal cord, nerves and ganglia. [NIH] Neural: 1. Pertaining to a nerve or to the nerves. 2. Situated in the region of the spinal axis, as the neutral arch. [EU] Neurons: The basic cellular units of nervous tissue. Each neuron consists of a body, an axon, and dendrites. Their purpose is to receive, conduct, and transmit impulses in the nervous system. [NIH]
170 Toxic Shock Syndrome
Neuroretinitis: Inflammation of the optic nerve head and adjacent retina. [NIH] Neutralization: An act or process of neutralizing. [EU] Neutrons: Electrically neutral elementary particles found in all atomic nuclei except light hydrogen; the mass is equal to that of the proton and electron combined and they are unstable when isolated from the nucleus, undergoing beta decay. Slow, thermal, epithermal, and fast neutrons refer to the energy levels with which the neutrons are ejected from heavier nuclei during their decay. [NIH] Neutropenia: An abnormal decrease in the number of neutrophils, a type of white blood cell. [NIH] Neutrophil: A type of white blood cell. [NIH] Niacin: Water-soluble vitamin of the B complex occurring in various animal and plant tissues. Required by the body for the formation of coenzymes NAD and NADP. Has pellagra-curative, vasodilating, and antilipemic properties. [NIH] Nitric Oxide: A free radical gas produced endogenously by a variety of mammalian cells. It is synthesized from arginine by a complex reaction, catalyzed by nitric oxide synthase. Nitric oxide is endothelium-derived relaxing factor. It is released by the vascular endothelium and mediates the relaxation induced by some vasodilators such as acetylcholine and bradykinin. It also inhibits platelet aggregation, induces disaggregation of aggregated platelets, and inhibits platelet adhesion to the vascular endothelium. Nitric oxide activates cytosolic guanylate cyclase and thus elevates intracellular levels of cyclic GMP. [NIH]
Nitrogen: An element with the atomic symbol N, atomic number 7, and atomic weight 14. Nitrogen exists as a diatomic gas and makes up about 78% of the earth's atmosphere by volume. It is a constituent of proteins and nucleic acids and found in all living cells. [NIH] Nonoxynol: Nonionic surfactant mixtures varying in the number of repeating ethoxy (oxy1,2-ethanediyl) groups. They are used as detergents, emulsifiers, wetting agents, defoaming agents, etc. Nonoxynol-9, the compound with 9 repeating ethoxy groups, is a spermatocide, formulated primarily as a component of vaginal foams and creams. [NIH] Norepinephrine: Precursor of epinephrine that is secreted by the adrenal medulla and is a widespread central and autonomic neurotransmitter. Norepinephrine is the principal transmitter of most postganglionic sympathetic fibers and of the diffuse projection system in the brain arising from the locus ceruleus. It is also found in plants and is used pharmacologically as a sympathomimetic. [NIH] Nuclear: A test of the structure, blood flow, and function of the kidneys. The doctor injects a mildly radioactive solution into an arm vein and uses x-rays to monitor its progress through the kidneys. [NIH] Nuclei: A body of specialized protoplasm found in nearly all cells and containing the chromosomes. [NIH] Nucleic acid: Either of two types of macromolecule (DNA or RNA) formed by polymerization of nucleotides. Nucleic acids are found in all living cells and contain the information (genetic code) for the transfer of genetic information from one generation to the next. [NIH] Nucleic Acid Hybridization: The process whereby two single-stranded polynucleotides form a double-stranded molecule, with hydrogen bonding between the complementary bases in the two strains. [NIH] Nucleus: A body of specialized protoplasm found in nearly all cells and containing the chromosomes. [NIH]
Dictionary 171
Observational study: An epidemiologic study that does not involve any intervention, experimental or otherwise. Such a study may be one in which nature is allowed to take its course, with changes in one characteristic being studied in relation to changes in other characteristics. Analytical epidemiologic methods, such as case-control and cohort study designs, are properly called observational epidemiology because the investigator is observing without intervention other than to record, classify, count, and statistically analyze results. [NIH] Ocular: 1. Of, pertaining to, or affecting the eye. 2. Eyepiece. [EU] Ocular Hypertension: A condition in which the intraocular pressure is elevated above normal and which may lead to glaucoma. [NIH] Opacity: Degree of density (area most dense taken for reading). [NIH] Open Reading Frames: Reading frames where successive nucleotide triplets can be read as codons specifying amino acids and where the sequence of these triplets is not interrupted by stop codons. [NIH] Ophthalmology: A surgical specialty concerned with the structure and function of the eye and the medical and surgical treatment of its defects and diseases. [NIH] Opportunistic Infections: An infection caused by an organism which becomes pathogenic under certain conditions, e.g., during immunosuppression. [NIH] Optic Nerve: The 2nd cranial nerve. The optic nerve conveys visual information from the retina to the brain. The nerve carries the axons of the retinal ganglion cells which sort at the optic chiasm and continue via the optic tracts to the brain. The largest projection is to the lateral geniculate nuclei; other important targets include the superior colliculi and the suprachiasmatic nuclei. Though known as the second cranial nerve, it is considered part of the central nervous system. [NIH] Orthopaedic: Pertaining to the correction of deformities of the musculoskeletal system; pertaining to orthopaedics. [EU] Osteoarthritis: A progressive, degenerative joint disease, the most common form of arthritis, especially in older persons. The disease is thought to result not from the aging process but from biochemical changes and biomechanical stresses affecting articular cartilage. In the foreign literature it is often called osteoarthrosis deformans. [NIH] Osteomyelitis: Inflammation of bone caused by a pyogenic organism. It may remain localized or may spread through the bone to involve the marrow, cortex, cancellous tissue, and periosteum. [EU] Ovary: Either of the paired glands in the female that produce the female germ cells and secrete some of the female sex hormones. [NIH] Pachymeningitis: Inflammation of the dura mater of the brain, the spinal cord or the optic nerve. [NIH] Palliative: 1. Affording relief, but not cure. 2. An alleviating medicine. [EU] Pancreas: A mixed exocrine and endocrine gland situated transversely across the posterior abdominal wall in the epigastric and hypochondriac regions. The endocrine portion is comprised of the Islets of Langerhans, while the exocrine portion is a compound acinar gland that secretes digestive enzymes. [NIH] Pancreatic: Having to do with the pancreas. [NIH] Pancreatitis: Acute or chronic inflammation of the pancreas, which may be asymptomatic or symptomatic, and which is due to autodigestion of a pancreatic tissue by its own enzymes. It is caused most often by alcoholism or biliary tract disease; less commonly it may be
172 Toxic Shock Syndrome
associated with hyperlipaemia, hyperparathyroidism, abdominal trauma (accidental or operative injury), vasculitis, or uraemia. [EU] Papilloma: A benign epithelial neoplasm which may arise from the skin, mucous membranes or glandular ducts. [NIH] Papule: A small circumscribed, superficial, solid elevation of the skin. [EU] Parasitic: Having to do with or being a parasite. A parasite is an animal or a plant that lives on or in an organism of another species and gets at least some of its nutrients from it. [NIH] Pathogen: Any disease-producing microorganism. [EU] Pathogenesis: The cellular events and reactions that occur in the development of disease. [NIH]
Pathologic: 1. Indicative of or caused by a morbid condition. 2. Pertaining to pathology (= branch of medicine that treats the essential nature of the disease, especially the structural and functional changes in tissues and organs of the body caused by the disease). [EU] Pathologic Processes: The abnormal mechanisms and forms involved in the dysfunctions of tissues and organs. [NIH] Penicillin: An antibiotic drug used to treat infection. [NIH] Penis: The external reproductive organ of males. It is composed of a mass of erectile tissue enclosed in three cylindrical fibrous compartments. Two of the three compartments, the corpus cavernosa, are placed side-by-side along the upper part of the organ. The third compartment below, the corpus spongiosum, houses the urethra. [NIH] Peptide: Any compound consisting of two or more amino acids, the building blocks of proteins. Peptides are combined to make proteins. [NIH] Peptide T: N-(N-(N(2)-(N-(N-(N-(N-D-Alanyl L-seryl)-L-threonyl)-L-threonyl) L-threonyl)L-asparaginyl)-L-tyrosyl) L-threonine. Octapeptide sharing sequence homology with HIV envelope protein gp120. It is potentially useful as antiviral agent in AIDS therapy. The core pentapeptide sequence, TTNYT, consisting of amino acids 4-8 in peptide T, is the HIV envelope sequence required for attachment to the CD4 receptor. [NIH] Perceived risk: Estimate or evaluation of risk as observed through personal experience or personal study, and personal evaluation of consequences. [NIH] Pericardium: The fibroserous sac surrounding the heart and the roots of the great vessels. [NIH]
Perinatal: Pertaining to or occurring in the period shortly before and after birth; variously defined as beginning with completion of the twentieth to twenty-eighth week of gestation and ending 7 to 28 days after birth. [EU] Perineal: Pertaining to the perineum. [EU] Perineum: The area between the anus and the sex organs. [NIH] Peripheral blood: Blood circulating throughout the body. [NIH] Peripheral Nerves: The nerves outside of the brain and spinal cord, including the autonomic, cranial, and spinal nerves. Peripheral nerves contain non-neuronal cells and connective tissue as well as axons. The connective tissue layers include, from the outside to the inside, the epineurium, the perineurium, and the endoneurium. [NIH] Peritoneal: Having to do with the peritoneum (the tissue that lines the abdominal wall and covers most of the organs in the abdomen). [NIH] Peritoneal Cavity: The space enclosed by the peritoneum. It is divided into two portions, the greater sac and the lesser sac or omental bursa, which lies behind the stomach. The two sacs are connected by the foramen of Winslow, or epiploic foramen. [NIH]
Dictionary 173
