Anovulation - A Medical Dictionary, Bibliography, and Annotated Research Guide to Internet References

ANOVULATION A M EDICAL D ICTIONARY , B IBLIOGRAPHY , AND A NNOTATED R ESEARCH G UIDE TO I NTERNET R E FERENCES

J AMES N. P ARKER , M.D. AND P HILIP M. P ARKER , P H .D., E DITORS

ii

ICON Health Publications ICON Group International, Inc. 4370 La Jolla Village Drive, 4th Floor San Diego, CA 92122 USA Copyright 2004 by ICON Group International, Inc. Copyright 2004 by ICON Group International, Inc. All rights reserved. This book is protected by copyright. No part of it may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying, recording, or otherwise, without written permission from the publisher. Printed in the United States of America. Last digit indicates print number: 10 9 8 7 6 4 5 3 2 1

Publisher, Health Care: Philip Parker, Ph.D. Editor(s): James Parker, M.D., Philip Parker, Ph.D. Publisher's note: The ideas, procedures, and suggestions contained in this book are not intended for the diagnosis or treatment of a health problem. As new medical or scientific information becomes available from academic and clinical research, recommended treatments and drug therapies may undergo changes. The authors, editors, and publisher have attempted to make the information in this book up to date and accurate in accord with accepted standards at the time of publication. The authors, editors, and publisher are not responsible for errors or omissions or for consequences from application of the book, and make no warranty, expressed or implied, in regard to the contents of this book. Any practice described in this book should be applied by the reader in accordance with professional standards of care used in regard to the unique circumstances that may apply in each situation. The reader is advised to always check product information (package inserts) for changes and new information regarding dosage and contraindications before prescribing any drug or pharmacological product. Caution is especially urged when using new or infrequently ordered drugs, herbal remedies, vitamins and supplements, alternative therapies, complementary therapies and medicines, and integrative medical treatments. Cataloging-in-Publication Data Parker, James N., 1961Parker, Philip M., 1960Anovulation: A Medical Dictionary, Bibliography, and Annotated Research Guide to Internet References / James N. Parker and Philip M. Parker, editors p. cm. Includes bibliographical references, glossary, and index. ISBN: 0-497-00074-1 1. Anovulation-Popular works. I. Title.

iii

Disclaimer This publication is not intended to be used for the diagnosis or treatment of a health problem. It is sold with the understanding that the publisher, editors, and authors are not engaging in the rendering of medical, psychological, financial, legal, or other professional services. References to any entity, product, service, or source of information that may be contained in this publication should not be considered an endorsement, either direct or implied, by the publisher, editors, or authors. ICON Group International, Inc., the editors, and the authors are not responsible for the content of any Web pages or publications referenced in this publication.

Copyright Notice If a physician wishes to copy limited passages from this book for patient use, this right is automatically granted without written permission from ICON Group International, Inc. (ICON Group). However, all of ICON Group publications have copyrights. With exception to the above, copying our publications in whole or in part, for whatever reason, is a violation of copyright laws and can lead to penalties and fines. Should you want to copy tables, graphs, or other materials, please contact us to request permission (E-mail: [email protected]). ICON Group often grants permission for very limited reproduction of our publications for internal use, press releases, and academic research. Such reproduction requires confirmed permission from ICON Group International, Inc. The disclaimer above must accompany all reproductions, in whole or in part, of this book.

iv

Acknowledgements The collective knowledge generated from academic and applied research summarized in various references has been critical in the creation of this book which is best viewed as a comprehensive compilation and collection of information prepared by various official agencies which produce publications on anovulation. Books in this series draw from various agencies and institutions associated with the United States Department of Health and Human Services, and in particular, the Office of the Secretary of Health and Human Services (OS), the Administration for Children and Families (ACF), the Administration on Aging (AOA), the Agency for Healthcare Research and Quality (AHRQ), the Agency for Toxic Substances and Disease Registry (ATSDR), the Centers for Disease Control and Prevention (CDC), the Food and Drug Administration (FDA), the Healthcare Financing Administration (HCFA), the Health Resources and Services Administration (HRSA), the Indian Health Service (IHS), the institutions of the National Institutes of Health (NIH), the Program Support Center (PSC), and the Substance Abuse and Mental Health Services Administration (SAMHSA). In addition to these sources, information gathered from the National Library of Medicine, the United States Patent Office, the European Union, and their related organizations has been invaluable in the creation of this book. Some of the work represented was financially supported by the Research and Development Committee at INSEAD. This support is gratefully acknowledged. Finally, special thanks are owed to Tiffany Freeman for her excellent editorial support.

v

About the Editors James N. Parker, M.D. Dr. James N. Parker received his Bachelor of Science degree in Psychobiology from the University of California, Riverside and his M.D. from the University of California, San Diego. In addition to authoring numerous research publications, he has lectured at various academic institutions. Dr. Parker is the medical editor for health books by ICON Health Publications. Philip M. Parker, Ph.D. Philip M. Parker is the Eli Lilly Chair Professor of Innovation, Business and Society at INSEAD (Fontainebleau, France and Singapore). Dr. Parker has also been Professor at the University of California, San Diego and has taught courses at Harvard University, the Hong Kong University of Science and Technology, the Massachusetts Institute of Technology, Stanford University, and UCLA. Dr. Parker is the associate editor for ICON Health Publications.

vi

About ICON Health Publications To discover more about ICON Health Publications, simply check with your preferred online booksellers, including Barnes&Noble.com and Amazon.com which currently carry all of our titles. Or, feel free to contact us directly for bulk purchases or institutional discounts: ICON Group International, Inc. 4370 La Jolla Village Drive, Fourth Floor San Diego, CA 92122 USA Fax: 858-546-4341 Web site: www.icongrouponline.com/health

vii

Table of Contents FORWARD .......................................................................................................................................... 1 CHAPTER 1. STUDIES ON ANOVULATION ......................................................................................... 3 Overview........................................................................................................................................ 3 The Combined Health Information Database................................................................................. 3 Federally Funded Research on Anovulation .................................................................................. 4 The National Library of Medicine: PubMed ................................................................................ 25 CHAPTER 2. NUTRITION AND ANOVULATION ............................................................................... 51 Overview...................................................................................................................................... 51 Finding Nutrition Studies on Anovulation ................................................................................. 51 Federal Resources on Nutrition ................................................................................................... 52 Additional Web Resources ........................................................................................................... 52 CHAPTER 3. ALTERNATIVE MEDICINE AND ANOVULATION ......................................................... 55 Overview...................................................................................................................................... 55 National Center for Complementary and Alternative Medicine.................................................. 55 Additional Web Resources ........................................................................................................... 59 General References ....................................................................................................................... 60 CHAPTER 4. PERIODICALS AND NEWS ON ANOVULATION ........................................................... 61 Overview...................................................................................................................................... 61 News Services and Press Releases................................................................................................ 61 Academic Periodicals covering Anovulation ............................................................................... 62 CHAPTER 5. RESEARCHING MEDICATIONS .................................................................................... 65 Overview...................................................................................................................................... 65 U.S. Pharmacopeia....................................................................................................................... 65 Commercial Databases ................................................................................................................. 66 Researching Orphan Drugs ......................................................................................................... 66 APPENDIX A. PHYSICIAN RESOURCES ............................................................................................ 71 Overview...................................................................................................................................... 71 NIH Guidelines............................................................................................................................ 71 NIH Databases............................................................................................................................. 73 Other Commercial Databases....................................................................................................... 75 APPENDIX B. PATIENT RESOURCES ................................................................................................. 77 Overview...................................................................................................................................... 77 Patient Guideline Sources............................................................................................................ 77 Finding Associations.................................................................................................................... 79 APPENDIX C. FINDING MEDICAL LIBRARIES .................................................................................. 81 Overview...................................................................................................................................... 81 Preparation................................................................................................................................... 81 Finding a Local Medical Library.................................................................................................. 81 Medical Libraries in the U.S. and Canada ................................................................................... 81 ONLINE GLOSSARIES.................................................................................................................. 87 Online Dictionary Directories ..................................................................................................... 87 ANOVULATION DICTIONARY ................................................................................................. 89 INDEX .............................................................................................................................................. 125

1

FORWARD In March 2001, the National Institutes of Health issued the following warning: "The number of Web sites offering health-related resources grows every day. Many sites provide valuable information, while others may have information that is unreliable or misleading."1 Furthermore, because of the rapid increase in Internet-based information, many hours can be wasted searching, selecting, and printing. Since only the smallest fraction of information dealing with anovulation is indexed in search engines, such as www.google.com or others, a non-systematic approach to Internet research can be not only time consuming, but also incomplete. This book was created for medical professionals, students, and members of the general public who want to know as much as possible about anovulation, using the most advanced research tools available and spending the least amount of time doing so. In addition to offering a structured and comprehensive bibliography, the pages that follow will tell you where and how to find reliable information covering virtually all topics related to anovulation, from the essentials to the most advanced areas of research. Public, academic, government, and peer-reviewed research studies are emphasized. Various abstracts are reproduced to give you some of the latest official information available to date on anovulation. Abundant guidance is given on how to obtain free-of-charge primary research results via the Internet. While this book focuses on the field of medicine, when some sources provide access to non-medical information relating to anovulation, these are noted in the text. E-book and electronic versions of this book are fully interactive with each of the Internet sites mentioned (clicking on a hyperlink automatically opens your browser to the site indicated). If you are using the hard copy version of this book, you can access a cited Web site by typing the provided Web address directly into your Internet browser. You may find it useful to refer to synonyms or related terms when accessing these Internet databases. NOTE: At the time of publication, the Web addresses were functional. However, some links may fail due to URL address changes, which is a common occurrence on the Internet. For readers unfamiliar with the Internet, detailed instructions are offered on how to access electronic resources. For readers unfamiliar with medical terminology, a comprehensive glossary is provided. For readers without access to Internet resources, a directory of medical libraries, that have or can locate references cited here, is given. We hope these resources will prove useful to the widest possible audience seeking information on anovulation. The Editors

1

From the NIH, National Cancer Institute (NCI): http://www.cancer.gov/cancerinfo/ten-things-to-know.

3

CHAPTER 1. STUDIES ON ANOVULATION Overview In this chapter, we will show you how to locate peer-reviewed references and studies on anovulation.

The Combined Health Information Database The Combined Health Information Database summarizes studies across numerous federal agencies. To limit your investigation to research studies and anovulation, you will need to use the advanced search options. First, go to http://chid.nih.gov/index.html. From there, select the “Detailed Search” option (or go directly to that page with the following hyperlink: http://chid.nih.gov/detail/detail.html). The trick in extracting studies is found in the drop boxes at the bottom of the search page where “You may refine your search by.” Select the dates and language you prefer, and the format option “Journal Article.” At the top of the search form, select the number of records you would like to see (we recommend 100) and check the box to display “whole records.” We recommend that you type “anovulation” (or synonyms) into the “For these words:” box. Consider using the option “anywhere in record” to make your search as broad as possible. If you want to limit the search to only a particular field, such as the title of the journal, then select this option in the “Search in these fields” drop box. The following is what you can expect from this type of search: •

Polycystic Ovary Syndrome Source: Diabetes Self-Management. 18(6): 56-57,59. November-December 2001. Contact: Available from R.A. Rapaport Publishing, Inc. 150 West 22nd Street, New York, NY 10011. (800) 234-0923. Website: www.diabetes-self-mgmt.com. Summary: This article discusses polycystic ovary syndrome (PCOS), a disorder characterized by high levels of male hormones (androgens) and chronic anovulation (failure to ovulate) in females. In addition, PCOS is associated with insulin resistance, the key problem underlying type 2 diabetes. In insulin resistance, body tissues, particularly muscle, fat, and liver cells, do not respond properly to insulin. As a result, more insulin than normal is needed to keep a person's blood glucose (sugar) level in the normal range. Diabetes develops in about one-third of all women with PCOS. Effective

4

Anovulation

treatments are available for PCOS, and early diagnosis gives a woman the best chance of avoiding long term complications. The symptoms of PCOS typically develop during puberty and progress slowly. Symptoms can include increased body hair, thinning of scalp hair (alopecia), persistent acne, erratic menstrual cycles (two to six times a year), obesity, symptoms of low blood sugar after eating significant amounts of carbohydrate, and difficulty conceiving. Treatment usually includes weight reduction, exercise, and following a low carbohydrate diet. Additional therapy is tailored to the woman's main complaint, whether that is acne, hirsutism (excessive hair), alopecia, uncontrollable appetite, or infertility. Drugs used to treat PCOS can include oral contraceptives, androgen-blocking agents, and insulin-sensitizing agents. The author concludes that a multidisciplinary health care team is most appropriate for treating women with PCOS. One sidebar offers resources for readers who wish to obtain additional information about PCOS, its diagnosis, clinical features, potential complications, and treatments.

Federally Funded Research on Anovulation The U.S. Government supports a variety of research studies relating to anovulation. These studies are tracked by the Office of Extramural Research at the National Institutes of Health.2 CRISP (Computerized Retrieval of Information on Scientific Projects) is a searchable database of federally funded biomedical research projects conducted at universities, hospitals, and other institutions. Search the CRISP Web site at http://crisp.cit.nih.gov/crisp/crisp_query.generate_screen. You will have the option to perform targeted searches by various criteria, including geography, date, and topics related to anovulation. For most of the studies, the agencies reporting into CRISP provide summaries or abstracts. As opposed to clinical trial research using patients, many federally funded studies use animals or simulated models to explore anovulation. The following is typical of the type of information found when searching the CRISP database for anovulation: •

Project Title: ADRENAL AXIS AND THE REPRODUCTIVE PROCESS Principal Investigator & Institution: Ferin, Michel J.; Professor; Obstetrics and Gynecology; Columbia University Health Sciences Po Box 49 New York, Ny 10032 Timing: Fiscal Year 2002; Project Start 01-SEP-1987; Project End 30-JUN-2005 Summary: Our overall objective is to investigate how stress, and by definition an activated hypothalamic-pituitary-adrenal axis (HPA), acts to modify normal function of the hypothalamic- pituitary-gonadal axis (HPG) and to interfere with the normal menstrual cycle in a relevant non-human primate. In the previous funding period, we developed two distinct short-term stress models (inflammatory and psychogenic) in the rhesus monkey and demonstrated that they reliably interfere with normal cyclic function and induce cycle stage- and stress-specific damage that may include a delay in folliculogenesis, a decrease in luteal secretory capability reminiscent of the inadequate luteal phase syndrome, and/or interference with the normal tonic gonadotropin profile. The first two aims will investigate the role of the 2 main HPA neuropeptides, CRH and

2 Healthcare projects are funded by the National Institutes of Health (NIH), Substance Abuse and Mental Health Services (SAMHSA), Health Resources and Services Administration (HRSA), Food and Drug Administration (FDA), Centers for Disease Control and Prevention (CDCP), Agency for Healthcare Research and Quality (AHRQ), and Office of Assistant Secretary of Health (OASH).