Peritoneum: Endothelial lining of the abdominal cavity, the parietal peritoneum covering the inside of the abdominal wall and the visceral peritoneum covering the bowel, the mesentery, and certain of the organs. The portion that covers the bowel becomes the serosal layer of the bowel wall. [NIH] Peritonitis: Inflammation of the peritoneum; a condition marked by exudations in the peritoneum of serum, fibrin, cells, and pus. It is attended by abdominal pain and tenderness, constipation, vomiting, and moderate fever. [EU] Phagocytosis: The engulfing of microorganisms, other cells, and foreign particles by phagocytic cells. [NIH] Phallic: Pertaining to the phallus, or penis. [EU] Pharmaceutical Preparations: Drugs intended for human or veterinary use, presented in their finished dosage form. Included here are materials used in the preparation and/or formulation of the finished dosage form. [NIH] Pharmacologic: Pertaining to pharmacology or to the properties and reactions of drugs. [EU] Pharyngitis: Inflammation of the throat. [NIH] Pharynx: The hollow tube about 5 inches long that starts behind the nose and ends at the top of the trachea (windpipe) and esophagus (the tube that goes to the stomach). [NIH] Phenylalanine: An aromatic amino acid that is essential in the animal diet. It is a precursor of melanin, dopamine, noradrenalin, and thyroxine. [NIH] Pheromone: A substance secreted externally by certain animal species, especially insects, to affect the behavior or development of other members of the species. [NIH] Phosphodiesterase: Effector enzyme that regulates the levels of a second messenger, the cyclic GMP. [NIH] Phosphorus: A non-metallic element that is found in the blood, muscles, nevers, bones, and teeth, and is a component of adenosine triphosphate (ATP; the primary energy source for the body's cells.) [NIH] Phosphorylation: The introduction of a phosphoryl group into a compound through the formation of an ester bond between the compound and a phosphorus moiety. [NIH] Phosphorylcholine: Calcium and magnesium salts used therapeutically in hepatobiliary dysfunction. [NIH] Photocoagulation: Using a special strong beam of light (laser) to seal off bleeding blood vessels such as in the eye. The laser can also burn away blood vessels that should not have grown in the eye. This is the main treatment for diabetic retinopathy. [NIH] Physical Examination: Systematic and thorough inspection of the patient for physical signs of disease or abnormality. [NIH] Physiologic: Having to do with the functions of the body. When used in the phrase "physiologic age," it refers to an age assigned by general health, as opposed to calendar age. [NIH]
Physiology: The science that deals with the life processes and functions of organismus, their cells, tissues, and organs. [NIH] Plants: Multicellular, eukaryotic life forms of the kingdom Plantae. They are characterized by a mainly photosynthetic mode of nutrition; essentially unlimited growth at localized regions of cell divisions (meristems); cellulose within cells providing rigidity; the absence of organs of locomotion; absense of nervous and sensory systems; and an alteration of haploid and diploid generations. [NIH] Plaque: A clear zone in a bacterial culture grown on an agar plate caused by localized
174 Toxic Shock Syndrome
destruction of bacterial cells by a bacteriophage. The concentration of infective virus in a fluid can be estimated by applying the fluid to a culture and counting the number of. [NIH] Plasma: The clear, yellowish, fluid part of the blood that carries the blood cells. The proteins that form blood clots are in plasma. [NIH] Plasma cells: A type of white blood cell that produces antibodies. [NIH] Plasmin: A product of the lysis of plasminogen (profibrinolysin) by plasminogen activators. It is composed of two polypeptide chains, light (B) and heavy (A), with a molecular weight of 75,000. It is the major proteolytic enzyme involved in blood clot retraction or the lysis of fibrin and quickly inactivated by antiplasmins. EC 3.4.21.7. [NIH] Plasminogen: Precursor of fibrinolysin (plasmin). It is a single-chain beta-globulin of molecular weight 80-90,000 found mostly in association with fibrinogen in plasma; plasminogen activators change it to fibrinolysin. It is used in wound debriding and has been investigated as a thrombolytic agent. [NIH] Plasminogen Activators: A heterogeneous group of proteolytic enzymes that convert plasminogen to plasmin. They are concentrated in the lysosomes of most cells and in the vascular endothelium, particularly in the vessels of the microcirculation. EC 3.4.21.-. [NIH] Platelet Aggregation: The attachment of platelets to one another. This clumping together can be induced by a number of agents (e.g., thrombin, collagen) and is part of the mechanism leading to the formation of a thrombus. [NIH] Platelet Factor 4: A high-molecular-weight proteoglycan-platelet factor complex which is released from blood platelets by thrombin. It acts as a mediator in the heparin-neutralizing capacity of the blood and plays a role in platelet aggregation. At high ionic strength (I=0.75), the complex dissociates into the active component (molecular weight 29,000) and the proteoglycan carrier (chondroitin 4-sulfate, molecular weight 350,000). The molecule exists in the form of a dimer consisting of 8 moles of platelet factor 4 and 2 moles of proteoglycan. [NIH]
Platelets: A type of blood cell that helps prevent bleeding by causing blood clots to form. Also called thrombocytes. [NIH] Poisoning: A condition or physical state produced by the ingestion, injection or inhalation of, or exposure to a deleterious agent. [NIH] Polyarteritis Nodosa: A form of necrotizing vasculitis involving small- and medium-sized arteries. The signs and symptoms result from infarction and scarring of the affected organ system. [NIH] Polyethylene: A vinyl polymer made from ethylene. It can be branched or linear. Branched or low-density polyethylene is tough and pliable but not to the same degree as linear polyethylene. Linear or high-density polyethylene has a greater hardness and tensile strength. Polyethylene is used in a variety of products, including implants and prostheses. [NIH]
Polymerase: An enzyme which catalyses the synthesis of DNA using a single DNA strand as a template. The polymerase copies the template in the 5'-3'direction provided that sufficient quantities of free nucleotides, dATP and dTTP are present. [NIH] Polymerase Chain Reaction: In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation
Dictionary 175
analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships. [NIH] Polypeptide: A peptide which on hydrolysis yields more than two amino acids; called tripeptides, tetrapeptides, etc. according to the number of amino acids contained. [EU] Polysaccharide: A type of carbohydrate. It contains sugar molecules that are linked together chemically. [NIH] Posterior: Situated in back of, or in the back part of, or affecting the back or dorsal surface of the body. In lower animals, it refers to the caudal end of the body. [EU] Postoperative: After surgery. [NIH] Potentiates: A degree of synergism which causes the exposure of the organism to a harmful substance to worsen a disease already contracted. [NIH] Practice Guidelines: Directions or principles presenting current or future rules of policy for the health care practitioner to assist him in patient care decisions regarding diagnosis, therapy, or related clinical circumstances. The guidelines may be developed by government agencies at any level, institutions, professional societies, governing boards, or by the convening of expert panels. The guidelines form a basis for the evaluation of all aspects of health care and delivery. [NIH] Precursor: Something that precedes. In biological processes, a substance from which another, usually more active or mature substance is formed. In clinical medicine, a sign or symptom that heralds another. [EU] Prednisolone: A glucocorticoid with the general properties of the corticosteroids. It is the drug of choice for all conditions in which routine systemic corticosteroid therapy is indicated, except adrenal deficiency states. [NIH] Prednisone: A synthetic anti-inflammatory glucocorticoid derived from cortisone. It is biologically inert and converted to prednisolone in the liver. [NIH] Prenatal: Existing or occurring before birth, with reference to the fetus. [EU] Prevalence: The total number of cases of a given disease in a specified population at a designated time. It is differentiated from incidence, which refers to the number of new cases in the population at a given time. [NIH] Prickle: Several layers of the epidermis where the individual cells are connected by cell bridges. [NIH] Progesterone: Pregn-4-ene-3,20-dione. The principal progestational hormone of the body, secreted by the corpus luteum, adrenal cortex, and placenta. Its chief function is to prepare the uterus for the reception and development of the fertilized ovum. It acts as an antiovulatory agent when administered on days 5-25 of the menstrual cycle. [NIH] Progression: Increase in the size of a tumor or spread of cancer in the body. [NIH] Progressive: Advancing; going forward; going from bad to worse; increasing in scope or severity. [EU] Proline: A non-essential amino acid that is synthesized from glutamic acid. It is an essential component of collagen and is important for proper functioning of joints and tendons. [NIH] Prophylaxis: An attempt to prevent disease. [NIH] Proportional: Being in proportion : corresponding in size, degree, or intensity, having the same or a constant ratio; of, relating to, or used in determining proportions. [EU] Prostaglandin: Any of a group of components derived from unsaturated 20-carbon fatty acids, primarily arachidonic acid, via the cyclooxygenase pathway that are extremely potent mediators of a diverse group of physiologic processes. The abbreviation for prostaglandin is PG; specific compounds are designated by adding one of the letters A through I to indicate
176 Toxic Shock Syndrome
the type of substituents found on the hydrocarbon skeleton and a subscript (1, 2 or 3) to indicate the number of double bonds in the hydrocarbon skeleton e.g., PGE2. The predominant naturally occurring prostaglandins all have two double bonds and are synthesized from arachidonic acid (5,8,11,14-eicosatetraenoic acid) by the pathway shown in the illustration. The 1 series and 3 series are produced by the same pathway with fatty acids having one fewer double bond (8,11,14-eicosatrienoic acid or one more double bond (5,8,11,14,17-eicosapentaenoic acid) than arachidonic acid. The subscript a or ß indicates the configuration at C-9 (a denotes a substituent below the plane of the ring, ß, above the plane). The naturally occurring PGF's have the a configuration, e.g., PGF2a. All of the prostaglandins act by binding to specific cell-surface receptors causing an increase in the level of the intracellular second messenger cyclic AMP (and in some cases cyclic GMP also). The effect produced by the cyclic AMP increase depends on the specific cell type. In some cases there is also a positive feedback effect. Increased cyclic AMP increases prostaglandin synthesis leading to further increases in cyclic AMP. [EU] Prostaglandins A: (13E,15S)-15-Hydroxy-9-oxoprosta-10,13-dien-1-oic acid (PGA(1)); (5Z,13E,15S)-15-hydroxy-9-oxoprosta-5,10,13-trien-1-oic acid (PGA(2)); (5Z,13E,15S,17Z)-15hydroxy-9-oxoprosta-5,10,13,17-tetraen-1-oic acid (PGA(3)). A group of naturally occurring secondary prostaglandins derived from PGE. PGA(1) and PGA(2) as well as their 19hydroxy derivatives are found in many organs and tissues. [NIH] Prosthesis: An artificial replacement of a part of the body. [NIH] Protease: Proteinase (= any enzyme that catalyses the splitting of interior peptide bonds in a protein). [EU] Protein C: A vitamin-K dependent zymogen present in the blood, which, upon activation by thrombin and thrombomodulin exerts anticoagulant properties by inactivating factors Va and VIIIa at the rate-limiting steps of thrombin formation. [NIH] Protein Conformation: The characteristic 3-dimensional shape of a protein, including the secondary, supersecondary (motifs), tertiary (domains) and quaternary structure of the peptide chain. Quaternary protein structure describes the conformation assumed by multimeric proteins (aggregates of more than one polypeptide chain). [NIH] Protein S: The vitamin K-dependent cofactor of activated protein C. Together with protein C, it inhibits the action of factors VIIIa and Va. A deficiency in protein S can lead to recurrent venous and arterial thrombosis. [NIH] Proteins: Polymers of amino acids linked by peptide bonds. The specific sequence of amino acids determines the shape and function of the protein. [NIH] Proteinuria: The presence of protein in the urine, indicating that the kidneys are not working properly. [NIH] Proteolytic: 1. Pertaining to, characterized by, or promoting proteolysis. 