Studies

5

vasopressin (VP), in the process by which stress interferes with the menstrual cycle by correlating their central release and the effects of specific CRH and VP antagonists to neutralize endogenous HPA activity. Since different stress may activate varying central pathways, which may, in turn, have different sensitivities to ovarian steroids, we will compare HPA and HPG effects in the 2 different stress models and in the follicular and luteal phase of the cycle. The goal of aim 3 is to develop a long-term stress that results in amenorrhea, the defining symptom of the established clinical functional hypothalamic chronic anovulation syndrome. Here, we will test whether two unrelated stimuli, such as a psychogenic stress and diet, can synergize to produce the syndrome and investigate the role of CRH, VP and opioid peptides in established amenorrhea. We will also investigate whether leptin, in a new role as a modulator of stress-related endocrine function and reproduction, plays a protective role against amenorrhea. Overall, the data will contribute to our understanding of the varying mechanisms whereby different stress stimuli interfere with reproductive function and of how the ovarian endocrine milieu influences this process. They will provide novel information on the early stages whereby a stress, insufficient to interrupt the cycle, interferes with normal cyclic function and may result in infertility, and open new avenues of treatment in the chronic anovulation syndrome. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen •

Project Title: ANDROGENIZED FEMALE AS A MODEL FOR P0LYCYSTIC OVARIAN SY Principal Investigator & Institution: Abbott, David H.; Primate Research Center; University of Wisconsin Madison 750 University Ave Madison, Wi 53706 Timing: Fiscal Year 2002; Project Start 01-AUG-1999; Project End 31-JUL-2004 Summary: Polycystic ovarian syndrome (PCOS) affects 10 percent of reproductive-aged women and is characterized by hyperandrogenic anovulation. Hyperinsulinemia plays a key role in the mechanism of hyperandrogenic anovulation. The etiology of PCOS in the human, however, is unknown. Prenatal androgen excess in female rhesus monkeys results in ovarian, endocrinological and metabolic features in adulthood which closely resemble PCOS. In this nonhuman primate model for PCOS, we will test the hypothesis that a double insult is required to evoke hyperandrogenic anovulation. We propose that hyperandrogenism is required for hyperinsulinemia to effect hyperandrogenic anovulation (PCOS). Without hyperandrogenism, hyperinsulinemia may induce ovarian hyperandrogenism, but it will fail to induce hyperandrogenic anovulation. The Specific Aims of the proposed research are to (1) use an insulin-sensitizing agent to ameliorate hyperinsulinemia and induce ovulatory cycles in prenatally androgenized female rhesus monkeys that exhibit hyperandrogenic anovulation, (2) produce hyperinsulinemia in normo-insulinemic, hyperandrogenic, prenatally androgenized females and induce hyperandrogenic anovulation, and (3) use an anti-androgen in combination with hyperinsulinemia in normo-insulinemic hyperandrogenic, prenatally androgenized females to block insulin-induced hyperandrogenic anovulation. Eight anovulatory and 10 ovulatory prenatally androgenized females will be matched for age and body composition with 18 ovulatory controls. The 8 anovulatory androgenized females and their controls will receive 4 mg/kg of troglitazone (RezulinTm, ParkeDavis) daily for 6 months to ameliorate their hyperinsulinemia. The 10 ovulatory androgenized females and their controls will receive daily injections of insulin (Ultralente insulin, Eli Lilly) for 6 months, starting at 5U/day and incrementing to 20U/day. A 6-month Control Phase will be counterbalanced with each Treatment Phase. During all Phases, data will be collected on ovarian function and morphology,

6

Anovulation

hyperandrogenism in the ovary and adrenal, changes in intra-ovarian follicular fluid content, degree of LH hypersecretion, glucose/insulin homeodynamics, and CT/DXAdetermined body composition. If our hypothesis is correct, these data will establish that hyperinsulinemia results in hyperandrogenic anovulation only in prenatally androgenized female monkeys. Such results would offer novel insights into the origin and mechanism of PCOS, and would provide a unifying determinant for a multifactorial syndrome. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen •

Project Title: ANOVULATION IN PCOS--ETIOLOGY OF INCREASED LH SECRETION Principal Investigator & Institution: Marshall, John C.; Professor of Medical Science; University of Virginia Charlottesville Box 400195 Charlottesville, Va 22904 Timing: Fiscal Year 2003; Project Start 23-APR-2003; Project End 31-MAR-2008 Summary: Consistent features ofpolycystic ovarian syndrome (PCOS) include anovulation and hyperandrogenemia. In different individuals, these may be associated with hyperinsulinemia, obesity and associated disorders such as dyslipidemia. LH levels are elevated in up to 90% of patients when recent ovulation (and transient suppression of LH) has been excluded. The elevated LH reflects a persistently rapid frequency of GnRH secretion, enhancing LH synthesis, secretion and consequent androgen production by the ovary. An important aspect of normal ovulatory cycles is the differential synthesis and secretion of FSH and LH at different cycle stages. The ability to differentially secrete LH or FSH relates in part to changes in GnRH pulse frequency (slow frequency favors FSH) and slowing the GnRH pulse generator is effected by luteal progesterone (P). In PCOS, sensitivity to P is reduced by hyperandrogenemia and GnRH pulse frequency remains persistently rapid, leading to excess LH, normal or low FSH, excess androgen production and acyclicity. In SA1, we aim to pursue the primacy of P as the regulator of the GnRH pulse generator in normal women, in support of a thesis that elevation of P inhibits the rapid GnRH (1 pulse/h) secretion present after sexual maturation in adolescents. We also examine if excess androgens impair P induction of increased hypothalamic opioid activity, as a mechanism for reduced inhibition of GnRH pulse secretion. SA2 seeks to examine hypothalamic abnormalities in hyperandrogenemic adolescents, where hyperandrogenemia and abnormal LH secretion is documented and thought to be the forerunner of adult PCOS. We plan to determine ifhyperandrogenemia exerts similar inhibitory actions on P suppression of GnRH in adolescents prior to and after menarche. We will also study nocturnal LH, FSH and steroid secretion in eu- and hyperandrogenemic adolescent girls, to determine ifP effects the daytime suppression of GnRH pulse secretion during early pubertal maturation. If so, pubertal exposure to excess androgens may have similar actions to those seen in adults, leading to persistent 24 h GnRH secretion. In SA3, we aim to examine the efficacy of anti-androgens in enhancing the ability of P to inhibit GnRH pulse secretion, in efforts to enhance subsequent selective FSH secretion and follicular maturation upon steroid withdrawal. Our goal is to use physiologic principles to design protocols, which will inhibit the production of excess androgens and allow induction of cyclical follicular maturation and ovulation. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen

Studies

•

Project Title: BIOENERGETICS DISTURBANCES

OF

EXERCISE-INDUCED

7

MENSTRUAL

Principal Investigator & Institution: Williams, Nancy I.; Noll Physiological Res Ctr; Pennsylvania State University-Univ Park 110 Technology Center University Park, Pa 16802 Timing: Fiscal Year 2002; Project Start 10-MAY-2001; Project End 30-APR-2004 Summary: (Scanned from the applicant's abstract) The suppression of menstrual cyclicity due to strenuous exercise can cause infertility, severe bone demineralization, increase fracture risk, and possibly increase the risk of cardiovascular disease. Recent findings in humans and animals have strongly suggested that exercise-induced menstrual disturbances are primarily caused by low energy availability and not by other factors, such as the physical stress of exercise per se. While some studies have quantified energy balance associated with short-term decreases in plasma levels of reproductive hormones, the bioenergetics associated with the induction and reversal of clinically recognized menstrual disturbances in exercising women remain unclear. The first specific aim of this proposal is to test the hypothesis that there is a direct relationship between the severity of exercise-induced menstrual disturbances and the magnitude of negative energy balance. In addition to weight loss, crosssectional studies in humans suggest that exercise-induced menstrual disturbances are associated with adaptive mechanisms to conserve energy, i.e., alterations in circulating metabolic hormones and substrates, and reductions in components of 24 h energy expenditure such as metabolic rate. Since in vivo and in vitro studies using animal models have suggested mechanistic roles for key metabolic hormones and substrates in the modulation of GnRH neuronal activity with changes in energy balance, prospective studies in humans are now necessary to identify the time course and magnitudes of change of potential key metabolic signals during the development of EIMD. The second specific aim of this proposal is to test the hypothesis that exercise-induced menstrual disturbances are triggered by the development of a particular metabolic state defined by adaptive mechanisms to conserve energy. The significance of this research relates to conditions of infertility, delayed puberty, anovulation, anorexia nervosa, exercise-induced amenorrhea, and the recently identified high incidence of luteal phase disturbances and anovulatory cycles in women exercising even at recreational levels. We expect the results of these studies to provide new and useful information for making specific recommendations regarding the exercise and dietary practices concomitant with maintaining normal, ovulatory menstrual cycles and adequate levels of circulating estrogen and progesterone. The results will also expand our understanding of the mechanism of the modulation of reproductive function by energy availability. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen •

Project Title: COUPLING OF D-CHIRO-INOSITOL TO INSULIN IN PCOS WOMEN Principal Investigator & Institution: Iuorno, Maria J.; Internal Medicine; Virginia Commonwealth University Richmond, Va 232980568 Timing: Fiscal Year 2003; Project Start 01-AUG-2003; Project End 31-JUL-2005 Summary: (provided by applicant): Polycystic ovary syndrome (PCOS) is characterized by hyperandrogenism and chronic anovulation and it is the most common form of female infertility in the U.S. It has been demonstrated that insulin resistance accompanied by compensatory hyperinsulinemia is, in part, responsible for the hyperandrogenism and anovulation of this disorder. The cellular mechanisms of insulin

8

Anovulation

resistance in PCOS are still largely unknown. D-chiro-inositol phosphoglycan (DCI-IPG) is a nonclassical mediator of insulin action that has been demonstrated to increase glucose utilization. Previous studies have shown that administering a drug similar to the native mediator to women with PCOS increases insulin sensitivity, reduces ovarian androgen production and improves ovulation in these women. Therefore, it seems likely that women with PCOS have a defect in DCI-IPG cellular activity that leads to insulin resistance. The aim of this application is to determine whether a defect in coupling between D-chiro-inositol phosphoglycan and insulin plays a role in the insulin resistance of PCOS. We propose to assess the coupling of the DCI-IPG to insulin in women with PCOS and normal women: 1) by administering diazoxide to these women in order to temporarily suppress their pancreatic insulin secretion and measure a change in activity in DCI-IPG in plasma of these women following suppression of insulin and 2) by restoring insulin following diazoxide administration using an insulin clamp and measuring the degree to which DCI-IPG activity is also restored during the clamp in normal women versus women with PCOS. Hence, both PCOS women and normal control women will be evaluated for this insulin to DCI-IPG activity relationship. It is our hypothesis that at least one mechanism of insulin resistance in PCOS is due to defective coupling between insulin and DCI-IPG activity. The results of these studies will 1) describe the physiologic, in vivo relationship between insulin and DCI-IPG in normal women; 2) provide a mechanism for insulin resistance in PCOS as it relates to the DCI-IPG insulin signaling cascade; 3) provide the groundwork for further clinical studies to explore the role of defective coupling in other insulin resistant human conditions (such obesity or type 2 diabetes); and 4) lead to novel specific therapies for the insulin resistance of PCOS. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen •

Project Title: OUTCOMES

DDT,

ENDOCRINE

DISRUPTION

AND

REPRODUCTIVE

Principal Investigator & Institution: Wang, Xiaobin; Associate Professor; Boston Medical Center Gambro Bldg, 2Nd Fl, 660 Harrison Ave, Ste a Boston, Ma 02118 Timing: Fiscal Year 2002; Project Start 01-SEP-2001; Project End 31-AUG-2004 Summary: This proposal responds to RFA OH-01-001 "Endocrine Disruptors: Epidemiologic Approaches." Both animal and in vitro studies support the hypothesis that dichlorodiphenyl trichloroethane (DDT) and its metabolites are potentially important human reproductive toxins. However, the epidemiologic data associating DDT with human reproductive health are limited. The goal of this proposal is to establish a dose-response relationship between exposure to dichlorodiphenyl dichloroethene (DDE), a major and stable metabolite of DDT, endocrine dysfunction, and adverse reproductive outcomes in women. We will test the hypotheses that exposure to DDE is associated with (1) hormone dysfunction including reduced estrogen excretion (REE), anovulation, abnormal luteal phase (ALP), and abnormal follicular phase (AFP); (2) menstrual disorders; (3) reduced fecundability; and (4) adverse pregnancy outcomes including spontaneous abortion (SAB), preterm delivery, low birth weight, and intrauterine growth retardation (IUGR). We will further test the hypotheses that endocrine disruption evaluated by REE, anovulation, ALP, and AFP is associated with above adverse reproductive outcomes. This proposal is built on a large prospective cohort study in Anqing, China, funded by NICHD (HD32505, period: 19962001) to evaluate the effects of rotating shift work on reproductive outcomes. A total of 1,200 married women employees of Anqing Textile Mill who were between 20 and 34 years of age, never smokers, and who obtained permission to have a child and