2. An enzyme that promotes proteolysis (= the splitting of proteins by hydrolysis of the peptide bonds with formation of smaller polypeptides). [EU] Protons: Stable elementary particles having the smallest known positive charge, found in the nuclei of all elements. The proton mass is less than that of a neutron. A proton is the nucleus of the light hydrogen atom, i.e., the hydrogen ion. [NIH] Protozoa: A subkingdom consisting of unicellular organisms that are the simplest in the animal kingdom. Most are free living. They range in size from submicroscopic to macroscopic. Protozoa are divided into seven phyla: Sarcomastigophora, Labyrinthomorpha, Apicomplexa, Microspora, Ascetospora, Myxozoa, and Ciliophora. [NIH] Pruritic: Pertaining to or characterized by pruritus. [EU]
Dictionary 177
Psoriasis: A common genetically determined, chronic, inflammatory skin disease characterized by rounded erythematous, dry, scaling patches. The lesions have a predilection for nails, scalp, genitalia, extensor surfaces, and the lumbosacral region. Accelerated epidermopoiesis is considered to be the fundamental pathologic feature in psoriasis. [NIH] Psychiatry: The medical science that deals with the origin, diagnosis, prevention, and treatment of mental disorders. [NIH] Public Health: Branch of medicine concerned with the prevention and control of disease and disability, and the promotion of physical and mental health of the population on the international, national, state, or municipal level. [NIH] Public Policy: A course or method of action selected, usually by a government, from among alternatives to guide and determine present and future decisions. [NIH] Publishing: "The business or profession of the commercial production and issuance of literature" (Webster's 3d). It includes the publisher, publication processes, editing and editors. Production may be by conventional printing methods or by electronic publishing. [NIH]
Pulmonary: Relating to the lungs. [NIH] Pulmonary Artery: The short wide vessel arising from the conus arteriosus of the right ventricle and conveying unaerated blood to the lungs. [NIH] Pulmonary Emphysema: Condition of the lungs characterized by increase beyond normal in the size of air spaces distal to the terminal bronchioles, either from dilatation of the alveoli or from destruction of their walls. [NIH] Pulse: The rhythmical expansion and contraction of an artery produced by waves of pressure caused by the ejection of blood from the left ventricle of the heart as it contracts. [NIH]
Purpura: Purplish or brownish red discoloration, easily visible through the epidermis, caused by hemorrhage into the tissues. [NIH] Purulent: Consisting of or containing pus; associated with the formation of or caused by pus. [EU] Pustular: Pertaining to or of the nature of a pustule; consisting of pustules (= a visible collection of pus within or beneath the epidermis). [EU] Putrefaction: The process of decomposition of animal and vegetable matter by living organisms. [NIH] Pyogenic: Producing pus; pyopoietic (= liquid inflammation product made up of cells and a thin fluid called liquor puris). [EU] Pyrogenic: Inducing fever. [EU] Quinoxaline: AMPA/Kainate antagonist. [NIH] Radiation: Emission or propagation of electromagnetic energy (waves/rays), or the waves/rays themselves; a stream of electromagnetic particles (electrons, neutrons, protons, alpha particles) or a mixture of these. The most common source is the sun. [NIH] Radiation therapy: The use of high-energy radiation from x-rays, gamma rays, neutrons, and other sources to kill cancer cells and shrink tumors. Radiation may come from a machine outside the body (external-beam radiation therapy), or it may come from radioactive material placed in the body in the area near cancer cells (internal radiation therapy, implant radiation, or brachytherapy). Systemic radiation therapy uses a radioactive substance, such as a radiolabeled monoclonal antibody, that circulates throughout the body. Also called radiotherapy. [NIH]
178 Toxic Shock Syndrome
Radioactive: Giving off radiation. [NIH] Randomized: Describes an experiment or clinical trial in which animal or human subjects are assigned by chance to separate groups that compare different treatments. [NIH] Rape: Unlawful sexual intercourse without consent of the victim. [NIH] Receptor: A molecule inside or on the surface of a cell that binds to a specific substance and causes a specific physiologic effect in the cell. [NIH] Recombinant: A cell or an individual with a new combination of genes not found together in either parent; usually applied to linked genes. [EU] Rectal: By or having to do with the rectum. The rectum is the last 8 to 10 inches of the large intestine and ends at the anus. [NIH] Rectum: The last 8 to 10 inches of the large intestine. [NIH] Red blood cells: RBCs. Cells that carry oxygen to all parts of the body. Also called erythrocytes. [NIH] Refer: To send or direct for treatment, aid, information, de decision. [NIH] Refraction: A test to determine the best eyeglasses or contact lenses to correct a refractive error (myopia, hyperopia, or astigmatism). [NIH] Regimen: A treatment plan that specifies the dosage, the schedule, and the duration of treatment. [NIH] Renal failure: Progressive renal insufficiency and uremia, due to irreversible and progressive renal glomerular tubular or interstitial disease. [NIH] Reperfusion: Restoration of blood supply to tissue which is ischemic due to decrease in normal blood supply. The decrease may result from any source including atherosclerotic obstruction, narrowing of the artery, or surgical clamping. It is primarily a procedure for treating infarction or other ischemia, by enabling viable ischemic tissue to recover, thus limiting further necrosis. However, it is thought that reperfusion can itself further damage the ischemic tissue, causing reperfusion injury. [NIH] Reperfusion Injury: Functional, metabolic, or structural changes, including necrosis, in ischemic tissues thought to result from reperfusion to ischemic areas of the tissue. The most common instance is myocardial reperfusion injury. [NIH] Research Design: A plan for collecting and utilizing data so that desired information can be obtained with sufficient precision or so that an hypothesis can be tested properly. [NIH] Resection: Removal of tissue or part or all of an organ by surgery. [NIH] Respiration: The act of breathing with the lungs, consisting of inspiration, or the taking into the lungs of the ambient air, and of expiration, or the expelling of the modified air which contains more carbon dioxide than the air taken in (Blakiston's Gould Medical Dictionary, 4th ed.). This does not include tissue respiration (= oxygen consumption) or cell respiration (= cell respiration). [NIH] Respiratory distress syndrome: A lung disease that occurs primarily in premature infants; the newborn must struggle for each breath and blueing of its skin reflects the baby's inability to get enough oxygen. [NIH] Respiratory syncytial virus: RSV. A virus that causes respiratory infections with cold-like symptoms. [NIH] Restoration: Broad term applied to any inlay, crown, bridge or complete denture which restores or replaces loss of teeth or oral tissues. [NIH] Retina: The ten-layered nervous tissue membrane of the eye. It is continuous with the optic
Dictionary 179
nerve and receives images of external objects and transmits visual impulses to the brain. Its outer surface is in contact with the choroid and the inner surface with the vitreous body. The outer-most layer is pigmented, whereas the inner nine layers are transparent. [NIH] Retinitis: Inflammation of the retina. It is rarely limited to the retina, but is commonly associated with diseases of the choroid (chorioretinitis) and of the optic nerve (neuroretinitis). The disease may be confined to one eye, but since it is generally dependent on a constitutional factor, it is almost always bilateral. It may be acute in course, but as a rule it lasts many weeks or even several months. [NIH] Rheumatic Heart Disease: Disease of the heart resulting from rheumatic fever and characterized by inflammatory changes in the myocardium or scarring of the valves. [NIH] Rheumatism: A group of disorders marked by inflammation or pain in the connective tissue structures of the body. These structures include bone, cartilage, and fat. [NIH] Rheumatoid: Resembling rheumatism. [EU] Rheumatoid arthritis: A form of arthritis, the cause of which is unknown, although infection, hypersensitivity, hormone imbalance and psychologic stress have been suggested as possible causes. [NIH] Rhinitis: Inflammation of the mucous membrane of the nose. [NIH] Ribose: A pentose active in biological systems usually in its D-form. [NIH] Rickettsiae: One of a group of obligate intracellular parasitic microorganisms, once regarded as intermediate in their properties between bacteria and viruses but now classified as bacteria in the order Rickettsiales, which includes 17 genera and 3 families: Rickettsiace. [NIH]
Rod: A reception for vision, located in the retina. [NIH] Rubber: A high-molecular-weight polymeric elastomer derived from the milk juice (latex) of Hevea brasiliensis and other trees. It is a substance that can be stretched at room temperature to atleast twice its original length and after releasing the stress, retractrapidly, and recover its original dimensions fully. Synthetic rubber is made from many different chemicals, including styrene, acrylonitrile, ethylene, propylene, and isoprene. [NIH] Saline: A solution of salt and water. [NIH] Sanitary: Relating or belonging to health and hygiene; conductive to the restoration or maintenance of health. [NIH] Saponins: Sapogenin glycosides. A type of glycoside widely distributed in plants. Each consists of a sapogenin as the aglycon moiety, and a sugar. The sapogenin may be a steroid or a triterpene and the sugar may be glucose, galactose, a pentose, or a methylpentose. Sapogenins are poisonous towards the lower forms of life and are powerful hemolytics when injected into the blood stream able to dissolve red blood cells at even extreme dilutions. [NIH] Saturate: Means fatty acids without double bond. [NIH] Scabies: A contagious cutaneous inflammation caused by the bite of the mite Sarcoptes scabiei. It is characterized by pruritic papular eruptions and burrows and affects primarily the axillae, elbows, wrists, and genitalia, although it can spread to cover the entire body. [NIH]
Scarlet Fever: Infection with group A streptococci that is characterized by tonsillitis and pharyngitis. An erythematous rash is commonly present. [NIH] Sclera: The tough white outer coat of the eyeball, covering approximately the posterior fivesixths of its surface, and continuous anteriorly with the cornea and posteriorly with the external sheath of the optic nerve. [EU]
180 Toxic Shock Syndrome
Scleroderma: A chronic disorder marked by hardening and thickening of the skin. Scleroderma can be localized or it can affect the entire body (systemic). [NIH] Screening: Checking for disease when there are no symptoms. [NIH] Scrotum: In males, the external sac that contains the testicles. [NIH] Secretion: 1. The process of elaborating a specific product as a result of the activity of a gland; this activity may range from separating a specific substance of the blood to the elaboration of a new chemical substance. 2. Any substance produced by secretion. [EU] Semen: The thick, yellowish-white, viscid fluid secretion of male reproductive organs discharged upon ejaculation. In addition to reproductive organ secretions, it contains spermatozoa and their nutrient plasma. [NIH] Semisynthetic: Produced by chemical manipulation of naturally occurring substances. [EU] Sensibility: The ability to receive, feel and appreciate sensations and impressions; the quality of being sensitive; the extend to which a method gives results that are free from false negatives. [NIH] Sensitization: 1. Administration of antigen to induce a primary immune response; priming; immunization. 2. Exposure to allergen that results in the development of hypersensitivity. 3. The coating of erythrocytes with antibody so that they are subject to lysis by complement in the presence of homologous antigen, the first stage of a complement fixation test. [EU] Sepsis: The presence of bacteria in the bloodstream. [NIH] Septic: Produced by or due to decomposition by microorganisms; putrefactive. [EU] Septicaemia: A term originally used to denote a putrefactive process in the body, but now usually referring to infection with pyogenic micro-organisms; a genus of Diptera; the severe type of infection in which the blood stream is invaded by large numbers of the causal. [NIH] Sequence Homology: The degree of similarity between sequences. Studies of amino acid and nucleotide sequences provide useful information about the genetic relatedness of certain species. [NIH] Sequencing: The determination of the order of nucleotides in a DNA or RNA chain. [NIH] Serotonin: A biochemical messenger and regulator, synthesized from the essential amino acid L-tryptophan. In humans it is found primarily in the central nervous system, gastrointestinal tract, and blood platelets. Serotonin mediates several important physiological functions including neurotransmission, gastrointestinal motility, hemostasis, and cardiovascular integrity. Multiple receptor families (receptors, serotonin) explain the broad physiological actions and distribution of this biochemical mediator. [NIH] Serotypes: A cause of haemorrhagic septicaemia (in cattle, sheep and pigs), fowl cholera of birds, pasteurellosis of rabbits, and gangrenous mastitis of ewes. It is also commonly found in atrophic rhinitis of pigs. [NIH] Serum: The clear liquid part of the blood that remains after blood cells and clotting proteins have been removed. [NIH] Sexually Transmitted Diseases: Diseases due to or propagated by sexual contact. [NIH] Shedding: Release of infectious particles (e. g., bacteria, viruses) into the environment, for example by sneezing, by fecal excretion, or from an open lesion. [NIH] Shock: The general bodily disturbance following a severe injury; an emotional or moral upset occasioned by some disturbing or unexpected experience; disruption of the circulation, which can upset all body functions: sometimes referred to as circulatory shock. [NIH]
Side effect: A consequence other than the one(s) for which an agent or measure is used, as
Dictionary 181
the adverse effects produced by a drug, especially on a tissue or organ system other than the one sought to be benefited by its administration. [EU] Sigma Factor: A protein which is a subunit of RNA polymerase. It effects initiation of specific RNA chains from DNA. [NIH] Signs and Symptoms: Clinical manifestations that can be either objective when observed by a physician, or subjective when perceived by the patient. [NIH] Skeletal: Having to do with the skeleton (boney part of the body). [NIH] Skeleton: The framework that supports the soft tissues of vertebrate animals and protects many of their internal organs. The skeletons of vertebrates are made of bone and/or cartilage. [NIH] Skin graft: Skin that is moved from one part of the body to another. [NIH] Small intestine: The part of the digestive tract that is located between the stomach and the large intestine. [NIH] Smooth muscle: Muscle that performs automatic tasks, such as constricting blood vessels. [NIH]
Sodium: An element that is a member of the alkali group of metals. It has the atomic symbol Na, atomic number 11, and atomic weight 23. With a valence of 1, it has a strong affinity for oxygen and other nonmetallic elements. Sodium provides the chief cation of the extracellular body fluids. Its salts are the most widely used in medicine. (From Dorland, 27th ed) Physiologically the sodium ion plays a major role in blood pressure regulation, maintenance of fluid volume, and electrolyte balance. [NIH] Soft tissue: Refers to muscle, fat, fibrous tissue, blood vessels, or other supporting tissue of the body. [NIH] Solid tumor: Cancer of body tissues other than blood, bone marrow, or the lymphatic system. [NIH] Solvent: 1. Dissolving; effecting a solution. 2. A liquid that dissolves or that is capable of dissolving; the component of a solution that is present in greater amount. [EU] Somatic: 1. Pertaining to or characteristic of the soma or body. 2. Pertaining to the body wall in contrast to the viscera. [EU] Specialist: In medicine, one who concentrates on 1 special branch of medical science. [NIH] Species: A taxonomic category subordinate to a genus (or subgenus) and superior to a subspecies or variety, composed of individuals possessing common characters distinguishing them from other categories of individuals of the same taxonomic level. In taxonomic nomenclature, species are designated by the genus name followed by a Latin or Latinized adjective or noun. [EU] Specificity: Degree of selectivity shown by an antibody with respect to the number and types of antigens with which the antibody combines, as well as with respect to the rates and the extents of these reactions. [NIH] Spectrum: A charted band of wavelengths of electromagnetic vibrations obtained by refraction and diffraction. By extension, a measurable range of activity, such as the range of bacteria affected by an antibiotic (antibacterial s.) or the complete range of manifestations of a disease. [EU] Spermatozoa: Mature male germ cells that develop in the seminiferous tubules of the testes. Each consists of a head, a body, and a tail that provides propulsion. The head consists mainly of chromatin. [NIH] Spermicide: An agent that is destructive to spermatozoa. [EU]
182 Toxic Shock Syndrome
Spinal cord: The main trunk or bundle of nerves running down the spine through holes in the spinal bone (the vertebrae) from the brain to the level of the lower back. [NIH] Spinous: Like a spine or thorn in shape; having spines. [NIH] Spirochete: Lyme disease. [NIH] Splenomegaly: Enlargement of the spleen. [NIH] Spores: The reproductive elements of lower organisms, such as protozoa, fungi, and cryptogamic plants. [NIH] Stabilizer: A device for maintaining constant X-ray tube voltage or current. [NIH] Staphylococcal Infections: Infections with bacteria of the genus Staphylococcus. [NIH] Staphylococcal Scalded Skin Syndrome: A disease of infants due to group 2 phage type 17 staphylococci that produce an epidermolytic exotoxin. Superficial fine vesicles and bullae form and rupture easily, resulting in loss of large sheets of epidermis. [NIH] Stents: Devices that provide support for tubular structures that are being anastomosed or for body cavities during skin grafting. [NIH] Sterility: 1. The inability to produce offspring, i.e., the inability to conceive (female s.) or to induce conception (male s.). 2. The state of being aseptic, or free from microorganisms. [EU] Steroid: A group name for lipids that contain a hydrogenated cyclopentanoperhydrophenanthrene ring system. Some of the substances included in this group are progesterone, adrenocortical hormones, the gonadal hormones, cardiac aglycones, bile acids, sterols (such as cholesterol), toad poisons, saponins, and some of the carcinogenic hydrocarbons. [EU] Stimulus: That which can elicit or evoke action (response) in a muscle, nerve, gland or other excitable issue, or cause an augmenting action upon any function or metabolic process. [NIH] Stomach: An organ of digestion situated in the left upper quadrant of the abdomen between the termination of the esophagus and the beginning of the duodenum. [NIH] Strand: DNA normally exists in the bacterial nucleus in a helix, in which two strands are coiled together. [NIH] Streptococcal: Caused by infection due to any species of streptococcus. [NIH] Streptococcal Infections: Infections with bacteria of the genus Streptococcus. [NIH] Streptococci: A genus of spherical Gram-positive bacteria occurring in chains or pairs. They are widely distributed in nature, being important pathogens but often found as normal commensals in the mouth, skin, and intestine of humans and other animals. [NIH] Streptococcus: A genus of gram-positive, coccoid bacteria whose organisms occur in pairs or chains. No endospores are produced. Many species exist as commensals or parasites on man or animals with some being highly pathogenic. A few species are saprophytes and occur in the natural environment. [NIH] Stress: Forcibly exerted influence; pressure. Any condition or situation that causes strain or tension. Stress may be either physical or psychologic, or both. [NIH] Stridor: The loud, harsh, vibrating sound produced by partial obstruction of the larynx or trachea. [NIH] Stroke: Sudden loss of function of part of the brain because of loss of blood flow. Stroke may be caused by a clot (thrombosis) or rupture (hemorrhage) of a blood vessel to the brain. [NIH] Styrene: A colorless, toxic liquid with a strong aromatic odor. It is used to make rubbers, polymers and copolymers, and polystyrene plastics. [NIH] Subacute: Somewhat acute; between acute and chronic. [EU]
Dictionary 183