Studies

9

attempted to become pregnant over the course of the study have been enrolled in the parent study. Information available from this cohort includes: (1) detailed baseline and follow-up questionnaires on sociodemographic characteristics, reproductive history, occupational and environmental factors, and dietary intake; (2) daily diary from each woman reporting menstruation, use of medications, sexual intercourse, contraceptive use, active and passive smoking, alcohol use, and occupational exposure; (3) clinical data on reproductive outcomes, including menstrual disturbances, time to conception, SAB, preterm delivery, low birth weight, and IUGR; (4) daily urine samples from each woman for up to one year or until pregnancy is clinically confirmed; (5) measures of time to conception and subclinical fetal loss determined by a highly sensitive and specific assay for urinary B-hCG; and (6) archived pre-pregnant plasma samples from each woman. This proposal will include the 1,200 women already enrolled in the parent study. Plasma DDT/DDE levels will be measured and urinary pregnanediao-3glucorinide (PdG), estrogen conjugates (E1C), and follicle stimulating hormone (FSH) will be analyzed. These newly obtained pesticide and hormone data will be linked to existent epidemiologic and clinical database to investigate dose-response relationships between DDE exposure, hormone dysfunction, and adverse reproductive outcomes, with adjustment for important confounders. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen •

Project Title: GENES, ANDROGENS AND INTRAUTERINE ENVIRONMENT IN PCOS Principal Investigator & Institution: Dunaif, Andrea F.; Chief, Division of Women's Health; Medicine; Northwestern University 633 Clark Street Evanston, Il 60208 Timing: Fiscal Year 2002; Project Start 27-SEP-2002; Project End 31-JUL-2007 Summary: (provided by applicant): PCOS is among the most common disorders of adolescent and premenopausal women, affecting approximately 710% of this population. It is a high priority and overarching women's health problem with substantial reproductive and metabolic morbidities throughout the lifespan. Dunaif's recent studies on the mechanisms of insulin resistance in PCOS have revealed the surprising finding that defects in skeletal muscle insulin action are acquired secondary to a factor (or factors) in the in vivo environment (Project 1). Dunaif and colleagues' family studies have shown that hyperandrogenernia is the major reproductive phenotype in PCOS kindreds (Figure 3). Urbanek and colleagues have compelling evidence that this phenotype is linked with a marker, D19S884, on chromosome 19p in the region of the insulin receptor gene (Project 2). This marker is also associated with a metabolic phenotype in PCOS women as well as in their brothers characterized by decreased insulin secretion, particularly in response to sulfonylurea (Project 1). Abbott and colleagues have shown that many of the phenotypic features of PCOS, such as ovarian hyperandrogenism, polycystic ovaries, increased LH levels, anovulation, central adiposity and decreased insulin secretion can be produced in rhesus monkeys by intrauterine testosterone exposure (Project 3). Levine has obtained evidence that one mechanism for some of these androgen actions is decreased function of ATP-sensitive potassium channels (K+ATP channel) in gonadotropin releasing hormone (GnRH) containing neurons and in pancreatic islet P-cells (Project 4). Sulfonylureas stimulate insulin secretion through activation of one of these channels, known as the sulfonylurea receptor, and the same channel complex appears to function in GnRH neurons. These observations have led to a paradigm shift in our concept of the pathogenesis of PCOS. Exposure of the fetus to androgens could result in the reproductive phenotype and the pancreatic P-cell dysfunction characteristic of PCOS. We propose to test the hypothesis

10

Anovulation

that hyperandrogenernia resulting from variation in a gene in linkage disequilibrium with D I 9S884 causes many of the phenotypic features of PCOS by prenatal androgen programming. This hypothesis will be directly tested in two animal models and in translational human studies. The metabolic phenotype associated with the chromosome 19p PCOS susceptibility gene will be defined and this susceptibility gene will be identified. These studies will elucidate the pathogenesis of PCOS and provide the potential for molecular diagnosis of the syndrome. These objectives will be accomplished in four highly synergistic and interactive research projects. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen •

Project Title: SYNDROME

GRANULOSA

CELL

FUNCTION

IN

POLYCYSTIC

OVARY

Principal Investigator & Institution: Chang, R Jeffrey.; Professor & Chairman; Reproductive Medicine; University of California San Diego La Jolla, Ca 920930934 Timing: Fiscal Year 2004; Project Start 15-MAY-2004; Project End 28-FEB-2009 Summary: (provided by applicant): Polycystic ovary syndrome affects approximately 510% of reproductive-aged women. A cardinal feature of this disorder is chronic anovulation, which is manifest clinically by irregular menstrual bleeding and is the primary cause for infertility in these women. The mechanism(s) responsible for ovulatory disruption are not well understood. While recognizing the well-documented decrease in pituitary FSH secretion, a growing body of evidence indicates that ovarian follicular function in PCOS is abnormal, which is characterized by an initial resistance to gonadotropin stimulation during ovulation induction followed by subsequent hyperresponsiveness once progressive follicle growth has been achieved. The latter consideration has particular important clinical relevance as excessive granulosa cell stimulation may lead to ovarian hyperstimulation syndrome and potential serious lifethreatening complications. We have demonstrated previously, in vitro, and more recently, in vivo, that granulosa cells from PCOS ovaries exhibit greater E2 responsiveness to FSH stimulation compared to responses observed in granulosa cells of normal women. Furthermore, our assessment of FSH-stimulated E2 release in PCOS women undergoing insulin infusion suggests that granulosa cells may exhibit insulin resistant, which may result from or contribute to functional abnormalities of the follicle. The mechanisms responsible for these alterations of granulosa cell function are unknown. Of those factors, which have been shown, in vitro, to impact granulosa cell responses to FSH, estrogen, androgen, and insulin are uniquely linked to PCOS by virtue of their abnormal secretion, production, and metabolism, respectively. However, translational studies to specifically test whether these factors may be responsible for abnormal granulosa cell function in women with PCOS have not been performed. In this project, we propose to address the hypotheses that each of these factors, either alone or in combination, may be responsible for abnormal granulosa cell function in PCOS. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen •

Project Title: INSULIN AND OVARIAN/METABOLIC RESPONSES IN PCOS Principal Investigator & Institution: Nestler, John E.; University of Virginia Charlottesville Box 400195 Charlottesville, Va 22904 Timing: Fiscal Year 2002 Summary: The polycystic ovary syndrome (PCOS) is a major health problem that affects approximately 6% of women of reproductive age. PCOS is characterized by hyperandogenism and anovulation, and is the leading cause of female infertility in the

Studies

11

United States. Evidence suggests that insulin resistance accompanies by compensatory hyperinsulinemia is a common features of PCOS, and that hyperinsulinemia is responsible in part for the hyperandrogenism of the disorder. However, clinical studies have not assessed the possible role of hyperinsulinemia in promoting the chronic anovulation of PCOS, nor have they examined whether improving insulin selectivity alters PCOS-associated morbidities that may also be linked to insulin resistance and/or hyperinsulinemia, such as glucose intolerance, hypertension, dyslipidemia and atherosclerosis. Therefore, we propose 1) to assess the effects of chronic (12 month) insulin reduction on the hormonal, metabolic (glucose tolerance, blood pressure, lipids, PAI-1, tPA antigen) and ovulatory profiles of women with PCOS, as well as the time course of any changes, 2) to determine whether pharmacologically improving the insulin sensitivity of clomiphene-resistant PCOS women increase the rates of spontaneous and/or clomiphene-induced ovulation, and 3) to determine whether hyperinsulinemia alters 24 hours before and after administration of clomiphene plus placebo or metformin). If our studies confirm an important role of hyperinsulinemia in the pathogenesis of PCOS, they have significant practical implications. That is, they will provide compelling evidence that the first-line treatment of anovulation due to PCOS should be measured aimed at improving insulin sensitivity and reducing serum insulin-including the use of "insulin-sensitizing" agents. Moreover, they will suggest that in women who have failed standard ovulation induction measures, the relatively inexpensive and non-invasive technique of "insulin sensitization" should be employed prior to the initiation of expensive and more complicated technology. Finally, our findings should reveal whether insulin sensitization beneficially affects PCOS comorbidities that may also be related to insulin resistance or hyperinsulinemia. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen •

Project Title: LIFESTYLE INTERVENTION /METFORMIN /POLYCYSTIC OVARY SYND Principal Investigator & Institution: Legro, Richard S.; Professor of Obstetrics and Gynecology; Meharry Medical College 1005-D B Todd Blvd Nashville, Tn 37208 Timing: Fiscal Year 2003; Project Start 10-JUL-2003; Project End 30-JUN-2008 Summary: Polycystic ovary syndrome is a common endocrinopathy characterized by chronic anovulation and androgen excess, and an adolescent phenotype has now been identified. The overall hypothesis of this proposal is that insulin resistance is the fundamental pathophysiologic defect in both adolescents and adult females with polycystic ovary syndrome (PCOS), and therefore interventions to improve it are most likely to result in spontaneous ovulation (adults) and reductions in hyperandrogenemia (adolescents). We propose to build on the landmark findings of the Diabetes Prevention Program (DPP), where both a lifestyle intervention and metformin therapy, as single agent therapies, significantly reduced the diabetes conversion rates in a high risk population (the females of which were similar to a PCOS population). We will examine the effects of combination therapy compared to single agent therapy in females with PCOS. The DPP established lifestyle interventions, as the gold standard treatment for this metabolic syndrome and one all affected should receive. Therefore we hypothesized that combination therapy with lifestyle intervention and metformin will be more effective than lifestyle intervention and placebo on improving the stigmata of polycystic ovary syndrome (by 25%). We propose to conduct two parallel trials of this hypothesis: Study 1 will be conducted in an adult population (N = 150, Age 21-39) with ovulation frequency as the primary outcome. Study 2 will be conducted in an adolescent population ( N = 100, Age 14-18) with hyperandrogenemia as the primary outcome.

12

Anovulation

Each study will be a two center, double blind, randomized trial that lasts 6 months. The two treatment strategies: 1) Lifestyle intervention with mefformin, 2) Lifestyle intervention with placebo. We will additionally follow other reproductive and metabolic parameters in both treatment groups for response including acne, hirsutism, glucose tolerance, and body composition. It is unknown if multiple treatments to improve insulin sensitivity are additive in females with PCOS. Additionally there is little data to assess the effects of these combined interventions on improving the hyperandrogenism and anovulation that characterize PCOS. There have also only been very limited studies of these therapies in an adolescent population. Our focus will also specifically be on a minority population and we will also explore ethnic and racial differences in response to therapy. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen •

Project Title: LONG-TERM TREATMENT OF POLYCYSTIC OVARY SYNDROME Principal Investigator & Institution: Hoeger, Kathleen M.; Obstetrics and Gynecology; University of Rochester Orpa - Rc Box 270140 Rochester, Ny 14627 Timing: Fiscal Year 2004; Project Start 01-DEC-2003; Project End 30-NOV-2008 Summary: (provided by applicant): Polycystic Ovary Syndrome (PCOS) is a heterogeneous condition characterized by chronic anovulation and androgen excess that occurs in 4-8% of reproductive-aged women. The signs and symptoms of PCOS often are present at puberty although the diagnosis is often delayed until adulthood. Obesity is a common association with PCOS and is often present at an early age in these women. Insulin resitance is felt to play a critical pathophysiologic role in PCOS and interventions that have reduced insulin resistance have been shown to improve the metabolic and reproductive consequences of PCOS. The two most common interventions, weight reduction and use of insulin sensitizers, have not been evaluated in the long-term, and there are no controlled data on these interventions in the adolescent with PCOS. During the proposed K23 award, the PI will pursue research on the relative efficacy of pharmacologic and lifestyle interventions and test the overall hypothesis that these interventions to reduce insulin resistance in adult and adolescent women with PCOS will ameliorate their symptoms and improve metabolic parameters over the long-term. The significant public health impact of the metabolic and reproductive consequences of PCOS suggests the need for carefully done, controlled clinical trials of long-term intervention and follow-up. The PI will devote the next five years to developing a sound clincial trial program in PCOS, pursuing randomized, controlled pilot trials in the adult and adolescent with PCOS. The K23 award will allow the PI to gain the necessary background in epidemiology, clinical trial design and statistical analysis to propose and carry out a large-scale clinical trial assessing the relative benefits of insulin-sensitizing agents and lifestyle management. The perspective of both the adolescent with early onset of the disease, and the adult with more established morbidity, allows the exploration of these interventions across the reproductive life-span and provides a uinque opportunity to follow the long-term impact of treatment. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen

•

Project Title: MBRS SCORE AT NEW MEXICO HIGHLANDS UNIVERSITY Principal Investigator & Institution: Horne, C A.; Behavioral Sciences; New Mexico Highlands University Sininger Hall 234 Las Vegas, Nm 87701 Timing: Fiscal Year 2002; Project Start 01-JUN-1977; Project End 31-AUG-2004

Studies

13

Summary: New Mexico Highlands University is a historically Hispanic institution committed to programs that focus on its multiethnic student body, especially the Hispanic and Native American cultures that are distinctive of the State of New Mexico. The NMHU MBRS program has traditionally been part of the S06 mechanism of NIH support and the present MBRS SCORE application is a competitive renewal designed to replace the research component of the old S06. Seven research subprojects are proposed from a wide range of biomedical science and extend from "Photosensitization and Photoprotection in Model Visual Systems" to "Factors that Maintain Postpartum Anovulation." The present application includes five subprojects that are competitive renewals and two subprojects that are new efforts. The overall goal of the proposed NMHU MBRS SCORE program is to enhance the biomedical research capabilities of the NMHU faculty. The specific goals and objectives of this program include: 1) To establish a supportive environment at NMHU for conducting research by enhancing the utilization of the resources of the Office of Research, Planning, and Institutional Development by NMHU research faculty, and by increasing the number of external seminar guest speakers and collaborations, 2) To increase the productivity and visibility of research at NMHU through publication of manuscripts in peer-reviewed journals, review articles, or book chapters, through presentations delivered at major scientific meetings, and through submission of external grant proposals. It is expected that this program will result in at least 2 biomedical research grant proposals submitted for MBRS supplemental funding, at least one faculty member participating in an external summer research placement each year, a minimum of two manuscripts published per year by senior PIs, one manuscript published every two years for other PIs, at least two published abstracts per PI per year, and the submission of at least one external grant proposal by each PI by the end of the third year of the project period. This application includes an ambitious and comprehensive evaluation plan containing measurable objectives and including personal monitoring of the program goals, objectives, and activities by the Program Evaluator. Overall, the proposed MBRS SCORE program is expected to enhance significantly the biomedical research competitiveness and capabilities of NMHU faculty. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen •

Project Title: RESEARCH

NATIONAL

COOPERATIVE

PROGRAM

FOR

INFERTILITY

Principal Investigator & Institution: Strauss, Jerome F.; Professor; Obstetrics and Gynecology; University of Pennsylvania 3451 Walnut Street Philadelphia, Pa 19104 Timing: Fiscal Year 2003; Project Start 01-DEC-1996; Project End 31-MAR-2007 Summary: (provided by applicant): Polycystic ovary syndrome (PCOS) is a leading cause of infertility in women. Five to 10% of premenopausal women are estimated to be affected by this disease, which is characterized by hyperandrogenemia, chronic anovulation, and is associated with other health risks such as type 2 diabetes mellitus and obesity. A primary defect in PCOS resides in the ovary, with increased (thecal/stromal) androgen production and follicular maturation arrest being the hallmarks. Unique changes in PCOS ovarian morphology, hyperplasia and thickening of the cortical ovarian stroma and hypertrophy of the stroma at the cortical-medullary boundary, suggest the possible involvement of the ovarian stroma. Previous investigators have postulated that the increased stromal density could be a cause of PCOS or a result of a primary ovarian deficit. We hypothesize that there is a bidirectional dialogue between the stroma and theca that influences the activities of these two compartments. The long-term objective of this project is to elucidate the role ovarian

14

Anovulation

stromal cells play in the etiology of PCOS. This objective will be attained by completing the following specific aims: 1) define ovarian stromal cell paracrine interactions with thecal cells focusing on steroidogenesis and growth factor/growth factor binding protein production; and 2) determine whether PCOS ovarian stromal cells have functional defect(s) that result in the manifestation of the thecal PCOS phenotype, or whether stromal cells exhibit an altered phenotype because of interaction with PCOS thecal cells. To examine stromal cell function and paracrine theca interactions, cell culture experiments will be performed. The effects of androgens, progesterone, gonadotropins and cAMP treatment on stromal cell proliferation, steroidogenic potential and growth factor/growth factor binding protein production will be evaluated using radioimmunoassays, ELISAs, Western blots, and quantitative real-time RT-PCR. Paracrine interactions between stromal and thecal cells will be evaluated by testing conditioned medium from each cell type on the other cell type and by co-culture of thecal and stromal cells. Identification of the paracrine factor(s) expressed by ovarian stromal cells that influence theca cells will be initiated using standard fractionation procedures, followed by state-of-the-art proteomic and lipid/small molecule approaches. Lastly, we will examine PCOS stromal and thecal cell interactions, determining if they differ from normal ovarian stromal/thecal interactions. These studies should elucidate for the first time the functional role of ovarian stromal cells, and their role in PCOS. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen •

Project Title: NEURAL INFLUENCE ON HYPOPHYSEAL GONADAL FUNCTION Principal Investigator & Institution: Spies, Harold G.; Oregon Health & Science University Portland, or 972393098 Timing: Fiscal Year 2002 Summary: The preovulatory release of gonadotropin-releasing hormone (GnRH) and luteinizing hormone (LH) in women and rhesus monkeys is dependent upon enhanced secretion of ovarian estradiol-17? (E). This E-induced GnRH/LH surge is accompanied by changes in hypothalamic and brainstem cells that are identified as neuropeptide Y (NPY)-, norepinephrine (NE)-, acetylcholine (Ach)- and gamma aminobutyric acid (GABA)-containing neurons. Our research has focused on how E influences transcriptional-translational events associated with these peptide and transmitter systems and how these central neural events change with aging, especially the perimenopausal life-stage where E secretion declines. Two isoforms of the E receptor (ER ? and ?) have been reported. To study the tissue distribution of the ER isoforms, we cloned and sequenced two cDNA probes (126 bp and 291 bp) for rhesus monkey ER-?. These cDNA fragments were similar, but not identical, to human ER-? sequences. With pro bes for bo th ER-? and ER-?, we quantified the ER isoforms in several peripheral and central neural male and female tissues by reverse transcription-polymerase chain reaction (RT-PCR). Both the ER-? and ER-? mRNAs were present in male and female reproductive organs. Only ER-? was expressed in liver, frontal cortex, caudate nucleus, locus coeruleus and cerebellum. In some brain regions, i.e., the putamen, internal capsule, hippocampus and paraventricular hypothalamus, ER-? was expressed in the female, but not in the male. In macaque females 10-15 years of age mRNA expression for tyrosine hydroxylase (TH, enzyme for control of NE synthesis) in specific adrenergic neural populations (A1, A2, A6) are upregulated by E treatment. However, after E treatment in perimenopausal monkeys (> 22 years old), expression levels of TH mRNA is dampened in the A6 region of brainstem. We continue to study the relevance of this age- and E-related decline in TH mRNA response in brainstem neurons. We also cloned

Studies

15

a 356 bp monkey choline acetyltransferase (CHAT, the enzyme for control of Ach synthesis) cDNA fragment that corresponds to the human CHAT N-1 type sequence 332 to 684. The 5= and 3= primer sequences were TAAGATGGCAGCAAAAACTCCC and ACCGATGACCAGCTGAGGTTT, respectively. To our knowledge, this partial DNA sequence of the rhesus monkey CHAT gene has not been documented previously. The MCHAT RNA probe that was generated from the clone hybridized with CHAT mRNA in several specific hypothalamic and brainstem areas in adult female macaque brain. Quantification of mRNA expression during various physiologic conditions will help establish the relevance of cholinergic neurons during ovulation and anovulation in primates. FUNDING NIH HD16631, HD18185 PUBLICATIONS Pau CY, Pau KYF, Spies HG. Putative estrogen receptor and a mRNA expression in male and female rhesus macaques. Mol Cell Endocrinol 146:59-68, 1998. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen •

Project Title: NEUROENDOCRINE CONTROL OF SEASONALITY Principal Investigator & Institution: Goodman, Robert M.; Professor; Physiology and Pharmacology; West Virginia University P. O. Box 6845 Morgantown, Wv 265066845 Timing: Fiscal Year 2002; Project Start 01-SEP-1983; Project End 30-JUN-2007 Summary: (provided by applicant) The long-term goal of this research is to understand the structural and functional changes in the hypothalamus that are responsible for the reversible suppression of ovarian function, such as occurs prior to puberty. It has been recognized for over 40 years that increases in response to estradiol (E2) negative feedback play a major role in producing these periods of infertility (e.g., the gonadostat theory of puberty), but the underlying changes in hypothalamo-pituitary function remain largely unknown. Using seasonal breeding as a model, we have identified a neural circuit (the vmPOA-RCh system) that plays a key role in alterations in E2 negative feedback in the ewe. This circuitry mediates E2 inhibition of gonadotropinreleasing hormone (GnRH) pulse frequency and is activated during periods of anovulation (anestrus) and inactivated during periods of fertility (breeding season). The first specific aim will better characterize this circuit by determining the phenotype of estrogen-responsive elements in the vmPOA and RCh and evaluating the role of ER in mediating the actions of E2. The second specific aim will test three alternate explanations for the activation of this system in anestrus: an increase in estrogen receptors, an increase in key neurotransmitter levels, or an increase in synaptic contacts within the circuit. The third specific aim will begin to determine the mechanisms by which external factors control the activity of this circuit. There is now evidence that another hypothalamic area, the premammillary region (PMR) controls changes in responsiveness to E2 negative feedback. The experiments in Specific Aim 3, we will examine the anatomical and functional connections between this area and the vmPOARCh system and test the hypothesis that it is critical for changes in response to E2 negative feedback. These questions will be addressed using a combination of anatomical, molecular and physiological approaches that include immunocytochemical analysis (at the light and electron microscopic levels), in situ hybridization, tract-tracing, local administration of drugs and hormones to different hypothalamic areas, and the production of small hypothalamic lesions. The results of these studies will provide fundamental information on the control of reproductive function and on neural plasticity in the adult brain that may be relevant to both physiological and pathological suppression of ovarian function. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen

16

•

Anovulation

Project Title: NEUROENDOCRINOLOGY OF PUBERTY Principal Investigator & Institution: Foster, Douglas L.; Professor & Research Scientist; Obstetrics and Gynecology; University of Michigan at Ann Arbor 3003 South State, Room 1040 Ann Arbor, Mi 481091274 Timing: Fiscal Year 2002; Project Start 01-MAR-1984; Project End 31-JAN-2005 Summary: When nourishment is inadequate or energy expenditure is great, fertility is reduced in the adult, and puberty is delayed in the developing individual. This suppression of reproductive activity is not understood mechanistically. We believe this to be an integrative problem at this stage of inquiry that requires both physiologic and pharmacologic approaches to answer broad questions about how the brain discriminates how well nourished and how mature the body is. Our broad objective is to understand the physiological mechanisms by which changes in nutrition and metabolism control reproduction, specifically the signals, sensors, and pathways whereby blood-borne information regulates GnRH secretion. To progress further in understanding the relationship between growth, metabolism and production of high frequency GnRH pulses during development, we must first determine how energy metabolism regulates GnRH secretion. To progress further in understanding the relationship between growth , metabolism and production of high frequency GnRH pulses during development, we must first determine how energy metabolism regulates GnRH secretion in the adult. Thus, we will first evaluate how changes in glucose availability and leptin modify GnRH secretion during adulthood and then determine if such a mechanism might be timing puberty during growth. The sheep will be used because its large size and long lifespan permits individuals to be studied longitudinally through their development and permits detailed studies in adults. Importantly, it is well suited for the characterization of hypophysiotrophic hormone patterns. Specific Aim 1 will determine if the hindbrain and the liver contain sensors that transmit information about glucose availability to regulated GnRH secretion. We will both increase and decrease availability locally in each site to establish their function and their interrelationships. Specific Aim 2 will determine the role of leptin as a signal to regulate the pulsatile secretion of GnRH. This will be achieved through central administration of leptin during both acute fasting and chronic low nutrition. Although widely studied in feeding behavior, we have little understanding of its physiologic role in regulating GnRH secretion. Specific Aim 3 will assess "nutritional stress" as a cause hypogonadotropism through reduced GnRH secretion by monitoring of stress peptides in the pituitary portal circulation and by antagonizing their action during acute fasting and chronic low nutrition. Specific Aim 4 will determine if glucose availability times the pubertal GnRH increase by using the power of our large animal model in which we can chronically administer metabolically important signals such as insulin and leptin. Understanding the metabolic control of GnRH secretion has broad application both to growth and maturation and to other physiologic conditions in which reduced GnRH secretion may contribute to infertility because of altered energy metabolism. These include dietary malnutrition from eating disorders; during high-energy expenditure, as in exercise- induced amenorrhea and lactational anovulation; during type 1-diabetesinduced infertility. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen

Studies

•

Project Title: ORGANOPHOSPHATE REPRODUCTIVE HEALTH

PESTICIDES

AND

17

HUMAN

Principal Investigator & Institution: Xu, Xiping; Associate Professor & Director; Environmental Health; Harvard University (Sch of Public Hlth) Public Health Campus Boston, Ma 02115 Timing: Fiscal Year 2002; Project Start 01-SEP-2000; Project End 31-AUG-2004 Summary: (Adapted from the Investigator's Abstract) This study is designed to recruit and prospectively follow a cohort of women and their husbands to assess the effects of exposure to organophosphate (OP) pesticides on adverse reproductive outcomes in both men and women in agricultural workers. Married never-smoking women age 20-34 who currently work in Haikou Township, Anqing, who have obtained permission to have a child, and who will be attempting to become pregnant over the course of the study will be eligible for the study. Reproductive endpoints will include (1) semen parameters (concentration, total count, motility, progression and morphology), (2) menstrual disorders (oligomenorrhea, amenorrhea, polymenorrhea, intermenstrual bleeding, prolonged menstrual bleeding, dysmenorrhea, and irregular menstruation); (3) alterations in hormone patterns including reduced estrogen excretion (REE), anovulation, abnormal luteal phase (ALP), and abnormal follicular phase (AFP) in women and abnormalities of LH, FSH, TSH, SHBG, inhibin-B and testosterone in men; (4) fecundability; and (5) pregnancy outcomes including spontaneous abortion, preterm delivery, low birth weight and intrauterine growth retardation. After enrollment, interviewers will administer a previously validated questionnaire to the women and their husbands to collect baseline information on sociodemographic, environmental, occupational, and personal covariates. Semen samples will be obtained by trained technicians at enrollment and again four months later. Each woman will keep a diary of her menstrual information, environmental exposures, and dietary intake. Daily urine samples will be collected from each female subject for up to one year or until a pregnancy occurs. Urinary PdG, EIC, LH, FSH and hCG will be measured to identify abnormal endocrine patterns and subclinical pregnancy. Once a woman becomes pregnant, she will be followed for pregnancy outcomes obtained from a follow-up survey and hospital records where the baby is delivered. Extensive exposure assessment will be conducted throughout the follow-up period and, therefore, dose-response relationships can be established. All participants will keep daily exposure diaries. Urine samples will be measured for metabolites on selected exposure days. A subset of participants will be studied for personal air monitoring and serial analysis of urine metabolites to validate the exposure diary and urine metabolite assay. The investigators state that the proposed study has several strengths: (1) it will be conducted in a population with a broad range of organophosphate pesticide exposure; (2) exposure will be well-characterized; (3) each woman and her husband will be studied simultaneously; (4) the prospective study design can eliminate certain flaws or potential biases in previous retrospective studies; (5) time to conception and spontaneous abortion will be evaluated with the improved specific hCG assay, which can detect pregnancy within a few days of implantation; (6) recently-developed biomarkers, including urinary hormone assays and FISH methods, will be applied to the study; (7) gene-environment interactions will be tested; (8) the field cost in China is much lower than that in the U.S.; and (9) the population possesses unique characteristics for examining the proposed hypothesis, i.e., a stable workforce, a non-smoking group and excellent compliance rates. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen

18

•

Anovulation

Project Title: OVARIAN ANDROGEN PRODUCTION AND FOLLICULAR FUNCTION Principal Investigator & Institution: Menon, Jairam K.; Professor; Obstetrics and Gynecology; University of Michigan at Ann Arbor 3003 South State, Room 1040 Ann Arbor, Mi 481091274 Timing: Fiscal Year 2002; Project Start 01-JUL-2000; Project End 30-JUN-2005 Summary: The overall goal of this proposal is to examine the molecular basis for the development of hyperandrogenic states and consequent impairment of follicular function. Ovarian hyperandrogenism leads to ovulatory dysfunction including anovulation and infertility. In some cases such as polycystic ovarian syndrome, hyperandrogenism usually accompanies increased insulin resistance resulting in elevated insulin levels, and increased IGF-1 system. The altered endocrine and paracrine milieu results in increased androgen production by theca-interstitial cells, ovarian hyperplasia and loss of ovulatory capacity of the follicles. The objective of this proposal is to examine the cellular mechanisms responsible for hyperandrogenism and the resultant effects of excess androgen exposure on follicular function. To accomplish this, three specific aims are proposed. Aim 1 will examine the role of increased cholesterol transport into theca-interstitial cells in response to insulin, IGF-1 and LH. This will be tested by examining the induction of HDL and LDL receptor expression in rat thecainterstitial cells by in situ hypbridization and by Northern blot analysis, and by determining the uptake and utilization of cholesterol for androgen synthesis. Aim 2 will examine the cellular mechanism involved in the deleterious effects of androgen exposure on the ovarian follicular function in response to insulin/IGF-1 and FSH. This will be examined by analyzing changes in cell cycle constituents involved in the progression of restriction points in cell cycle, namely cyclins and cyclin-dependent kinases in response to insul/IGF-1 and FSH in androgen exposed follicles. Aim 3 will examine the effect of androgen exposure on the follicular function. This will be determined by examining the signaling of insulin/IGF-1 and FSH in androgen-exposed follicles. The above studies will be carried out in rat and human tissues. The proposed studies address novel questions central to reproductive endocrinology and are directly relevant to the disorders affecting fertility. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen

•

Project Title: PARACRINE DYSREGULATION OF OOCYTE COMPETENCE IN PCOS Principal Investigator & Institution: Dumesic, Daniel A.; Professor; Mayo Clinic Coll of Medicine, Rochester 200 1St St Sw Rochester, Mn 55905 Timing: Fiscal Year 2003; Project Start 01-SEP-2003; Project End 31-AUG-2007 Summary: (provided by applicant): Polycystic ovary syndrome (PCOS) in women is characterized by anovulation, LH hypersecretion, hyperandrogenism and insulin resistance. As the most common endocrinopathy in females, affecting 4-7% of reproductive-aged women, and as a frequent cause of infertility, accounting for 75% of anovulation, PCOS has staggering adverse physiological, psychological and financial consequence on reproduction in women. During gonadotropin stimulation for in vitro fertilization (IVF), PCOS women experience decreased fecundity and increased pregnancy loss. Since experimental investigation of oocyte and embryo development in humans is limited by ethical constraints, we have developed the prenatally androgenized (PA) female rhesus monkey as a model for PCOS. PA female monkeys undergoing follicle stimulating hormone (FSH) therapy for IVF exhibit LH

Studies

19

hypersecretion, circulating insulin excess, an exaggerated shift in intrafollicular steroidogenesis from estradiol (E2) and androstenedione (A4) to progesterone (P4), and impaired embryo development beginning with embryonic genome activation. Because insulin enhances FSH-induced granulose cell differentiation, leading to LH-induced P4 production, we hypothesize that a) premature follicle luteinization and b) impaired oocyte developmental competence in PA monkeys are caused by adverse effects of hyperinsulinemia on follicle maturation. We predict that such abnormalities in PA monkeys are reversed by improved insulin sensitivity from weight loss through dietary restriction and will test our prediction in Specific Aims 1 and 2. Based upon data from our recognized nonhuman primate model of PCOS, we also hypothesize that c) premature follicle luteinization is a cause of poor oocyte developmental competence in PCOS women undergoing FSH therapy for IVF. We predict that granulosa cell dysregulation of LH receptor, insulin receptor (IR) and growth differentiation factor-9 (GDF-9) transcription from premature follicle luteinization causes poor cumulus cell proliferation in PCOS women (Specific Aim 3). We further hypothesize that d) meiotically-competent and meiotically-incompetent oocytes of PCOS patients are impaired in expression of GDF-9 and other developmentally relevant messenger ribonucleic acids (mRNAs) (Specific Aim 4). The long-term objectives of this proposal are to: 1) define molecular markers of oocyte developmental competence that enhance IVF pregnancy outcome by improving rates of embryo cleavage and blastocyst formation; while minimizing pregnancy loss in women with PCOS and other insulin resistant states, such as obesity and Type II diabetes, and 2) to provide additional, unique, insight into the transgenerational effect of PCOS. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen •

Project Title: AMENORRHEA

PATHOGENESIS

OF

FUNCTIONAL

HYPOTHALAMIC

Principal Investigator & Institution: Cameron, Judy L.; Oregon Health & Science University Portland, or 972393098 Timing: Fiscal Year 2002 Summary: The overall goal of this grant is to increase our understanding of the etiology of Functional Hypothalamic Amenorrhea (FHA) and to test several novel treatment regimens for this reproductive disorder. Anovulation is the most common cause of infertility in women and FHA is the most common cause of anovulation. The proximate cause of FHA is insufficient hypothalamic gonadotropin-releasing hormone (GnRH) secretion. However, a constellation of neuroendocrine secretory disturbances attributable to altered hypothalamic function exist. Our current investigation in women and in monkeys implicates dysfunctional attitudes, psychosocial stress, and associated behaviors such as calorie restriction and exercise in the genesis of characteristic hypothalamic-pituitary-adrenal (HPA), HP-thyroidal (HPT), and HP-ovarian (HPO) secretory alterations. Thus, we conceptualize FHA as a state of altered hypothalamic homeostasis caused by synergism between psychogenic challenge and meta boli c compromise. Building on these findings, we hypothesize that cognitive behavior therapy (CBT) aimed at improving attitudes and correcting problematic behaviors will reverse hypothalamic derangements and restore ovulation. One aim of this grant is to test this hypothesis. However, because not all women with FHA will respond to CBT, we are continuing our quest to discern in women and in monkeys the neurobiological mechanisms underlying the synergism between psychogenic and metabolic stressors with the goal of identifying promising pharmacologic interventions. To refine our model of the pathogenesis of FHA, monkey studies are critical to identifying causality and

20

Anovulation

pharmacologic options, while the human studies are integral to testing the efficacy of psychosocial and pharmacologic therapies. An interdisciplinary team of established investigators is working on these combined clinical and basic studies, with expertise in the areas of psychiatry, behavioral medicine, exercise physiology, neurobiology, and reproductive endocrinology. New findings this year indicate that monkeys with elevated basal heartrate are more prone to develop stress-induced reproductive dysfunction than monkeys with lower basal heartrate. We are currently examining whether this also holds true for women. FUNDING NIMH MH 50748-05 PUBLICATIONS Cameron JL, Bridges MW, Graham RE, Bench L, Berga SL, Matthews K. Basal heartrate predicts development of reproductive dysfunction in response to psychological stress. In The Endocrine Society Program and Abstracts 80th Annual Meeting (held in New Orleans, LA, June 24-27, 1998), p 138 (abstract #P1-76). Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen •

Project Title: PHYSIOLOGY AND PATHOPHYSIOLOGY OF THE PRIMATE GONAD Principal Investigator & Institution: Plant, Tony M.; Professor; Cell Biology and Physiology; University of Pittsburgh at Pittsburgh 350 Thackeray Hall Pittsburgh, Pa 15260 Timing: Fiscal Year 2002; Project Start 29-SEP-1997; Project End 31-MAR-2005 Summary: The mission of the proposed Specialized Cooperative Center in Reproduction at the University of Pittsburgh Medical School is to study, by integrating molecular, cellular and system approaches, the physiological mechanisms that govern gonadal function in primates, and to investigate the pathophysiological bases of specific states of human infertility where parallel and interactive studies of non-human primates are likely to be particularly rewarding. This mission reflects the long- standing forte of this Center to employ non-human primate models to better understand the physiology of reproduction in man. The Center will be comprised of 3 Technical Service Cores (Primate, Assay and Cell Imaging) with an open access format to subserve U54 Projects and additional programs supported by either R01 (7) or R29(1) grants. The U54 Projects focus on the control of gonadal function in primates. Conceptually, they are tightly linked by the theme that FSH plays a fundamental role in the regulation of both ovarian and testicular function, and that the study of the control, and mechanism of action, of this gonadotropin will provide insight into treatment of infertility in men and women. Moreover, it is anticipated that advance sin one project will impact upon the others, and this is exemplified by projects I and II. The first of which will examine the roles of hyperinsulinemia and hyperandrogenemia in producing aberrant patterns of gonadotropin secretion (increased LH:FSH ratios in association with elevated LH pulse frequency) and anovulation in women with polycystic ovarian syndrome. This clinical endeavor is placed in tandem is placed in tandem with a project employing a nonhuman primate model to examine the action of insulin and androgen on the pituitary/ovarian axis in normal ovulatory monkeys. The remaining U54 projects also employs non-human primate model. It examines the control mechanism whereby sperm production is governed by the FSH-inhibition B feedback loop. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen

•

Project Title: REGULATION OF GNRH DRIVE IN PCOS Principal Investigator & Institution: Berga, Sarah L.; Professor and Chair; University of Pittsburgh at Pittsburgh 350 Thackeray Hall Pittsburgh, Pa 15260

Studies

21

Timing: Fiscal Year 2002 Summary: Polycystic ovary syndrome (PCOS) is classically defined as chronic anovulation in the presence of hyperandrogenism of ovarian origin. More recently, PCOS has been associated with insulin resistance and hyperinsulinemia. Because hyperandrogenism and insulin resistance the independent role of each in the genesis of anovulation remains unclear. Since the development of safe and convenient therapies to restore ovulation depends on identifying the cause(s), the aim of this project is to clarify to what extent hyperandrogenism and insulin resistance independently contribute to anovulation in PCOS. The proximate cause of anovulation in PCOS is aberrant gonadotropin secretion characterized by elevated circulating LH and insufficient FSH to sustain folliculogenesis. A likely cause of the altered LH/FSH ratio is a rapid GnRH pulse frequency (as reflected by increased LH pulse frequency). To determine the cause of anovulation in women with PCOS, we will investigate the roles of hyperandrogenism and hyperinsulinemia in the maintenance of rapid LH pulse frequency and reduced LH secretion by: [1] reducing androgen action with the androgen receptor blocker, flutamide; [2] by improving insulin resistance insulin resistance with the insulin sensitizer, troglitazone; and [3] by comparing the effects of pharmacologic intervention to placebo. Non-obese women with PCOS will be studied because these pharmacological agents are more likely to reduce androgen action or restore insulin sensitivity in relatively lean women. The use of a non-obese population will afford a clearer test of concept regarding the pathogenesis of anovulation in PCOS and the results of this study will be directly relevant to the treatment of infertility in women with PCOS. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen •

Project Title: REPRODUCTIVE ANDROGENIZATION

CONSEQUENCES

OF

PRENATAL

Principal Investigator & Institution: Padmanabhan, Vasantha; Professor of Pediatrics; Pediatrics & Communicable Dis; University of Michigan at Ann Arbor 3003 South State, Room 1040 Ann Arbor, Mi 481091274 Timing: Fiscal Year 2002; Project Start 08-AUG-2001; Project End 31-MAY-2006 Summary: Polycystic ovarian syndrome (PCOS) is the most common endocrinopathy and it affects 10 percent of reproductive-aged women. The etiology of chronic hyperandrogenic anovulations, such as PCOS, may have genetic underpinnings. Although the underlying mechanisms are unknown, PCOS is now recognized as hyperandrogenism accompanied by anovulation. Polycystic ovarian morphology is highly correlated with conditions in which the fetus has been exposed to high amounts of sex steroids before birth. For example, women with classical 21-hydroxylase deficiency mimic PCOS, exhibit anovulation, ovarian hyperandrogenism, and LH hypersecretion. Perhaps excess sex steroids early in life may provide a hormonal "insult" that results in manifestation of PCOS later in adulthood. This proposal aims to use a new model, the prenatally-androgenized sheep (long gestation, mono-ovular species), to investigate causal mechanisms for the developmental origins of PCOS. Our preliminary studies indicate that these sheep develop ovulatory defects during adulthood similar to those of women with PCOS: anovulation, elevated LH levels, hyperandrogenemia, hyperinsulinemia, and multifollicular ovaries. In this proposal, we will test the following hypothesis: prenatal exposure to androgens disrupts adult reproductive function culminating in hyperandrogenic anovulation and that this disruption is mediated via reduced sensitivity to the positive feedback actions of estradiol, abnormal gonadotropic drive and/or altered ovarian sensitivity to FSH. The specific Aims of the

22

Anovulation

proposed research are to determine 1) the extent to which fetal exposure to androgens disrupts reproductive cyclicity, ovarian function, ovulatory capacity and fertility in adulthood, (2) if reduced sensitivity to estradiol stimulatory feedback of gonadotropin secretion contributes to the disruptive effects of prenatal- androgenization on postnatal reproductive cyclicity, and (3) if abnormal gonadotropic drive and/or reduced ovarian sensitivity to FSH contributes to the disruptive effects of prenatal- androgenization on postnatal reproductive cyclicity. If our hyposthesis proves to be correct, this would form the basis for a distinct developmental origin of an important reproductive disease in adulthood. Specifically it will establish that discrete, experimentally induced androgen excess of fetal sheep provides the first clear etiology for hyperandrogenic anovulation in adulthood. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen •

Project Title: REPRODUCTIVE PHYSIOLOGY OF OVARIAN FAILURE Principal Investigator & Institution: Santoro, Nanette F.; Professor and Director; Ob/Gyn & Women's Health; Yeshiva University 500 W 185Th St New York, Ny 10033 Timing: Fiscal Year 2002; Project Start 15-AUG-1994; Project End 31-MAR-2004 Summary: Our group has previously reported striking increases in estrogen secretin and excretion in women in the early stage of the menopause transition. The causes of he shortened follicular phases, increased whole cycle estrogen, and decreased progesterone in perimenopause, as well as the consequences of this altered reproductive hormonal environment on the hypothalamic-pituitary and endometrial axes are the focus of this continuing renewal. We propose 3 Specific Aims: Aims 1 will determine the association of elevated FSH in the perimenopause with decreased inhibin A and B, and with increases in circulating activin A. In Aim 2, we will test the hypothesis that increased estrogen secretion in perimenopausal cycles will caused increased menstrual bleeding. We will also determine whether increased estradiol exposure causes increased endometrial angiogenesis and proliferation as assessed immunohistochemically. We will test the hypothesis that abundance and location of ER alpha and beta subtypes differ between perimenopausal and mid-productive aged women's endometrium. Aim 3 will test the hypothesis that perimenopausal anovulation is caused by LH surge failure secondary to supraphysiologic estradiol stimulation. We will administer physiologic and supraphysiologic estradiol by infusion and test the resulting LH surge. We will also test directly pituitary sensitivity to exogenous LH in estradiol primed perimenopausal women to determine if there id reduced positive feedback sensitivity in perimenopausal women to determine if there is reduced positive feedback sensitivity in perimenopausal women. In this manner, we hope to elucidate the critical mechanisms that may cause or be the consequence of the hormonal dynamics of the early stages of the menopausal transition. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen

•

Project Title: RISK OF CHD IN WOMEN WITH POLYCYSTIC OVARY SYNDROME Principal Investigator & Institution: Talbott, Evelyn O.; Faculty; Epidemiology; University of Pittsburgh at Pittsburgh 350 Thackeray Hall Pittsburgh, Pa 15260 Timing: Fiscal Year 2002; Project Start 30-SEP-2000; Project End 31-AUG-2004 Summary: (Adapted from the Investigator's Abstract) Polycystic ovary syndrome (PCOS), characterized by chronic anovulation, hyperandrogenism, and insulin resistance, is estimated to affect four percent to eight percent of all women. In 1992, the investigators initiated the first large-scale study of cardiovascular risk factors in women

Studies

23

with PCOS (1992-1994). They recruited 244 women with PCOS and 244 age-, race- and neighborhood-matched controls age (19-50 years of age) and determined that PCOS cases had a profile that conferred increased cardiovascular risk (increased LDLc, triglycerides, and waist/hip ratio, obesity, decreased HDLc, hyperinsulinemia, and increased diastolic and systolic blood pressure). During phase II, (1996-99) they investigated the prevalence of subclinical atherosclerosis (SCA) of the carotid arteries in women 30+ years of age from the original cohort. In preliminary analyses, PCOS cases 45+ years had significantly higher mean intima-media wall thickness (IMT) than controls (0.75mm vs. 0.70mm, p=40 years from the original cohort to determine if PCOS cases have greater initial coronary or aortic calcification and/or greater progression during years 4 and 5, 2) evaluate the progression of carotid atherosclerosis over a 5-year period of PCOS cases and controls >=40 years who participated in Phase II of the study, 3) evaluate whether CHD risk factors can be linked to the extent of coronary and aortic calcification within cases and controls, 4) evaluate vascular stiffness in PCOS cases and controls and determine CHD risk factors for aortic stiffness, and 5) evaluate endothelial function in PCOS cases and controls and changes over five years. CHD risk factors will include: HDLt, LDLc, triglycerides, glucose, insulin, Lp(a), PAI-1, blood pressure, and anthropometric measures. Information will be obtained on medical, reproductive and physical activity history. The investigators state that this study has the potential to identify the determinants of early SCA in this high-risk group of women and has important implications for primary as well as secondary prevention. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen •

Project Title: INDUCTION

ROSIGLITAZONE

AND

CLOMIPHENE

FOR

OVULATION

Principal Investigator & Institution: Cataldo, Nicholas A.; Assistant Professor of Obstetrics and Gy; Gynecology and Obstetrics; Stanford University Stanford, Ca 94305 Timing: Fiscal Year 2002; Project Start 01-AUG-2001; Project End 31-JUL-2004 Summary: This proposal will evaluate the effectiveness of a new drug combination, rosiglitazone and clomiphene, for the induction of ovulation in anovulatory women with polycystic ovary syndrome (PCOS). PCOS is a disorder affecting about 5% of women of reproductive age, characterized by anovulation with loss of menstrual cyclicity and hyperandrogenism, often resulting in hirsutism or acne. Anovulation leads to spontaneous infertility and poses a risk of endometrial carcinoma if untreated. A majority of women with PCOS have peripheral insulin resistance and compensatory hyperinsulinemia. These abnormalities may lead to a long-term increased rish of Type 2 diabetes mellitus, hypertension, and accelerated atherosclerosis. Induction of ovulation is necessary to restore fertility to women with PCOS. The standard initial treatment is oral clomiphene citrate, a selective estrogen-receptor modulator which increases endogenous FSH secretion. Clomiphene is successful in inducing ovulation in only about 70% of women with PCOS, and failure is associated with hyperinsulinemia. Women who fail clomiphene ovulation induction are usually treated with parenteral FSH, but this is associated with a greater risk than clomiphene of both multiple gestation and ovarian hyperstimulation syndrome, which in its severe form can be lifethreatening. This study will examine whether clomiphene can be more effective in inducing ovulation in women with PCOS when given concomitantly with rosiglitazone, an insulin sensitizer which lowers circulating insulin levels. Women with PCOS selected for previous resistance to clomiphene ovulation induction will be randomized to receive either rosiglitazone or placebo in double-bind fashion for 6 weeks, and then will undergo attempted ovulation induction with clomiphene. If unsuccessful, the

24

Anovulation

clomiphene dose will be increased in up to 2 subsequent cycles in standard fashion in an effort to achieve ovulation. Spontaneous and clomiphene-induced ovulatory outcomes, assessed by serum progesterone levels, will be compared between rosiglitazone and placebo groups and correlated with changes in hyperinsulinemia, assessed on oral glucose tolerance testing (OGTT), and with changes in baseline LH, total and free testosterone, sex hormone binding globulin (SHBG), and insulin-like growth factor binding protein-1 (IGFBP-1) levels. The effects of rosiglitazone on insulin secretion on OGTT will be correlated with its effects on the levels of the above hormones and binding proteins. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen •

Project Title: THE MOLECULAR PRODUCTION

BASIS

OF

OVARIAN

TESTOSTERONE

Principal Investigator & Institution: Rosenfield, Robert L.; Professor of Pediatrics; Pediatrics; University of Chicago 5801 S Ellis Ave Chicago, Il 60637 Timing: Fiscal Year 2002; Project Start 01-JUN-2001; Project End 31-MAY-2005 Summary: (Scanned from the applicant's abstract) Polycystic ovary syndrome (PCOS) is a poorly understood syndrome of chronic hyperandrogenism and anovulation which appears to be due to dysregulation of steroidogenesis resulting in a high level of serum testosterone. Testosterone biosynthesis from androstenedione is carried out by androgenic 17b-hydroxysteroid dehydrogenase (17B-HSD) activity. The molecular basis for androgenic 17B-HSD activity within the ovary was unknown until we recently demonstrated that 17B-HSD5 is expressed in human ovary. In addition, a number of structural variants of 17B-HSD5 exist and appear to vary in activities. We propose to characterize the cell-specific expression of the 17B-HSD5 gene in the ovary, the regulation of expression of the gene in the ovary, and determine if candidate activating gene variants, which seem to be fairly common, are related hyperandrogenic states such as PCOS, all of which are unknown. The specific aims are to test the hypotheses that: 1) ovarian 17B-HSD5 is mainly expressed in theca-interstitial-stromal (thecal) cells. 2) 17BHSD5 in thecal cells is regulated by LH and that insulin modulates this effect. 3) activating variants of the 17B-HSD5 gene contribute to hyperandrogenism in women and that a specific phenotype is associated with these variants. The experimental design to test these hypotheses is as follows: 1) The localization of 17B-HSD5 gene expression will be determined in ovarian tissue by using in situ polymerase chain reaction (PCR) hybridization, reverse transcriptase PCR, and Northern techniques. 2) LH-regulahon of the 17B-HSD5 gene in thecal cells will be examined by analysis of constructs of the 5untranslated region of the 17B-HSD5 gene, which will be subcloned into pGL3-reporter plasmids and transfected into thecal cells to monitor luciferase activity. 3) We will then functionally characterize candidate activating 17B-HSD gene variants by a variety of molecular and enzymatic techniques and determine the clinical significance of such these variants. The latter will be done in three ways: a) first, we will seek to identify candidate variants by comparing the sequence of the 17B-HSD5 gene in wellcharacterized normal women and women with diverse forms of PCOS (classic and nonclassic), b) then we will determine whether each candidate variant is associated with specific hyperandrogenic indices by comparison of its prevalence in hyperandrogenic and control populations and through use of family data, and c) finally, we will correlate genotype with phenotype using both case-control and family-based data. The overall goal of this proposal is to understand the factors regulating the production of testosterone in women, particularly in their ovaries. Website: http://crisp.cit.nih.gov/crisp/Crisp_Query.Generate_Screen

Studies

25

The National Library of Medicine: PubMed One of the quickest and most comprehensive ways to find academic studies in both English and other languages is to use PubMed, maintained by the National Library of Medicine.3 The advantage of PubMed over previously mentioned sources is that it covers a greater number of domestic and foreign references. It is also free to use. If the publisher has a Web site that offers full text of its journals, PubMed will provide links to that site, as well as to sites offering other related data. User registration, a subscription fee, or some other type of fee may be required to access the full text of articles in some journals. To generate your own bibliography of studies dealing with anovulation, simply go to the PubMed Web site at http://www.ncbi.nlm.nih.gov/pubmed. Type “anovulation” (or synonyms) into the search box, and click “Go.” The following is the type of output you can expect from PubMed for anovulation (hyperlinks lead to article summaries): •

A comparative prospective study of conventional regimen with chronic low-dose administration of follicle-stimulating hormone for anovulation associated with polycystic ovary syndrome. Author(s): Homburg R, Levy T, Ben-Rafael Z. Source: Fertility and Sterility. 1995 April; 63(4): 729-33. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=7890055

•

A dopamine D3 receptor genotype is associated with hyperandrogenic chronic anovulation and resistant to ovulation induction with clomiphene citrate in female Hispanics. Author(s): Legro RS, Muhleman DR, Comings DE, Lobo RA, Kovacs BW. Source: Fertility and Sterility. 1995 April; 63(4): 779-84. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=7890062

•

A method of bilateral ovarian biopsy at laparoscopy in infertility and chronic anovulation. Author(s): Neuwirth RS. Source: Fertility and Sterility. 1972 May; 23(5): 361-6. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=4260251

•

A randomized clinical trial of treatment of clomiphene citrate-resistant anovulation with the use of oral contraceptive pill suppression and repeat clomiphene citrate treatment. Author(s): Branigan EF, Estes MA. Source: American Journal of Obstetrics and Gynecology. 2003 June; 188(6): 1424-8; Discussion 1429-30. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=12824973

3 PubMed was developed by the National Center for Biotechnology Information (NCBI) at the National Library of Medicine (NLM) at the National Institutes of Health (NIH). The PubMed database was developed in conjunction with publishers of biomedical literature as a search tool for accessing literature citations and linking to full-text journal articles at Web sites of participating publishers. Publishers that participate in PubMed supply NLM with their citations electronically prior to or at the time of publication.