Subarachnoid: Situated or occurring between the arachnoid and the pia mater. [EU] Subclinical: Without clinical manifestations; said of the early stage(s) of an infection or other disease or abnormality before symptoms and signs become apparent or detectable by clinical examination or laboratory tests, or of a very mild form of an infection or other disease or abnormality. [EU] Subcutaneous: Beneath the skin. [NIH] Subspecies: A category intermediate in rank between species and variety, based on a smaller number of correlated characters than are used to differentiate species and generally conditioned by geographical and/or ecological occurrence. [NIH] Substance P: An eleven-amino acid neurotransmitter that appears in both the central and peripheral nervous systems. It is involved in transmission of pain, causes rapid contractions of the gastrointestinal smooth muscle, and modulates inflammatory and immune responses. [NIH]
Substrate: A substance upon which an enzyme acts. [EU] Suction: The removal of secretions, gas or fluid from hollow or tubular organs or cavities by means of a tube and a device that acts on negative pressure. [NIH] Sunburn: An injury to the skin causing erythema, tenderness, and sometimes blistering and resulting from excessive exposure to the sun. The reaction is produced by the ultraviolet radiation in sunlight. [NIH] Superantigens: Microbial antigens that have in common an extremely potent activating effect on T-cells that bear a specific variable region. Superantigens cross-link the variable region with class II MHC proteins regardless of the peptide binding in the T-cell receptor's pocket. The result is a transient expansion and subsequent death and anergy of the T-cells with the appropriate variable regions. [NIH] Suppositories: A small cone-shaped medicament having cocoa butter or gelatin at its basis and usually intended for the treatment of local conditions in the rectum. [NIH] Suppression: A conscious exclusion of disapproved desire contrary with repression, in which the process of exclusion is not conscious. [NIH] Suppurative: Consisting of, containing, associated with, or identified by the formation of pus. [NIH] Surfactant: A fat-containing protein in the respiratory passages which reduces the surface tension of pulmonary fluids and contributes to the elastic properties of pulmonary tissue. [NIH]
Surgical Sponges: Gauze material used to absorb body fluids during surgery. Referred to as gossypiboma if accidentally retained in the body following surgery. [NIH] Symptomatic: Having to do with symptoms, which are signs of a condition or disease. [NIH] Synergistic: Acting together; enhancing the effect of another force or agent. [EU] Syphilis: A contagious venereal disease caused by the spirochete Treponema pallidum. [NIH]
Systemic: Affecting the entire body. [NIH] Systemic lupus erythematosus: SLE. A chronic inflammatory connective tissue disease marked by skin rashes, joint pain and swelling, inflammation of the kidneys, inflammation of the fibrous tissue surrounding the heart (i.e., the pericardium), as well as other problems. Not all affected individuals display all of these problems. May be referred to as lupus. [NIH] Systolic: Indicating the maximum arterial pressure during contraction of the left ventricle of the heart. [EU]
184 Toxic Shock Syndrome
Tachycardia: Excessive rapidity in the action of the heart, usually with a heart rate above 100 beats per minute. [NIH] Tachypnea: Rapid breathing. [NIH] Teichoic Acids: Bacterial polysaccharides that are rich in phosphodiester linkages. They are the major components of the cell walls and membranes of many bacteria. [NIH] Testicles: The two egg-shaped glands found inside the scrotum. They produce sperm and male hormones. Also called testes. [NIH] Testicular: Pertaining to a testis. [EU] Testis: Either of the paired male reproductive glands that produce the male germ cells and the male hormones. [NIH] Tetani: Causal agent of tetanus. [NIH] Tetanic: Having the characteristics of, or relating to tetanus. [NIH] Tetanus: A disease caused by tetanospasmin, a powerful protein toxin produced by Clostridium tetani. Tetanus usually occurs after an acute injury, such as a puncture wound or laceration. Generalized tetanus, the most common form, is characterized by tetanic muscular contractions and hyperreflexia. Localized tetanus presents itself as a mild condition with manifestations restricted to muscles near the wound. It may progress to the generalized form. [NIH] Therapeutics: The branch of medicine which is concerned with the treatment of diseases, palliative or curative. [NIH] Thermal: Pertaining to or characterized by heat. [EU] Thoracic: Having to do with the chest. [NIH] Thorax: A part of the trunk between the neck and the abdomen; the chest. [NIH] Threonine: An essential amino acid occurring naturally in the L-form, which is the active form. It is found in eggs, milk, gelatin, and other proteins. [NIH] Threshold: For a specified sensory modality (e. g. light, sound, vibration), the lowest level (absolute threshold) or smallest difference (difference threshold, difference limen) or intensity of the stimulus discernible in prescribed conditions of stimulation. [NIH] Thrombin: An enzyme formed from prothrombin that converts fibrinogen to fibrin. (Dorland, 27th ed) EC 3.4.21.5. [NIH] Thrombocytes: Blood cells that help prevent bleeding by causing blood clots to form. Also called platelets. [NIH] Thrombocytopenia: A decrease in the number of blood platelets. [NIH] Thrombolytic: 1. Dissolving or splitting up a thrombus. 2. A thrombolytic agent. [EU] Thrombomodulin: A cell surface glycoprotein of endothelial cells that binds thrombin and serves as a cofactor in the activation of protein C and its regulation of blood coagulation. [NIH]
Thrombophlebitis: Inflammation of a vein associated with thrombus formation. [NIH] Thrombosis: The formation or presence of a blood clot inside a blood vessel. [NIH] Thrombus: An aggregation of blood factors, primarily platelets and fibrin with entrapment of cellular elements, frequently causing vascular obstruction at the point of its formation. Some authorities thus differentiate thrombus formation from simple coagulation or clot formation. [EU] Thymus: An organ that is part of the lymphatic system, in which T lymphocytes grow and
Dictionary 185
multiply. The thymus is in the chest behind the breastbone. [NIH] Thyroid: A gland located near the windpipe (trachea) that produces thyroid hormone, which helps regulate growth and metabolism. [NIH] Ticks: Blood-sucking arachnids of the order Acarina. [NIH] Tissue: A group or layer of cells that are alike in type and work together to perform a specific function. [NIH] Tonsillitis: Inflammation of the tonsils, especially the palatine tonsils. It is often caused by a bacterium. Tonsillitis may be acute, chronic, or recurrent. [NIH] Topical: On the surface of the body. [NIH] Toxic: Having to do with poison or something harmful to the body. Toxic substances usually cause unwanted side effects. [NIH] Toxicity: The quality of being poisonous, especially the degree of virulence of a toxic microbe or of a poison. [EU] Toxicology: The science concerned with the detection, chemical composition, and pharmacologic action of toxic substances or poisons and the treatment and prevention of toxic manifestations. [NIH] Toxins: Specific, characterizable, poisonous chemicals, often proteins, with specific biological properties, including immunogenicity, produced by microbes, higher plants, or animals. [NIH] Toxoid: The material resulting from the treatment of toxin in such a way that the toxic properties are inactivated whilst the antigenic potency remains intact. [NIH] Trachea: The cartilaginous and membranous tube descending from the larynx and branching into the right and left main bronchi. [NIH] Tracheitis: Inflammation of the trachea. [EU] Transcription Factors: Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process. [NIH] Transfection: The uptake of naked or purified DNA into cells, usually eukaryotic. It is analogous to bacterial transformation. [NIH] Transfer Factor: Factor derived from leukocyte lysates of immune donors which can transfer both local and systemic cellular immunity to nonimmune recipients. [NIH] Translocation: The movement of material in solution inside the body of the plant. [NIH] Transmitter: A chemical substance which effects the passage of nerve impulses from one cell to the other at the synapse. [NIH] Transplantation: Transference of a tissue or organ, alive or dead, within an individual, between individuals of the same species, or between individuals of different species. [NIH] Trauma: Any injury, wound, or shock, must frequently physical or structural shock, producing a disturbance. [NIH] Trees: Woody, usually tall, perennial higher plants (Angiosperms, Gymnosperms, and some Pterophyta) having usually a main stem and numerous branches. [NIH] Trichomonas: A genus of parasitic flagellate protozoans distinguished by the presence of four anterior flagella, an undulating membrane, and a trailing flagellum. [NIH] Trisomy: The possession of a third chromosome of any one type in an otherwise diploid cell. [NIH]
Tryptophan: An essential amino acid that is necessary for normal growth in infants and for
186 Toxic Shock Syndrome
nitrogen balance in adults. It is a precursor serotonin and niacin. [NIH] Tuberculosis: Any of the infectious diseases of man and other animals caused by species of Mycobacterium. [NIH] Tumor Necrosis Factor: Serum glycoprotein produced by activated macrophages and other mammalian mononuclear leukocytes which has necrotizing activity against tumor cell lines and increases ability to reject tumor transplants. It mimics the action of endotoxin but differs from it. It has a molecular weight of less than 70,000 kDa. [NIH] Tumour: 1. Swelling, one of the cardinal signs of inflammations; morbid enlargement. 2. A new growth of tissue in which the multiplication of cells is uncontrolled and progressive; called also neoplasm. [EU] Typhoid fever: The most important member of the enteric group of fevers which also includes the paratyphoids. [NIH] Typhoid fever: The most important member of the enteric group of fevers which also includes the paratyphoids. [NIH] Tyrosine: A non-essential amino acid. In animals it is synthesized from phenylalanine. It is also the precursor of epinephrine, thyroid hormones, and melanin. [NIH] Ulcer: A localized necrotic lesion of the skin or a mucous surface. [NIH] Ulcerative colitis: Chronic inflammation of the colon that produces ulcers in its lining. This condition is marked by abdominal pain, cramps, and loose discharges of pus, blood, and mucus from the bowel. [NIH] Unconscious: Experience which was once conscious, but was subsequently rejected, as the "personal unconscious". [NIH] Uraemia: 1. An excess in the blood of urea, creatinine, and other nitrogenous end products of protein and amino acids metabolism; more correctly referred to as azotemia. 2. In current usage the entire constellation of signs and symptoms of chronic renal failure, including nausea, vomiting anorexia, a metallic taste in the mouth, a uraemic odour of the breath, pruritus, uraemic frost on the skin, neuromuscular disorders, pain and twitching in the muscles, hypertension, edema, mental confusion, and acid-base and electrolyte imbalances. [EU]
Uremia: The illness associated with the buildup of urea in the blood because the kidneys are not working effectively. Symptoms include nausea, vomiting, loss of appetite, weakness, and mental confusion. [NIH] Ureters: Tubes that carry urine from the kidneys to the bladder. [NIH] Urethra: The tube through which urine leaves the body. It empties urine from the bladder. [NIH]
Urinary: Having to do with urine or the organs of the body that produce and get rid of urine. [NIH] Urinary tract: The organs of the body that produce and discharge urine. These include the kidneys, ureters, bladder, and urethra. [NIH] Urine: Fluid containing water and waste products. Urine is made by the kidneys, stored in the bladder, and leaves the body through the urethra. [NIH] Urogenital: Pertaining to the urinary and genital apparatus; genitourinary. [EU] Urticaria: A vascular reaction of the skin characterized by erythema and wheal formation due to localized increase of vascular permeability. The causative mechanism may be allergy, infection, or stress. [NIH] Uterus: The small, hollow, pear-shaped organ in a woman's pelvis. This is the organ in
Dictionary 187
which a fetus develops. Also called the womb. [NIH] Uvea: The middle coat of the eyeball, consisting of the choroid in the back of the eye and the ciliary body and iris in the front of the eye. [NIH] Uveitis: An inflammation of part or all of the uvea, the middle (vascular) tunic of the eye, and commonly involving the other tunics (the sclera and cornea, and the retina). [EU] Vaccination: Administration of vaccines to stimulate the host's immune response. This includes any preparation intended for active immunological prophylaxis. [NIH] Vaccine: A substance or group of substances meant to cause the immune system to respond to a tumor or to microorganisms, such as bacteria or viruses. [NIH] Vagina: The muscular canal extending from the uterus to the exterior of the body. Also called the birth canal. [NIH] Vaginal: Of or having to do with the vagina, the birth canal. [NIH] Vaginitis: Inflammation of the vagina characterized by pain and a purulent discharge. [NIH] Valves: Flap-like structures that control the direction of blood flow through the heart. [NIH] Varicella: Chicken pox. [EU] Vascular: Pertaining to blood vessels or indicative of a copious blood supply. [EU] Vasculitis: Inflammation of a blood vessel. [NIH] Vasodilators: Any nerve or agent which induces dilatation of the blood vessels. [NIH] Vein: Vessel-carrying blood from various parts of the body to the heart. [NIH] Venereal: Pertaining or related to or transmitted by sexual contact. [EU] Venous: Of or pertaining to the veins. [EU] Ventricle: One of the two pumping chambers of the heart. The right ventricle receives oxygen-poor blood from the right atrium and pumps it to the lungs through the pulmonary artery. The left ventricle receives oxygen-rich blood from the left atrium and pumps it to the body through the aorta. [NIH] Ventricular: Pertaining to a ventricle. [EU] Ventricular Dysfunction: A condition in which the ventricles of the heart exhibit a decreased functionality. [NIH] Venules: The minute vessels that collect blood from the capillary plexuses and join together to form veins. [NIH] Veterinary Medicine: The medical science concerned with the prevention, diagnosis, and treatment of diseases in animals. [NIH] Viral: Pertaining to, caused by, or of the nature of virus. [EU] Virulence: The degree of pathogenicity within a group or species of microorganisms or viruses as indicated by case fatality rates and/or the ability of the organism to invade the tissues of the host. [NIH] Virulent: A virus or bacteriophage capable only of lytic growth, as opposed to temperate phages establishing the lysogenic response. [NIH] Virus: Submicroscopic organism that causes infectious disease. In cancer therapy, some viruses may be made into vaccines that help the body build an immune response to, and kill, tumor cells. [NIH] Viscosity: A physical property of fluids that determines the internal resistance to shear forces. [EU]
188 Toxic Shock Syndrome
Vitro: Descriptive of an event or enzyme reaction under experimental investigation occurring outside a living organism. Parts of an organism or microorganism are used together with artificial substrates and/or conditions. [NIH] Vivo: Outside of or removed from the body of a living organism. [NIH] Vulva: The external female genital organs, including the clitoris, vaginal lips, and the opening to the vagina. [NIH] War: Hostile conflict between organized groups of people. [NIH] Wetting Agents: A surfactant that renders a surface wettable by water or enhances the spreading of water over the surface; used in foods and cosmetics; important in contrast media; also with contact lenses, dentures, and some prostheses. Synonyms: humectants; hydrating agents. [NIH] White blood cell: A type of cell in the immune system that helps the body fight infection and disease. White blood cells include lymphocytes, granulocytes, macrophages, and others. [NIH]
Windpipe: A rigid tube, 10 cm long, extending from the cricoid cartilage to the upper border of the fifth thoracic vertebra. [NIH] Xenograft: The cells of one species transplanted to another species. [NIH] Zoster: A virus infection of the Gasserian ganglion and its nerve branches, characterized by discrete areas of vesiculation of the epithelium of the forehead, the nose, the eyelids, and the cornea together with subepithelial infiltration. [NIH] Zymogen: Inactive form of an enzyme which can then be converted to the active form, usually by excision of a polypeptide, e. g. trypsinogen is the zymogen of trypsin. [NIH]
189
INDEX A Abdomen, 137, 143, 163, 165, 172, 182, 184 Abdominal, 137, 171, 172, 173, 186 Abdominal Pain, 137, 173, 186 Abscess, 62, 137 Acetylcholine, 137, 146, 170 Acrylonitrile, 137, 179 Actin, 137, 168, 169 Acute renal, 72, 137, 159 Adenine, 137 Adenosine, 94, 137, 173 Adjuvant, 89, 137, 156 Adoptive Transfer, 8, 137 Adrenergic, 82, 137, 154 Adsorption, 83, 137 Adsorptive, 137 Adverse Effect, 137, 181 Aerobic, 67, 137 Affinity, 7, 12, 81, 137, 138, 181 Agonist, 15, 138 Airway, 94, 138 Algorithms, 138, 142 Alleles, 21, 138 Allergen, 138, 180 Allergic Rhinitis, 94, 138 Allium, 37, 138 Allograft, 86, 138 Alpha Particles, 138, 177 Alternative medicine, 102, 138 Alveoli, 138, 177 Amino Acid Sequence, 90, 138, 140, 157 Amino Acids, 10, 21, 138, 157, 171, 172, 175, 176, 186 Amplification, 18, 54, 138 Anaerobic, 67, 139, 168 Anaesthesia, 40, 41, 57, 67, 71, 73, 139, 162 Anal, 139, 155 Analog, 91, 139, 145, 147 Analogous, 7, 139, 185 Analytes, 118, 139 Anaphylatoxins, 139, 148 Anaphylaxis, 85, 139 Anatomical, 139, 161 Anemia, 139, 158, 168 Anergy, 12, 52, 139, 183 Anesthesia, 138, 139 Angiogenesis, 86, 139 Animal model, 9, 11, 14, 85, 139
Annealing, 139, 174 Anorexia, 139, 152, 186 Antagonism, 7, 139 Antibacterial, 81, 84, 139, 147, 181 Antibiotic, 5, 11, 13, 139, 140, 143, 145, 165, 172, 181 Antibodies, 7, 15, 17, 19, 28, 30, 43, 83, 84, 101, 134, 140, 158, 159, 161, 166, 168, 174 Anticoagulant, 140, 176 Antigen, 8, 10, 14, 15, 21, 57, 138, 139, 140, 148, 153, 160, 161, 162, 167, 180 Antigen-Antibody Complex, 140, 148 Antigen-presenting cell, 10, 14, 140 Anti-infective, 140, 146, 163 Anti-inflammatory, 49, 140, 150, 157, 175 Antimicrobial, 4, 68, 90, 140, 147, 150 Antiseptic, 140, 145 Antiviral, 140, 172 Anus, 139, 140, 172, 178 Apoptosis, 17, 32, 140 Arachidonic Acid, 140, 175 Arginine, 82, 139, 140, 170 Arterial, 140, 160, 176, 183 Arteries, 140, 141, 143, 149, 167, 174 Arterioles, 141, 143 Articular, 141, 164, 171 Aseptic, 141, 182 Aspergillosis, 32, 141 Aspiration, 48, 141 Assay, 28, 30, 54, 141, 161 Astringent, 141, 145 Asymptomatic, 141, 171 Atmospheric Pressure, 141, 160 Atopic, 53, 63, 86, 141 Atrophy, 141, 154 Attenuated, 141, 151 Atypical, 141, 162 Autodigestion, 141, 171 Autoimmune disease, 11, 15, 84, 141 Autoimmunity, 11, 141 Autopsy, 21, 141 B Back Pain, 53, 141 Bacteremia, 8, 45, 58, 61, 141 Bacterial Infections, 29, 83, 84, 141, 145 Bacterial toxin, 84, 141 Bactericidal, 79, 80, 141 Bacteriophage, 141, 174, 187
190 Toxic Shock Syndrome
Bacteriostatic, 80, 138, 141 Bacterium, 81, 142, 159, 185 Base, 66, 137, 142, 150, 157, 164, 186 Basophils, 85, 142, 164 Benign, 142, 156, 158, 169, 172 Beta-Glucosidase, 16, 142 Beta-Thromboglobulin, 142, 163 Bilateral, 142, 154, 179 Bile, 142, 159, 160, 165, 182 Biliary, 142, 159, 171 Biliary Tract, 142, 171 Binding Sites, 40, 142 Biochemical, 6, 93, 138, 142, 164, 171, 180 Biopsy, 5, 142 Biotechnology, 6, 12, 16, 19, 97, 102, 113, 142 Bioterrorism, 7, 142 Biphasic, 85, 142 Bladder, 142, 186 Blastomycosis, 95, 142 Blister, 20, 143 Blood Cell Count, 143, 158 Blood Glucose, 143, 159, 162 Blood Platelets, 143, 174, 180, 184 Blood pressure, 82, 87, 132, 133, 143, 160, 161, 168, 181 Blood vessel, 5, 82, 139, 143, 145, 153, 157, 159, 164, 166, 173, 181, 182, 184, 187 Blot, 31, 143 Body Fluids, 83, 84, 143, 144, 181, 183 Bone Marrow, 85, 143, 161, 165, 168, 181 Bone Resorption, 93, 143 Bowel, 86, 139, 143, 153, 162, 163, 164, 173, 186 Bradykinin, 143, 170 Branch, 129, 143, 166, 172, 177, 181, 184 Breakdown, 143, 151, 156 Breast Implants, 60, 143 Broad-spectrum, 143, 145 Bronchi, 143, 154, 185 Bronchial, 17, 41, 143, 159 Bronchioles, 138, 143, 177 Bronchitis, 82, 93, 143, 147 Bronchoconstriction, 85, 143 Bronchus, 143, 144 Buccal, 144, 165 Burns, 21, 28, 39, 66, 144 Burns, Electric, 144 Bypass, 15, 144, 169 C Cachexia, 82, 144 Calcium, 144, 148, 169, 173
Candidiasis, 95, 144 Candidosis, 144 Cantharidin, 26, 144 Capsular, 8, 35, 144 Carbohydrate, 144, 157, 175 Carbon Dioxide, 18, 79, 144, 155, 178 Carboxy, 18, 56, 144 Carboxymethylcellulose, 34, 144 Carboxy-terminal, 18, 56, 144 Carcinogenic, 144, 162, 182 Carcinoma, 22, 80, 144 Cardiac, 71, 85, 86, 145, 152, 154, 169, 182 Cardiac arrest, 71, 145 Cardiovascular, 14, 85, 94, 134, 145, 180 Case report, 22, 26, 36, 38, 39, 42, 45, 48, 49, 51, 53, 58, 59, 60, 61, 62, 66, 145 Catechol, 93, 145 Catheters, 91, 145 Caudal, 145, 175 Causal, 145, 180, 184 Cefazolin, 34, 145 Cell Death, 140, 145, 169 Cell Division, 141, 145, 167, 173 Cell proliferation, 7, 32, 89, 91, 98, 145 Cellobiose, 145 Cellulitis, 26, 145 Cellulose, 16, 145, 156, 173 Central Nervous System, 137, 145, 156, 158, 171, 180 Central Nervous System Infections, 145, 158 Centrifugation, 145, 158 Cerebral, 35, 145, 146, 154 Cerebrum, 145 Cervical, 22, 146 Cervix, 80, 146, 151 Chelating Agents, 79, 146 Chemokines, 8, 146 Chemotactic Factors, 146, 148 Chemotaxis, 85, 146 Chemotherapy, 146 Chickenpox, 4, 96, 146 Chlamydia, 80, 146 Chlorhexidine, 79, 146 Chlorophyll, 146, 156 Cholera, 146, 180 Cholesterol, 142, 146, 165, 182 Cholinergic, 82, 146 Chorioretinitis, 146, 179 Choroid, 146, 179, 187 Chromatin, 140, 147, 153, 181 Chromosomal, 138, 147
Index 191