26

Anovulation

•

Additive effects of insulin-sensitizing and anti-androgen treatment in young, nonobese women with hyperinsulinism, hyperandrogenism, dyslipidemia, and anovulation. Author(s): Ibanez L, Valls C, Ferrer A, Ong K, Dunger DB, De Zegher F. Source: The Journal of Clinical Endocrinology and Metabolism. 2002 June; 87(6): 2870-4. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=12050266

•

Alteration of follicle regulatory protein levels in human reproductive disorders: anovulation. Author(s): Lew MW, Katt EL, Rodgers KE, diZerega GS. Source: Obstetrics and Gynecology. 1987 August; 70(2): 157-62. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=3601276

•

Altered neuroendocrine status of middle-aged rats prior to the onset of senescent anovulation. Author(s): Wilkes MM, Lu KH, Hopper BR, Yen SS. Source: Neuroendocrinology. 1979; 29(4): 255-61. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=514454

•

Amenorrhea and chronic anovulation. Finding and addressing the underlying cause. Author(s): Galle PC, McRae MA. Source: Postgraduate Medicine. 1992 August; 92(2): 255-60. Review. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=1495882

•

An assessment of urinary and plasma steroid estimations for monitoring treatment of anovulation with gonadotrophins. Author(s): Black WP, Coutts JR, Dodson KS, Rao LG. Source: J Obstet Gynaecol Br Commonw. 1974 September; 81(9): 667-75. No Abstract Available. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=4411958

•

Analysis of variables in treatment of anovulation with human gonadotrophins. Author(s): Bertrand PV, Butt WR, Crooke AC, Sutaria UD. Source: Endocrinol Exp. 1976; 10(4): 271-81. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=1087228

•

Anovulation after precocious pubarche: early markers and time course in adolescence. Author(s): Ibanez L, de Zegher F, Potau N. Source: The Journal of Clinical Endocrinology and Metabolism. 1999 August; 84(8): 2691-5. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=10443661

Studies

27

•

Anovulation and cancer. Author(s): Speroff L. Source: Obstetrics and Gynecology. 1984 February; 63(2): 269-70. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=6694826

•

Anovulation and increased androgenic activity as breast cancer risk in women with fibrocystic disease of the breast. Author(s): Gratterola R. Source: Cancer Research. 1978 September; 38(9): 3051-4. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=679211

•

Anovulation and monophasic cycles. Author(s): Spence JE. Source: Annals of the New York Academy of Sciences. 1997 June 17; 816: 173-6. Review. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=9238267

•

Anovulation following use of oral contraceptives. A review. Author(s): Halbert DR. Source: N C Med J. 1971 September; 32(9): 379-83. No Abstract Available. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=5286056

•

Anovulation in eumenorrheic, nonobese adolescent girls born small for gestational age: insulin sensitization induces ovulation, increases lean body mass, and reduces abdominal fat excess, dyslipidemia, and subclinical hyperandrogenism. Author(s): Ibanez L, Potau N, Ferrer A, Rodriguez-Hierro F, Marcos MV, De Zegher F. Source: The Journal of Clinical Endocrinology and Metabolism. 2002 December; 87(12): 5702-5. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=12466374

•

Anovulation or oligoovulation. Treatment--hazards and precautions. Author(s): Taymor ML. Source: Calif Med. 1972 April; 116(4): 57. No Abstract Available. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=5019105

•

Anovulation presumably due to the gonadotrophin-resistant ovary syndrome. Author(s): Lim HT, Meinders AE, de Haan LD, Bronkhorst FB. Source: European Journal of Obstetrics, Gynecology, and Reproductive Biology. 1984 January; 16(5): 327-37. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=6705963

28

Anovulation

•

Anovulation treated with clomiphene. Author(s): Nakano R. Source: Fertility and Sterility. 1979 March; 31(3): 354. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=437174

•

Anovulation with estrogen production: receptor disorders? Author(s): Bolton RA, Coulam CB, Ryan RJ. Source: Obstetrics and Gynecology. 1980 September; 56(3): 344-8. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=6252524

•

Anovulation, inadequate luteal phase and poor sperm penetration in cervical mucus during prolonged use of Norplant implants. Author(s): Brache V, Faundes A, Johansson E, Alvarez F. Source: Contraception. 1985 March; 31(3): 261-73. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=3922675

•

Anovulation. Author(s): Insler V, Lunenfeld B. Source: Contrib Gynecol Obstet. 1978; 4: 6-77. No Abstract Available. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=354866

•

Anovulation. Author(s): Hamilton-Fairley D, Taylor A. Source: Bmj (Clinical Research Ed.). 2003 September 6; 327(7414): 546-9. Review. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=12958117

•

Anovulation. What price fertility? Author(s): Karp L. Source: Obstetrics and Gynecology. 1972 October; 40(4): 618-20. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=5073459

•

Anovulation: etiology, evaluation and management. Author(s): Padilla SL, Craft KS. Source: The Nurse Practitioner. 1985 December; 10(12): 28-30, 33-4, 43-4. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=3935988

•

Anovulation: etiology, investigation and treatment. Author(s): Florio P, Gregori CA, Breen JL. Source: J Med Soc N J. 1978 January; 75(1): 21-32. No Abstract Available. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=271235

Studies

29

•

Are there two types of postpill anovulation? Author(s): Harlap S. Source: Fertility and Sterility. 1979 May; 31(5): 486-91. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=571816

•

Association of dopamine D2 receptor gene haplotypes with anovulation and fecundity in female Hispanics. Author(s): Legro RS, Dietz GW, Comings DE, Lobo RA, Kovacs BW. Source: Human Reproduction (Oxford, England). 1994 July; 9(7): 1271-5. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=7962432

•

Atmospheric temperature & anovulation in south Indian women with primary infertility. Author(s): Rameshkumar K, Thomas JA, Mohammed A. Source: The Indian Journal of Medical Research. 1992 February; 96: 27-8. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=1597328

•

Bromocriptine for induction of ovulation in normoprolactinaemic post-pill anovulation. Author(s): van der Steeg HJ, Bennink HJ. Source: Lancet. 1977 March 5; 1(8010): 502-4. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=65607

•

Bromocriptine treatment in anovulation with decreased ratio of follicle stimulating hormone to luteinizing hormone and with hyperandrogenism. Author(s): Suginami H, Kuroda G, Yano K, Kitagawa H, Matsuura S. Source: Endocrinol Jpn. 1988 February; 35(1): 47-55. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=2969329

•

Changing pituitary reactivity to follicle-stimulating hormone and luteinizing hormone-releasing hormone after induced ovulatory cycles and after anovulation in patients with polycystic ovarian disease. Author(s): Blankstein J, Rabinovici J, Goldenberg M, Shaley J, Mehta A, Serr DM, Mashiach S. Source: The Journal of Clinical Endocrinology and Metabolism. 1987 December; 65(6): 1164-7. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=3119650

•

Chronic anovulation due to prolactin hypersecretion. Author(s): Palermo R, Albano C, Mangione D, Napoli P. Source: Acta Eur Fertil. 1994 May-June; 25(3): 161-72. Review. No Abstract Available. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=7900499

30

Anovulation

•

Chronic anovulation may increase postmenopausal breast cancer risk. Author(s): Gonzalez ER. Source: Jama : the Journal of the American Medical Association. 1983 January 28; 249(4): 445-6. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=6848834

•

Chronic anovulation syndrome and associated neoplasia. Author(s): Coulam CB, Annegers JF, Kranz JS. Source: Obstetrics and Gynecology. 1983 April; 61(4): 403-7. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=6828267

•

Chronic anovulation. Author(s): Kim MH, Chang FE. Source: Clinical Obstetrics and Gynecology. 1984 December; 27(4): 941-52. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=6241119

•

Circadian variations of luteinizing hormone can have two different profiles in adolescent anovulation. Author(s): Porcu E, Venturoli S, Magrini O, Bolzani R, Gabbi D, Paradisi R, Fabbri R, Flamigni C. Source: The Journal of Clinical Endocrinology and Metabolism. 1987 September; 65(3): 488-93. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=3114303

•

Clinical and endocrine response to pulsatile intravenous gonadotropins in refractory anovulation. Author(s): Yuen BH, Pride SM, Callegari PB, Leroux AM, Moon YS. Source: Obstetrics and Gynecology. 1989 November; 74(5): 763-8. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=2510103

•

Clinical and hormonal characteristics in women with anovulation and insulin-treated diabetes mellitus. Author(s): Djursing H, Nyholm HC, Hagen C, Carstensen L, Pedersen LM. Source: American Journal of Obstetrics and Gynecology. 1982 August 15; 143(8): 876-82. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=7102763

•

Clinical effects of clomiphene in anovulation. Author(s): Lamb EJ, Guderian AM. Source: Obstetrics and Gynecology. 1966 October; 28(4): 505-12. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=5925037

Studies

31

•

Clinical evidence for an LH 'ceiling' effect induced by administration of recombinant human LH during the late follicular phase of stimulated cycles in World Health Organization type I and type II anovulation. Author(s): Loumaye E, Engrand P, Shoham Z, Hillier SG, Baird DT. Source: Human Reproduction (Oxford, England). 2003 February; 18(2): 314-22. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=12571167

•

Clinical results with human gonadotrophins in anovulation, using two alternative dosage schemes. Author(s): Butler JK. Source: Postgraduate Medical Journal. 1972 January; 48(555): 27-32. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=5014975

•

Combined medical and surgical treatment for transverse vaginal septum associated with anovulation. Author(s): Beyth Y, Mor-Yosef S. Source: Fertility and Sterility. 1982 May; 37(5): 704-6. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=7075804

•

Comparison between tamoxifen and clomiphene therapy in women with anovulation. Author(s): Gerhard I, Runnebaum B. Source: Arch Gynecol. 1979; 227(4): 279-88. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=518130

•

Current concepts in the treatment of anovulation. Author(s): Rabau E, Serr DM, Mashiach S, Insler V, Salomy M, Lunenfeld B. Source: British Medical Journal. 1967 November 25; 4(577): 446-9. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=6069754

•

Daily measurements of salivary progesterone reveal a high rate of anovulation in healthy students. Author(s): Vuorento T, Lahti A, Hovatta O, Huhtaniemi I. Source: Scandinavian Journal of Clinical and Laboratory Investigation. 1989 June; 49(4): 395-401. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=2740829

•

Dehydroepiandrosterone sulfate and anovulation increase serum inhibin and affect follicular function during administration of gonadotropins. Author(s): Haning RV Jr, Hua JJ, Hackett RJ, Wheeler CA, Frishman GN, Seifer DB, Dahl CA, Burger HG. Source: The Journal of Clinical Endocrinology and Metabolism. 1994 January; 78(1): 1459. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=8288697

32

Anovulation

•

Depressed prolactin levels in diabetic women with anovulation. Author(s): Djursing H, Nyholm HC, Hagen C, Molsted-Pedersen L. Source: Acta Obstetricia Et Gynecologica Scandinavica. 1982; 61(5): 403-6. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=6818826

•

Differential expression of T-helper cytokines in the peritoneal fluid of women with normal ovarian cycle compared with women with chronic anovulation. Author(s): Omu AE, Al-Azemi MK, Makhseed M, Al-Oattan F, Ismail AA, Al-Tahir S, Al-Busiri N. Source: Acta Obstetricia Et Gynecologica Scandinavica. 2003 July; 82(7): 603-9. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=12790840

•

Does anovulation exist in eumenorrheic women? Author(s): Malcolm CE, Cumming DC. Source: Obstetrics and Gynecology. 2003 August; 102(2): 317-8. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=12907106

•

Does anovulation induced by oral contraceptives favor pregnancy during the following two menstrual cycles? Author(s): Fukuda M, Fukuda K, Yding Andersen C, Byskov AG. Source: Fertility and Sterility. 2000 April; 73(4): 742-7. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=10731535

•

Ectopic luteinizing hormone secretion and anovulation. Author(s): Hirshberg B, Conn PM, Uwaifo GI, Blauer KL, Clark BD, Nieman LK. Source: The New England Journal of Medicine. 2003 January 23; 348(4): 312-7. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=12540644

•

Effects of a dopamine antagonist on the release of gonadotropin and prolactin in normal women and women with hyperprolactinemic anovulation. Author(s): Quigley ME, Judd SJ, Gilliland GB, Yen SS. Source: The Journal of Clinical Endocrinology and Metabolism. 1979 April; 48(4): 718-20. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=429515

•

Endocrine aspects of anovulation. Author(s): Jacobs HS. Source: Postgraduate Medical Journal. 1975 April; 51(594): 209-14. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=1197149

Studies

33

•

Endometrial carcinoma following chronic anovulation in a premenopausal woman with systemic lupus erythematosus. Author(s): Sekiya S, Iwasaki H, Takeda B, Takamizawa H. Source: Acta Obstetricia Et Gynecologica Scandinavica. 1988; 67(6): 553-6. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=3239388

•

Endometriosis and anovulation: a coexisting problem in the infertile female. Author(s): Soules MR, Makinak LR, Bury R, Poindexter A. Source: American Journal of Obstetrics and Gynecology. 1976 June 1; 125(3): 412-7. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=1275031

•

Estimated prevalence of undiagnosed glucose intolerance from hyperandrogenic anovulation among women requesting electrolysis. Author(s): Dumesic DA, Herrmann RR, O'Brien AM. Source: Int J Fertil Womens Med. 1997 July-August; 42(4): 255-60. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=9309459

•

Estrogen provocation test: lack of correlation between LH and 17-beta-estradiol basal levels and LH peak response in hypothalamic chronic anovulation. Author(s): Jasonni VM, Bulletti C, Cristiani P, Fuschini G, Ferraretti AP, Bonavia M, Flamigni C. Source: Acta Eur Fertil. 1982 June; 13(2): 101-4. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=6764580

•

Estrogen-androgen balance in anovulation. Author(s): Wu CH, Motohashi T, Abdel-Rahman HA, Mikhail G. Source: Fertility and Sterility. 1981 July; 36(1): 61-7. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=7195829

•

Etiology of anovulation in polycystic ovary syndrome. Author(s): Franks S, Mason H, White D, Willis D. Source: Steroids. 1998 May-June; 63(5-6): 306-7. Review. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=9618791

•

Evidence that estrogen may be a key factor in hyperprolactinemic anovulation: a case report. Author(s): Sakamoto H, Den K, Kondo Y, Tsubata K, Takagi S. Source: American Journal of Obstetrics and Gynecology. 1987 August; 157(2): 318-9. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=3618680

34

Anovulation

•

Extended clomiphene citrate (CC) and prednisone for the treatment of chronic anovulation resistant to CC alone. Author(s): Isaacs JD Jr, Lincoln SR, Cowan BD. Source: Fertility and Sterility. 1997 April; 67(4): 641-3. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=9093187

•

Follicular development and hormone concentrations following recombinant FSH administration for anovulation associated with polycystic ovarian syndrome: prospective, randomized comparison between low-dose step-up and modified stepdown regimens. Author(s): Balasch J, Fabregues F, Creus M, Puerto B, Penarrubia J, Vanrell JA. Source: Human Reproduction (Oxford, England). 2001 April; 16(4): 652-6. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=11278212

•

Frequency of anovulation and early menopause among women enrolled in selected adult AIDS clinical trials group studies. Author(s): Clark RA, Mulligan K, Stamenovic E, Chang B, Watts H, Andersen J, Squires K, Benson C. Source: The Journal of Infectious Diseases. 2001 November 15; 184(10): 1325-7. Epub 2001 October 02. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=11679923

•

Gonadotropin therapy for the treatment of anovulation and for ovarian hyperstimulation for IVF. Author(s): Macklon NS, Fauser BC. Source: Molecular and Cellular Endocrinology. 2002 January 25; 186(2): 159-61. Review. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=11900890

•

High frequency of luteal phase deficiency and anovulation in recreational women runners: blunted elevation in follicle-stimulating hormone observed during lutealfollicular transition. Author(s): De Souza MJ, Miller BE, Loucks AB, Luciano AA, Pescatello LS, Campbell CG, Lasley BL. Source: The Journal of Clinical Endocrinology and Metabolism. 1998 December; 83(12): 4220-32. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=9851755