Chromosome, 147, 165, 185 Chronic Disease, 144, 147 Chronic Obstructive Pulmonary Disease, 86, 93, 94, 147 Chronic renal, 36, 147, 186 Ciprofloxacin, 23, 147 Clindamycin, 98, 147 Clinical trial, 5, 113, 147, 178 Clone, 16, 21, 66, 147 Cloning, 14, 37, 142, 147 Coagulation, 4, 7, 14, 50, 143, 144, 147, 184 Coccidioidomycosis, 95, 147 Codons, 147, 157, 171 Cofactor, 147, 176, 184 Colitis, 86, 147 Collagen, 11, 147, 155, 156, 174, 175 Collapse, 14, 139, 143, 148 Complement, 81, 139, 148, 157, 166, 168, 180 Complementary and alternative medicine, 71, 74, 148 Complementary medicine, 71, 148 Computational Biology, 113, 148 Conception, 148, 149, 182 Cone, 148, 183 Congestion, 148, 154 Conjunctiva, 148, 162 Connective Tissue, 143, 145, 147, 149, 155, 156, 165, 172, 179, 183 Constipation, 149, 173 Constitutional, 149, 179 Contraception, 79, 80, 149 Contraceptive, 79, 80, 90, 106, 149 Contraindications, ii, 149 Coordination, 146, 149 Cornea, 149, 179, 187, 188 Coronary, 24, 85, 149, 167 Coronary Thrombosis, 149, 167 Corpus, 149, 172, 175 Cortex, 149, 171, 175 Corticosteroids, 72, 149, 157, 175 Cortisone, 149, 150, 175 Cranial, 149, 158, 171, 172 Craniocerebral Trauma, 149, 158 Croup, 24, 149 Crystallization, 6, 13, 14, 149 Curative, 149, 170, 184 Curettage, 118, 149, 165 Cutaneous, 5, 43, 85, 95, 142, 144, 149, 165, 179 Cyclic, 82, 94, 149, 158, 170, 173, 176 Cyst, 48, 150
Cysteine, 146, 150 Cytokine, 6, 8, 9, 14, 19, 27, 42, 150, 163 Cytoplasm, 140, 142, 150, 153 D Databases, Bibliographic, 113, 150 Degenerative, 150, 159, 171 Deletion, 12, 33, 140, 150 Denaturation, 150, 174 Dendrites, 150, 169 Density, 15, 145, 150, 165, 171, 174 Dermatitis, 53, 63, 86, 94, 150, 151 Desquamation, 4, 150 Detergents, 150, 170 Deuterium, 150, 160 Dexamethasone, 42, 59, 150 Diabetes Mellitus, 150, 159 Diagnostic procedure, 77, 102, 150 Dialyzer, 150, 159 Diarrhea, 5, 87, 93, 98, 132, 150, 153 Diastolic, 150, 160 Dietary Fats, 150, 165 Diffusion, 150, 151, 162 Digestion, 142, 143, 151, 163, 165, 182 Dilatation, 151, 177, 187 Dilution, 66, 151 Diploid, 151, 173, 185 Direct, iii, 13, 31, 81, 91, 105, 151, 178 Discrimination, 15, 151 Dissociation, 138, 151 Distal, 151, 177 Dorsal, 151, 154, 175 Douche, 78, 79, 151 Douching, 79, 151 Drug Interactions, 106, 151 Dura mater, 151, 167, 171 Dyes, 142, 151 Dysmenorrhea, 84, 119, 151 E Eczema, 82, 151 Edema, 35, 85, 132, 151, 169, 186 Effector, 137, 148, 151, 173 Efficacy, 7, 151 Ehrlichiosis, 7, 33, 39, 152 Ejaculation, 152, 180 Elastin, 147, 152 Electrocoagulation, 147, 152 Electrolyte, 152, 181, 186 Electrons, 142, 152, 163, 177 Electroplating, 145, 152 Embryo, 29, 152, 162 Emollient, 152, 157 Emphysema, 147, 152
192 Toxic Shock Syndrome
Empiric, 4, 152 Emulsion, 152, 155 Encephalitis, 152 Encephalomyelitis, 11, 15, 152 Encephalopathy, 4, 152 Endocarditis, 49, 61, 96, 144, 152 Endocardium, 152 Endometrial, 36, 152 Endometrium, 152, 153 Endothelial cell, 14, 33, 66, 82, 85, 152, 153, 163, 184 Endothelium, 153, 170, 174 Endothelium-derived, 153, 170 Endotoxic, 86, 93, 153 Endotoxin, 9, 28, 71, 72, 73, 82, 85, 153, 186 End-stage renal, 147, 153 Enteritis, 23, 153 Enterocolitis, 153 Enterotoxins, 6, 12, 14, 17, 18, 24, 30, 43, 46, 47, 53, 56, 78, 89, 153 Environmental Health, 112, 114, 153 Enzymatic, 144, 148, 153, 159, 174 Enzyme, 18, 30, 54, 66, 82, 85, 142, 151, 153, 158, 160, 165, 169, 173, 174, 176, 183, 184, 188 Enzyme-Linked Immunosorbent Assay, 30, 66, 153 Eosinophilia, 34, 57, 153, 155 Eosinophils, 153, 164 Epidemic, 17, 35, 153 Epidemiologic Factors, 95, 153 Epidemiological, 4, 20, 34, 153 Epidermal, 153, 164 Epidermis, 143, 153, 164, 175, 177, 182 Epinephrine, 137, 154, 170, 186 Epithelial, 6, 8, 17, 41, 150, 154, 159, 172 Epithelial Cells, 8, 17, 41, 154, 159 Epithelium, 6, 153, 154, 188 Epitope, 18, 44, 55, 154 Erectile, 154, 172 Erythema, 4, 95, 132, 154, 183, 186 Erythema Multiforme, 4, 154 Erythema Nodosum, 4, 154 Erythrocytes, 139, 143, 154, 178, 180 Estrogen, 118, 154 Ether, 80, 85, 154 Exfoliation, 150, 154 Exhaustion, 139, 154 Exogenous, 12, 82, 137, 151, 154 Exotoxin, 10, 12, 14, 19, 26, 31, 32, 37, 38, 53, 62, 78, 83, 87, 89, 98, 154, 182 Extensor, 154, 177
Extracellular, 149, 154, 155, 181 Extracellular Matrix, 149, 154, 155 F Family Planning, 113, 154 Fasciitis, 6, 8, 11, 29, 36, 38, 42, 55, 56, 58, 98, 155 Fat, 140, 143, 155, 165, 179, 181, 183 Fatigue, 155, 158 Fatty acids, 155, 175, 179 Febrile, 4, 155 Fibrin, 155, 173, 174, 184 Fibrinogen, 155, 174, 184 Fibroblasts, 89, 155, 163 Fibrosarcoma, 155 Fibrosis, 82, 155 Fixation, 91, 155, 180 Flagellum, 155, 185 Flatus, 155, 156 Fluorescence, 8, 29, 155 Fold, 6, 13, 156 Follicles, 156 Foramen, 156, 172 Forearm, 143, 155, 156 Fovea, 155, 156 Frontal Sinus, 61, 156 FSH, 118, 156 Fungi, 141, 156, 167, 182 Fungus, 144, 147, 156 G Ganglion, 156, 171, 188 Gangrene, 72, 156 Gangrenous, 156, 180 Gas, 82, 144, 150, 155, 156, 160, 170, 183 Gastric, 86, 141, 156, 159 Gastrointestinal, 82, 143, 147, 154, 156, 180, 183 Gelatin, 156, 157, 183, 184 Gels, 79, 156 Gene, 6, 8, 10, 13, 17, 18, 29, 32, 41, 54, 55, 57, 59, 89, 92, 97, 138, 142, 156, 157, 163 Gene Expression, 6, 13, 17, 41, 156 Genetic Code, 157, 170 Genetic Engineering, 142, 147, 157 Genetic testing, 157, 175 Genital, 80, 90, 147, 157, 186, 188 Genomics, 13, 17, 35, 157 Gestation, 157, 172 Gland, 149, 157, 165, 166, 171, 180, 182, 185 Glomerular, 157, 178 Glomeruli, 157 Glomerulonephritis, 13, 82, 157
Index 193
Glomerulus, 157, 169 Glucocorticoid, 150, 157, 175 Glucose, 142, 143, 145, 150, 157, 159, 162, 179 Glycerol, 67, 157 Glycine, 20, 157 Glycogen, 146, 157 Glycoprotein, 155, 157, 158, 164, 184, 186 Goats, 19, 157 Gonadal, 157, 182 Gonadotropic, 156, 157 Gonorrhea, 37, 80, 158 Governing Board, 158, 175 Gp120, 158, 172 Graft, 86, 158, 160, 161, 169 Gram-negative, 28, 38, 83, 86, 95, 146, 153, 158, 168 Gram-Negative Bacteria, 96, 153, 158 Gram-positive, 14, 83, 158, 182 Guanylate Cyclase, 158, 170 H Haptens, 138, 158 Headache, 5, 106, 132, 152, 158, 162 Headache Disorders, 158 Health Behavior, 24, 158 Health Status, 158 Heart failure, 82, 158 Hematocrit, 85, 143, 158 Hemodialysis, 59, 82, 150, 158 Hemoglobin, 139, 143, 146, 154, 159 Hemoglobin A, 146, 159 Hemolysins, 6, 159 Hemolytic, 27, 38, 66, 155, 159 Hemorrhage, 72, 149, 152, 158, 159, 169, 177, 182 Hepatitis, 79, 97, 159, 162 Hepatobiliary, 159, 173 Hepatocytes, 159 Hepatomegaly, 159, 162 Heredity, 156, 159 Herpes, 80, 159 Herpes Zoster, 159 Heterogeneity, 138, 159 Histamine, 139, 159 Histidine, 16, 159 Histocompatibility, 10, 12, 19, 44, 159 Hoarseness, 149, 159 Homogeneous, 11, 159 Homologous, 13, 83, 84, 89, 138, 160, 180 Hormone, 90, 118, 149, 154, 156, 160, 162, 163, 175, 179, 185 Horseradish Peroxidase, 153, 160
Host, 8, 11, 13, 82, 84, 86, 89, 91, 141, 144, 160, 161, 187 Humoral, 7, 160 Humour, 160 Hybrid, 147, 160 Hybridization, 18, 54, 160 Hydrogen, 93, 142, 144, 150, 160, 168, 170, 176 Hydrolysis, 34, 142, 145, 160, 175, 176 Hydroxylysine, 148, 160 Hydroxyproline, 148, 160 Hygienic, 151, 160 Hyperalgesia, 85, 160 Hyperbaric, 72, 160 Hyperbaric oxygen, 72, 160 Hypersensitivity, 18, 138, 139, 160, 179, 180 Hypertension, 85, 158, 160, 186 Hypoglycemia, 59, 160 Hypotension, 5, 6, 82, 85, 98, 132, 161 Hysterectomy, 38, 161 I Id, 68, 73, 90, 118, 119, 120, 121, 128, 130, 161 Immune response, 18, 56, 89, 137, 139, 140, 141, 149, 158, 161, 166, 168, 180, 183, 187 Immune Sera, 161 Immune system, 11, 82, 89, 140, 141, 161, 166, 187, 188 Immunity, 7, 24, 25, 30, 31, 41, 42, 44, 48, 53, 54, 55, 56, 57, 62, 63, 73, 89, 161, 166, 185 Immunization, 6, 8, 11, 137, 161, 180 Immunoassay, 153, 161 Immunocompromised, 7, 161 Immunodeficiency, 48, 58, 161 Immunogenic, 16, 83, 84, 161 Immunoglobulin, 22, 40, 42, 59, 140, 161, 168 Immunologic, 50, 137, 146, 159, 161, 166 Immunologic Factors, 159, 161 Immunotherapy, 137, 161 Impairment, 36, 161 In situ, 29, 161 In vitro, 6, 8, 9, 11, 22, 29, 30, 33, 39, 48, 66, 85, 161, 174 In vivo, 7, 8, 9, 11, 30, 33, 48, 73, 89, 161 Incision, 161, 163 Incubated, 89, 161 Indicative, 96, 162, 172, 187 Induction, 17, 18, 41, 52, 56, 67, 162 Infarction, 142, 149, 162, 167, 174, 178
194 Toxic Shock Syndrome
Infectious Mononucleosis, 96, 97, 162 Infiltration, 157, 162, 188 Inflammatory bowel disease, 82, 86, 93, 162 Influenza, 61, 98, 162 Infusion, 5, 162, 169 Ingestion, 162, 174 Inhalation, 147, 162, 174 Initiation, 162, 181, 185 Inoculum, 98, 162 Inorganic, 82, 162, 168 Insulin, 82, 162 Insulin-dependent diabetes mellitus, 82, 162 Intensive Care, 23, 36, 38, 40, 41, 49, 60, 61, 67, 73, 162 Interleukin-1, 42, 57, 67, 73, 163 Interleukin-10, 42, 163 Interleukin-2, 56, 163 Interleukin-4, 42, 163 Interleukin-8, 17, 41, 86, 163 Intermittent, 82, 163 Interstitial, 163, 169, 178 Intestinal, 153, 163 Intestine, 143, 153, 163, 164, 182 Intracellular, 8, 9, 42, 94, 162, 163, 170, 176, 179 Intraocular, 163, 171 Intraocular pressure, 163, 171 Intravascular, 4, 7, 14, 50, 163 Intravenous, 5, 22, 42, 54, 59, 98, 134, 162, 163 Intrinsic, 138, 163 Invasive, 6, 8, 10, 13, 23, 24, 34, 43, 161, 163 Iodine, 79, 80, 163 Ions, 142, 146, 151, 152, 160, 163 Ischemia, 141, 163, 169, 178 J Joint, 36, 91, 93, 141, 147, 164, 171, 183 K Kb, 13, 112, 164 Keratin, 164 Keratinocytes, 8, 163, 164 Kinetic, 12, 164 L Labile, 148, 164 Laceration, 164, 184 Large Intestine, 163, 164, 178, 181 Laxative, 144, 164 Lectins, 91, 92, 164 Lens, 144, 164
Leprosy, 96, 164 Lesion, 4, 142, 164, 165, 180, 186 Lethal, 11, 15, 28, 41, 141, 164 Leukocytes, 142, 143, 146, 153, 164, 186 Library Services, 128, 164 Life cycle, 142, 156, 164 Ligaments, 149, 164 Ligands, 7, 164 Lincomycin, 147, 164 Linkage, 9, 145, 165 Lip, 87, 88, 165 Lipase, 67, 165 Lipectomy, 60, 165 Lipid, 80, 85, 89, 157, 162, 165 Lipopolysaccharide, 16, 17, 18, 41, 67, 158, 165 Lipoprotein, 158, 165 Liver, 137, 140, 142, 152, 157, 159, 165, 175 Localization, 4, 18, 44, 165 Localized, 137, 155, 162, 165, 171, 173, 180, 184, 186 Lubricants, 79, 165 Lumbar, 51, 141, 165 Lupus, 82, 93, 165, 183 Lyme Disease, 96, 165 Lymph, 146, 153, 160, 162, 165, 166 Lymph node, 146, 165, 166 Lymphadenopathy, 162, 165 Lymphatic, 153, 162, 165, 181, 184 Lymphatic system, 165, 181, 184 Lymphocyte, 15, 17, 42, 57, 89, 140, 166, 167 Lymphoid, 22, 140, 149, 166 Lymphokines, 98, 166 Lymphoproliferative, 91, 166 Lytic, 166, 187 M Macrophage, 9, 17, 67, 72, 163, 166 Macrophage Activation, 9, 72, 166 Maculopapular, 4, 5, 166 Major Histocompatibility Complex, 6, 7, 14, 17, 19, 20, 30, 40, 55, 91, 163, 166 Malignancy, 80, 166 Malignant, 155, 166, 168, 169 Malignant tumor, 166, 168 Malnutrition, 141, 144, 166 Mammary, 12, 89, 166 Manifest, 98, 166 Man-made, 145, 166 Mastitis, 45, 166, 180 Mediate, 9, 166 Mediator, 67, 82, 85, 94, 163, 166, 174, 180
Index 195
Medicament, 138, 167, 183 MEDLINE, 113, 167 Melanin, 167, 173, 186 Membrane, 80, 134, 138, 146, 148, 150, 154, 158, 164, 167, 168, 169, 178, 179, 185 Meninges, 145, 149, 151, 167 Meningitis, 7, 38, 167 Menstruation, 75, 80, 84, 118, 119, 120, 151, 167 Mental Health, iv, 5, 112, 114, 167, 177 Mercury, 41, 67, 73, 167 Methicillin Resistance, 18, 47, 167 MI, 86, 97, 135, 167 Microbe, 167, 185 Microbiological, 27, 167 Microorganism, 92, 147, 167, 172, 188 Micro-organism, 167, 180 Microscopy, 8, 160, 167 Migration, 166, 167 Mitochondrial Swelling, 167, 169 Mitosis, 140, 164, 167 Modification, 7, 157, 168 Molecular, 6, 9, 27, 29, 46, 47, 72, 82, 83, 113, 115, 139, 142, 148, 155, 168, 174, 179, 186 Molecule, 10, 11, 13, 57, 82, 140, 142, 148, 151, 153, 154, 158, 160, 168, 170, 174, 178 Monitor, 119, 168, 170 Monoclonal, 8, 17, 30, 33, 41, 42, 48, 168, 177 Monoclonal antibodies, 8, 17, 30, 48, 168 Monocyte, 17, 67, 168 Monokines, 98, 168 Mononuclear, 18, 19, 25, 40, 41, 56, 63, 67, 155, 162, 168, 186 Morphological, 152, 156, 168 Morphology, 4, 5, 166, 168 Motility, 82, 168, 180 Mucosa, 153, 165, 168 Mucus, 168, 186 Multidrug resistance, 91, 168 Multiple Myeloma, 43, 168 Muscle Contraction, 85, 168 Musculoskeletal System, 168, 171 Myalgia, 98, 132, 162, 168 Mycoplasma, 11, 89, 145, 168 Myelin, 12, 168 Myocardial Reperfusion, 168, 169, 178 Myocardial Reperfusion Injury, 169, 178 Myocarditis, 82, 169 Myocardium, 167, 169, 179 Myosin, 168, 169
Myositis, 13, 22, 61, 169 N Nasal Mucosa, 162, 169 Necrosis, 53, 140, 155, 162, 167, 169, 178 Need, 3, 11, 20, 43, 78, 79, 88, 95, 97, 122, 137, 147, 157, 169 Neonatal, 23, 35, 46, 47, 169 Neonatal period, 35, 169 Neoplasia, 169 Neoplasm, 149, 169, 172, 186 Neoplastic, 89, 169 Nephritis, 86, 169 Nerve, 137, 139, 150, 156, 166, 169, 171, 182, 185, 187, 188 Nervous System, 145, 165, 166, 169, 183 Neural, 160, 169 Neurons, 82, 150, 169 Neuroretinitis, 170, 179 Neutralization, 11, 48, 170 Neutrons, 138, 170, 177 Neutropenia, 85, 170 Neutrophil, 85, 170 Niacin, 170, 186 Nitric Oxide, 9, 17, 67, 82, 170 Nitrogen, 155, 170, 186 Nonoxynol, 80, 170 Norepinephrine, 137, 170 Nuclear, 37, 152, 156, 166, 169, 170 Nuclei, 138, 152, 157, 167, 170, 171, 176 Nucleic acid, 84, 89, 157, 160, 170 Nucleic Acid Hybridization, 160, 170 Nucleus, 140, 142, 147, 149, 150, 153, 168, 170, 176, 182 O Observational study, 42, 171 Ocular, 82, 171 Ocular Hypertension, 82, 171 Opacity, 150, 171 Open Reading Frames, 13, 171 Ophthalmology, 155, 171 Opportunistic Infections, 81, 171 Optic Nerve, 170, 171, 179 Orthopaedic, 35, 36, 48, 58, 171 Osteoarthritis, 82, 171 Osteomyelitis, 91, 171 Ovary, 156, 171 P Pachymeningitis, 167, 171 Palliative, 171, 184 Pancreas, 137, 162, 165, 171 Pancreatic, 171 Pancreatitis, 22, 171
196 Toxic Shock Syndrome
Papilloma, 80, 172 Papule, 166, 172 Parasitic, 172, 179, 185 Pathogen, 11, 13, 91, 162, 172 Pathogenesis, 7, 8, 10, 12, 28, 44, 45, 49, 50, 67, 73, 172 Pathologic, 140, 142, 144, 149, 160, 172, 177 Pathologic Processes, 140, 172 Penicillin, 13, 81, 98, 139, 167, 172 Penis, 72, 88, 90, 152, 172, 173 Peptide, 10, 11, 12, 15, 21, 22, 57, 164, 172, 175, 176, 183 Peptide T, 15, 21, 57, 172 Perceived risk, 24, 172 Pericardium, 172, 183 Perinatal, 46, 172 Perineal, 5, 172 Perineum, 90, 172 Peripheral blood, 18, 25, 32, 56, 63, 67, 73, 172 Peripheral Nerves, 164, 172 Peritoneal, 56, 71, 172 Peritoneal Cavity, 71, 172 Peritoneum, 172, 173 Peritonitis, 59, 173 Phagocytosis, 6, 173 Phallic, 155, 173 Pharmaceutical Preparations, 145, 156, 173 Pharmacologic, 139, 173, 185 Pharyngitis, 6, 173, 179 Pharynx, 162, 173 Phenylalanine, 173, 186 Pheromone, 11, 173 Phosphodiesterase, 93, 94, 173 Phosphorus, 144, 173 Phosphorylation, 6, 56, 173 Phosphorylcholine, 85, 173 Photocoagulation, 147, 173 Physical Examination, 4, 173 Physiologic, 138, 167, 173, 175, 178 Physiology, 72, 164, 173 Plants, 142, 144, 146, 157, 168, 170, 173, 179, 182, 185 Plaque, 146, 173 Plasma, 80, 140, 142, 155, 156, 159, 168, 174, 180 Plasma cells, 140, 168, 174 Plasmin, 174 Plasminogen, 14, 174 Plasminogen Activators, 174 Platelet Aggregation, 139, 170, 174
Platelet Factor 4, 163, 174 Platelets, 82, 85, 142, 170, 174, 184 Poisoning, 7, 13, 18, 41, 67, 73, 93, 146, 167, 174 Polyarteritis Nodosa, 5, 174 Polyethylene, 80, 174 Polymerase, 13, 30, 53, 174, 181 Polymerase Chain Reaction, 30, 53, 174 Polypeptide, 89, 138, 144, 147, 155, 160, 174, 175, 176, 188 Polysaccharide, 8, 35, 140, 145, 175 Posterior, 60, 139, 141, 146, 151, 171, 175, 179 Postoperative, 51, 52, 81, 175 Potentiates, 163, 175 Practice Guidelines, 114, 175 Precursor, 140, 151, 153, 170, 173, 174, 175, 186 Prednisolone, 175 Prednisone, 5, 175 Prenatal, 152, 175 Prevalence, 29, 53, 175 Prickle, 164, 175 Progesterone, 175, 182 Progression, 29, 139, 175 Progressive, 98, 147, 158, 169, 171, 175, 178, 186 Proline, 147, 160, 175 Prophylaxis, 34, 175, 187 Proportional, 153, 175 Prostaglandin, 85, 175 Prostaglandins A, 176 Prosthesis, 91, 176 Protease, 6, 176 Protein C, 13, 138, 141, 164, 165, 176 Protein Conformation, 138, 164, 176 Protein S, 97, 142, 157, 176 Proteinuria, 168, 176 Proteolytic, 148, 155, 174, 176 Protons, 138, 160, 176, 177 Protozoa, 167, 176, 182 Pruritic, 151, 176, 179 Psoriasis, 29, 36, 82, 85, 86, 93, 94, 177 Psychiatry, 155, 177 Public Health, 54, 79, 97, 114, 177 Public Policy, 113, 177 Publishing, 16, 177 Pulmonary, 86, 93, 143, 177, 183, 187 Pulmonary Artery, 143, 177, 187 Pulmonary Emphysema, 93, 177 Pulse, 168, 177 Purpura, 5, 177
Index 197
Purulent, 177, 187 Pustular, 4, 177 Putrefaction, 156, 177 Pyogenic, 171, 177, 180 Pyrogenic, 6, 7, 10, 12, 13, 18, 19, 28, 31, 32, 43, 53, 62, 78, 84, 87, 89, 98, 177 Q Quinoxaline, 86, 177 R Radiation, 89, 155, 160, 166, 177, 178, 183 Radiation therapy, 160, 177 Radioactive, 160, 166, 168, 170, 177, 178 Randomized, 42, 151, 178 Rape, 88, 178 Receptor, 6, 7, 8, 9, 10, 15, 17, 30, 33, 40, 86, 140, 148, 158, 172, 178, 180, 183 Recombinant, 8, 15, 55, 178 Rectal, 90, 178 Rectum, 90, 140, 155, 156, 162, 164, 178, 183 Red blood cells, 154, 159, 178, 179 Refer, 1, 144, 148, 155, 156, 159, 165, 170, 178 Refraction, 178, 181 Regimen, 151, 178 Renal failure, 4, 178 Reperfusion, 86, 93, 169, 178 Reperfusion Injury, 86, 93, 178 Research Design, 8, 178 Resection, 36, 178 Respiration, 144, 168, 178 Respiratory distress syndrome, 7, 85, 86, 178 Respiratory syncytial virus, 25, 178 Restoration, 168, 178, 179 Retina, 146, 164, 170, 171, 178, 179, 187 Retinitis, 82, 179 Rheumatic Heart Disease, 13, 179 Rheumatism, 179 Rheumatoid, 58, 59, 82, 179 Rheumatoid arthritis, 58, 59, 82, 179 Rhinitis, 179, 180 Ribose, 137, 179 Rickettsiae, 4, 179 Rod, 27, 28, 142, 179 Rubber, 87, 88, 137, 179 Rubella, 96 S Saline, 143, 179 Sanitary, 84, 179 Saponins, 179, 182 Saturate, 81, 179
Scabies, 49, 179 Scarlet Fever, 4, 6, 18, 28, 43, 46, 96, 179 Sclera, 146, 148, 179, 187 Scleroderma, 155, 180 Screening, 50, 147, 180 Scrotum, 43, 72, 180, 184 Secretion, 11, 17, 19, 42, 57, 67, 73, 85, 159, 160, 162, 168, 180 Semen, 88, 152, 180 Semisynthetic, 145, 147, 180 Sensibility, 139, 160, 180 Sensitization, 9, 180 Sepsis, 13, 28, 72, 83, 86, 96, 180 Septic, 26, 82, 83, 86, 94, 141, 180 Septicaemia, 29, 180 Sequence Homology, 172, 180 Sequencing, 13, 175, 180 Serotonin, 180, 186 Serotypes, 26, 180 Serum, 17, 19, 31, 41, 67, 83, 84, 134, 137, 139, 145, 148, 161, 173, 180, 186 Sexually Transmitted Diseases, 88, 90, 180 Shedding, 150, 180 Side effect, 105, 137, 180, 185 Sigma Factor, 13, 181 Signs and Symptoms, 98, 174, 181, 186 Skeletal, 168, 181 Skeleton, 137, 164, 176, 181 Skin graft, 181, 182 Small intestine, 153, 160, 163, 181 Smooth muscle, 82, 94, 139, 159, 181, 183 Sodium, 79, 181 Soft tissue, 98, 143, 155, 181 Solid tumor, 139, 181 Solvent, 157, 181 Somatic, 160, 167, 181 Specialist, 119, 122, 181 Specificity, 15, 18, 138, 181 Spectrum, 7, 27, 91, 181 Spermatozoa, 180, 181 Spermicide, 80, 181 Spinal cord, 145, 146, 151, 152, 156, 167, 169, 171, 172, 182 Spinous, 153, 164, 182 Spirochete, 165, 182, 183 Splenomegaly, 162, 182 Spores, 147, 162, 182 Stabilizer, 144, 182 Staphylococcal Infections, 25, 118, 182 Staphylococcal Scalded Skin Syndrome, 5, 96, 182 Stents, 61, 182
198 Toxic Shock Syndrome
Sterility, 79, 182 Steroid, 64, 149, 179, 182 Stimulus, 163, 182, 184 Stomach, 137, 141, 156, 160, 172, 173, 181, 182 Strand, 174, 182 Streptococcal Infections, 10, 23, 34, 43, 47, 118, 182 Streptococci, 28, 46, 78, 179, 182 Streptococcus, 6, 8, 10, 13, 24, 27, 32, 37, 38, 39, 43, 47, 49, 55, 56, 66, 67, 98, 155, 182 Stress, 14, 89, 179, 182, 186 Stridor, 149, 182 Stroke, 86, 112, 182 Styrene, 179, 182 Subacute, 162, 182 Subarachnoid, 158, 183 Subclinical, 162, 183 Subcutaneous, 66, 145, 151, 156, 165, 183 Subspecies, 181, 183 Substance P, 180, 183 Substrate, 153, 183 Suction, 60, 165, 183 Sunburn, 82, 183 Superantigens, 6, 7, 10, 12, 13, 14, 15, 27, 33, 49, 60, 89, 98, 183 Suppositories, 79, 156, 183 Suppression, 91, 183 Suppurative, 145, 156, 183 Surfactant, 79, 80, 170, 183, 188 Surgical Sponges, 87, 183 Symptomatic, 171, 183 Synergistic, 11, 32, 183 Syphilis, 96, 183 Systemic, 8, 11, 61, 82, 83, 91, 93, 95, 106, 139, 143, 144, 154, 162, 175, 177, 180, 183, 185 Systemic lupus erythematosus, 61, 183 Systolic, 160, 183 T Tachycardia, 141, 184 Tachypnea, 141, 184 Teichoic Acids, 158, 184 Testicles, 180, 184 Testicular, 156, 184 Testis, 156, 184 Tetani, 184 Tetanic, 184 Tetanus, 97, 184 Therapeutics, 7, 13, 107, 184 Thermal, 151, 170, 174, 184
Thoracic, 141, 184, 188 Thorax, 137, 165, 184 Threonine, 172, 184 Threshold, 160, 184 Thrombin, 155, 174, 176, 184 Thrombocytes, 174, 184 Thrombocytopenia, 4, 85, 184 Thrombolytic, 174, 184 Thrombomodulin, 176, 184 Thrombophlebitis, 26, 184 Thrombosis, 14, 33, 50, 86, 142, 176, 182, 184 Thrombus, 149, 162, 169, 174, 184 Thymus, 161, 165, 166, 184 Thyroid, 119, 163, 185, 186 Ticks, 8, 165, 185 Tonsillitis, 179, 185 Topical, 68, 141, 146, 185 Toxicity, 16, 17, 84, 89, 151, 167, 185 Toxicology, 11, 114, 185 Toxins, 6, 7, 12, 14, 15, 18, 30, 47, 53, 66, 79, 80, 83, 84, 89, 140, 142, 152, 159, 162, 168, 185 Toxoid, 6, 185 Trachea, 143, 144, 173, 182, 185 Tracheitis, 25, 39, 185 Transcription Factors, 14, 185 Transfection, 89, 142, 185 Transfer Factor, 161, 185 Translocation, 8, 185 Transmitter, 137, 166, 170, 185 Transplantation, 147, 161, 166, 185 Trauma, 27, 35, 72, 91, 169, 172, 185 Trees, 179, 185 Trichomonas, 80, 185 Trisomy, 49, 185 Tryptophan, 39, 148, 180, 185 Tuberculosis, 165, 186 Tumor Necrosis Factor, 17, 41, 42, 49, 56, 57, 67, 73, 94, 186 Tumour, 53, 156, 186 Typhoid fever, 96, 186 Tyrosine, 56, 186 U Ulcer, 86, 145, 186 Ulcerative colitis, 82, 86, 162, 186 Unconscious, 161, 186 Uraemia, 172, 186 Uremia, 178, 186 Ureters, 186 Urethra, 90, 172, 186 Urinary, 5, 90, 147, 186
Index 199
Urinary tract, 90, 186 Urine, 142, 145, 176, 186 Urogenital, 158, 186 Urticaria, 139, 186 Uterus, 146, 149, 152, 153, 161, 167, 175, 186, 187 Uvea, 187 Uveitis, 82, 187 V Vaccination, 97, 187 Vaccine, 7, 11, 31, 55, 137, 187 Vagina, 78, 79, 84, 87, 88, 90, 144, 146, 151, 167, 187, 188 Vaginal, 6, 16, 35, 54, 63, 78, 79, 80, 84, 87, 88, 106, 119, 133, 170, 187, 188 Vaginitis, 80, 90, 144, 187 Valves, 179, 187 Varicella, 26, 63, 96, 187 Vascular, 6, 14, 82, 85, 139, 146, 153, 158, 162, 170, 174, 184, 186, 187 Vasculitis, 172, 174, 187 Vasodilators, 170, 187 Vein, 163, 170, 184, 187 Venereal, 80, 183, 187 Venous, 142, 143, 176, 187
Ventricle, 177, 183, 187 Ventricular, 44, 169, 187 Ventricular Dysfunction, 44, 187 Venules, 143, 187 Veterinary Medicine, 113, 187 Viral, 4, 10, 12, 79, 82, 90, 152, 162, 187 Virulence, 6, 7, 8, 11, 13, 141, 185, 187 Virulent, 52, 187 Virus, 48, 58, 79, 89, 141, 145, 146, 157, 158, 162, 163, 174, 178, 187, 188 Viscosity, 92, 187 Vitro, 9, 11, 188 Vivo, 7, 11, 89, 188 Vulva, 90, 188 W War, 46, 188 Wetting Agents, 170, 188 White blood cell, 140, 161, 162, 164, 165, 166, 168, 170, 174, 188 Windpipe, 144, 173, 185, 188 X Xenograft, 139, 188 Z Zoster, 63, 188 Zymogen, 176, 188
200 Toxic Shock Syndrome