•

HMG-HCG therapy in patients with hypergonadotropic ovarian anovulation: one pregnancy case report and ovulation and pregnancy rate. Author(s): Tanaka T, Sakuragi N, Fujimoto S, Ichinoe K. Source: Int J Fertil. 1982; 27(2): 100-4. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=6126442

Studies

35

•

Human menopausal gonadotropins for anovulation and sterility. Results of 7 years of treatment. Author(s): Rabau E, David A, Serr DM, Mashiach S, Lunenfeld B. Source: American Journal of Obstetrics and Gynecology. 1967 May 1; 98(1): 92-8. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=6023499

•

Hyperandrogenic anovulation (PCOS): a unique disorder of insulin action associated with an increased risk of non-insulin-dependent diabetes mellitus. Author(s): Dunaif A. Source: The American Journal of Medicine. 1995 January 16; 98(1A): 33S-39S. Review. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=7825639

•

Hyperandrogenic anovulation (the polycystic ovary syndrome)--back to the ovary? Author(s): Ben-Shlomo I, Homburg R, Shalev E. Source: Human Reproduction Update. 1998 May-June; 4(3): 296-300. Review. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=9741712

•

Hypothalamic chronic anovulation. Author(s): Lachelin GC, Yen SS. Source: American Journal of Obstetrics and Gynecology. 1978 April 1; 130(7): 825-31. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=147631

•

Hypothyroidism and anovulation. Author(s): Louvet JP, Gouarre M, Salandini AM, Boulard C. Source: Lancet. 1979 May 12; 1(8124): 1032. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=86746

•

Identification of anovulation and transient luteal function using a urinary pregnanediol-3-glucuronide ratio algorithm. Author(s): Kassam A, Overstreet JW, Snow-Harter C, De Souza MJ, Gold EB, Lasley BL. Source: Environmental Health Perspectives. 1996 April; 104(4): 408-13. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=8732951

•

Improved treatment for anovulation in polycystic ovarian disease utilizing the effect of progesterone on the inappropriate gonadotrophin release and clomiphene response. Author(s): Homburg R, Weissglas L, Goldman J. Source: Human Reproduction (Oxford, England). 1988 April; 3(3): 285-8. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=3131386

36

Anovulation

•

Increased luteinizing hormone and alpha-subunit secretion in women with hyperandrogenic anovulation. Author(s): Berga SL, Guzick DS, Winters SJ. Source: The Journal of Clinical Endocrinology and Metabolism. 1993 October; 77(4): 895901. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=7691863

•

Incremental clomiphene therapy: a new method for treating persistent anovulation. Author(s): O'Herlihy C, Pepperell RJ, Brown JB, Smith MA, Sandri L, McBain JC. Source: Obstetrics and Gynecology. 1981 November; 58(5): 535-42. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=6795551

•

Induced anovulation as treatment of premenstrual tension syndrome. A double-blind cross-over study with GnRH-agonist versus placebo. Author(s): Hammarback S, Backstrom T. Source: Acta Obstetricia Et Gynecologica Scandinavica. 1988; 67(2): 159-66. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=3140572

•

Induction of ovulation with synthetic gonadotrophin-releasing hormone in women with constant anovulation induced by contraceptive steroids. Author(s): Zanartu J, Dabancens A, Rodriguez-Bravo R, Schally AV. Source: British Medical Journal. 1974 March 30; 1(908): 605-8. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=4132247

•

Influence of the frequency of gonadotropin-releasing hormone (GnRH) administration on ovulatory responses in women with anovulation. Author(s): Bringer J, Hedon B, Jaffiol C, Nicolau S, Gibert F, Cristol P, Orsetti A, Viala JL, Mirouze J. Source: Fertility and Sterility. 1985 July; 44(1): 42-8. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=3891425

•

Interpretation of single progesterone measurement in diagnosis of anovulation and defective luteal phase. Author(s): Jeffcoate SL. Source: British Medical Journal (Clinical Research Ed.). 1984 March 17; 288(6420): 864. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=6423124

•

Interpretation of single progesterone measurement in diagnosis of anovulation and defective luteal phase: observations on analysis of the normal range. Author(s): Wathen NC, Perry L, Lilford RJ, Chard T. Source: British Medical Journal (Clinical Research Ed.). 1984 January 7; 288(6410): 7-9. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=6418326

Studies

37

•

Lactational amenorrhea/anovulation and some of their determinants: a comparison of well-nourished and undernourished women. Author(s): Wasalathanthri S, Tennekoon KH. Source: Fertility and Sterility. 2001 August; 76(2): 317-25. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=11476779

•

Laparoscopic surgery of chronic hyperandrogenic anovulation. Author(s): Kaaijk EM, Beek JF, van der Veen F. Source: Lasers in Surgery and Medicine. 1995; 16(3): 292-302. Review. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=7791504

•

Low-dose corticoid therapy for anovulation: effect upon fetal weight. Author(s): Lee F, Nelson N, Faiman C, Choi NW, Reyes FI. Source: Obstetrics and Gynecology. 1982 September; 60(3): 314-7. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=7121912

•

Luteinizing hormone bioactivity and variable responses to clomiphene citrate in chronic anovulation. Author(s): Prough SG, Aksel S, Yeoman R. Source: Fertility and Sterility. 1990 November; 54(5): 799-804. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=2121549

•

Management of anovulation. Author(s): Reyniak JV. Source: The Mount Sinai Journal of Medicine, New York. 1980 January-February; 47(1): 52-6. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=6770252

•

Management of anovulation. Author(s): Adams M, Cooke ID. Source: Clin Obstet Gynaecol. 1974 August; 1(2): 285-311. No Abstract Available. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=4620625

•

Management of infertility resulting from anovulation. Author(s): Jewelewicz R. Source: American Journal of Obstetrics and Gynecology. 1975 August 15; 122(8): 909-20. Review. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=1098465

38

Anovulation

•

Mathematical evaluation of the gonadotropin basal levels in hypothalamic chronic anovulation. Author(s): Jasonni VM, Bulletti C, Fuschini G, Ferraretti AP, Cristiani P, Bonavia M. Source: Acta Eur Fertil. 1982 March; 13(1): 39-41. No Abstract Available. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=7124297

•

Mechanism of anovulation in hyperprolactinemic amenorrhea determined by pulsatile gonadotropin-releasing hormone injection combined with human chorionic gonadotropin. Author(s): Matsuzaki T, Azuma K, Irahara M, Yasui T, Aono T. Source: Fertility and Sterility. 1994 December; 62(6): 1143-9. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=7957976

•

Menstrual cycle changes with marathon training: anovulation and short luteal phase. Author(s): Prior JC, Cameron K, Yuen BH, Thomas J. Source: Can J Appl Sport Sci. 1982 September; 7(3): 173-7. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=7127652

•

Metabolism of ovarian steroids in a patient with chronic familial anovulation. Author(s): Ances IG, Haskins AL, Ganis FM. Source: American Journal of Obstetrics and Gynecology. 1970 December 1; 108(7): 11303. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=4249817

•

Metergoline in the management of hyperprolactinemic amenorrhea and anovulation. Author(s): Falsetti L, Voltolini AM, Crosignani PG, Lotti G, Travaglini P, Faglia G, Cianci A, Palumbo G, Praga C, Pontiroli AE. Source: Gynecologic and Obstetric Investigation. 1982; 13(2): 108-16. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=7035305

•

Modern approaches to the diagnosis and management of anovulation. Author(s): Lunenfeld E, Lunenfeld B. Source: Int J Fertil. 1988 September-October; 33(5): 308, 311-8. Review. No Abstract Available. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=2904416

•

MURCS association and hypothalamic anovulation. Author(s): Pablo Mendez J, Orozco M, Ivan Ruiz A, Orozco E, Diaz L. Source: Revista De Investigacion Clinica; Organo Del Hospital De Enfermedades De La Nutricion. 1992 January-March; 44(1): 115-21. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=1523342

Studies

39

•

Neuroendocrine mechanism of anovulation in users of contraceptive subdermal implant of nomegestrol acetate (Uniplant). Author(s): Barnhart K, Devoto L, Pommer R, Sir-Pettermann T, Robinovic J, Coutinho E. Source: Fertility and Sterility. 1997 February; 67(2): 250-5. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=9022598

•

Normoprolactinemic anovulation nonresponsive to clomiphene citrate: ovulation induction with bromocriptine. Author(s): Porcile A, Gallardo E, Venegas E. Source: Fertility and Sterility. 1990 January; 53(1): 50-5. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=2295347

•

Obesity, polycystic ovary syndrome and anovulation--how are they interrelated? Author(s): Norman RJ. Source: Current Opinion in Obstetrics & Gynecology. 2001 June; 13(3): 323-7. Review. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=11396658

•

Observations on the combination of clomiphene citrate-human menopausal gonadotropin-human chorionic gonadotropin in the management of anovulation. Author(s): Jarrell J, McInnes R, Cooke R, Arronet G. Source: Fertility and Sterility. 1981 June; 35(6): 634-7. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=6788606

•

Oestrogen modulation of gonadotrophin and prolactin release in women with anovulation and their responses to clomiphene. Author(s): Kandeel FR, Butt WR, Rudd BT, Lynch SS, London DR, Edwards RL. Source: Clinical Endocrinology. 1979 June; 10(6): 619-35. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=383317

•

Ovarian function in chronic renal failure: evidence suggesting hypothalamic anovulation. Author(s): Lim VS, Henriquez C, Sievertsen G, Frohman LA. Source: Annals of Internal Medicine. 1980 July; 93(1): 21-7. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=7396309

•

Ovarian multifollicularity, high LH and androgen plasma levels, and anovulation are frequent and strongly linked in adolescent irregular cycles. Author(s): Venturoli S, Porcu E, Fabbri R, Paradisi R, Gammi L, Passarini M, Orsini LF, Flamigni C. Source: Acta Endocrinol (Copenh). 1986 March; 111(3): 368-72. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=3515820

40

Anovulation

•

Ovarian stimulation by human menopausal gonadotrophin in patients with amenorrhoea and anovulation. Author(s): Furuhjelm M, Lunell NO, Odeblad E. Source: Acta Obstetricia Et Gynecologica Scandinavica. 1966; 45(1): 63-87. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=5328320

•

Ovular dysfunction and anovulation. Author(s): Williams WW. Source: Obstetrics and Gynecology. 1970 August; 36(2): 311-4. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=5428497

•

Ovulation induction with pulsatile GnRH in a patient with anovulation of hypothalamic origin and central diabetes insipidus. Author(s): Grana-Barcia M, Liz J, Jimenez E, Novo A, Aguilar J. Source: Gynecological Endocrinology : the Official Journal of the International Society of Gynecological Endocrinology. 1998 June; 12(3): 203-7. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=9675568

•

Pathogenesis of psychogenic amenorrhea and anovulation. Author(s): Igarashi M, Tohma K, Ozawa M, Hosaka H, Matsumoto S. Source: Int J Fertil. 1965 October-December; 10(4): 311-9. No Abstract Available. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=5842642

•

Pathophysiology of anovulation. Author(s): Schaison G. Source: Human Reproduction (Oxford, England). 1988 May; 3(4): 525-30. Review. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=3292572

•

Pathophysiology of anovulation. Author(s): Lasley BL, Judd HL. Source: Clinical Obstetrics and Gynecology. 1978 March; 21(1): 87-97. Review. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=343956

•

Pituitary gonadotropin responsiveness to repeated gonadotropin releasing hormone (GnRH) stimulations in patients with chronic anovulation. Author(s): Rossmanith WG, Schramm S, Benz R, Lauritzen C. Source: Gynecological Endocrinology : the Official Journal of the International Society of Gynecological Endocrinology. 1991 September; 5(3): 185-96. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=1776504

Studies

41

•

Plasma hormone profile in anovulation. Author(s): Wu CH, Mikhail G. Source: Fertility and Sterility. 1979 March; 31(3): 258-66. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=571358

•

Polycystic ovary syndrome/hyperandrogenic chronic anovulation. Author(s): Lobo RA. Source: Adv Endocrinol Metab. 1995; 6: 167-91. Review. No Abstract Available. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=7671095

•

Post-partum anovulation in nursing mothers. Author(s): Taylor HW, Smith RE, Samuels SJ. Source: Journal of Tropical Pediatrics. 1991 December; 37(6): 286-92. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=1791646

•

Post-pill anovulation. Author(s): Pinkerton GD, Carey HM. Source: The Medical Journal of Australia. 1976 February 21; 1(8): 220-2. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=1263979

•

Premature response to luteinizing hormone of granulosa cells from anovulatory women with polycystic ovary syndrome: relevance to mechanism of anovulation. Author(s): Willis DS, Watson H, Mason HD, Galea R, Brincat M, Franks S. Source: The Journal of Clinical Endocrinology and Metabolism. 1998 November; 83(11): 3984-91. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=9814480

•

Prevalence of polycystic ovaries in women with anovulation and idiopathic hirsutism. Author(s): Gordon P, Treasure JL, King EA, Wheeler M, Russell GF. Source: British Medical Journal (Clinical Research Ed.). 1986 October 11; 293(6552): 9567. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=3094734

•

Prevalence of polycystic ovaries in women with anovulation and idiopathic hirsutism. Author(s): Adams J, Polson DW, Franks S. Source: British Medical Journal (Clinical Research Ed.). 1986 August 9; 293(6543): 355-9. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=3089520

42

Anovulation

•

Primary hyperprolactinaemia and chronic anovulation: pathophysiology and management. Author(s): Judd SJ. Source: Clin Reprod Fertil. 1982 June; 1(2): 95-116. Review. No Abstract Available. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=6226352

•

Progestogens versus oestrogens and progestogens for irregular uterine bleeding associated with anovulation. Author(s): Hickey M, Higham J, Fraser IS. Source: Cochrane Database Syst Rev. 2000; (2): Cd001895. Review. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=10796833

•

Progress in the investigation and treatment of anovulation. Author(s): Shearman RP. Source: American Journal of Obstetrics and Gynecology. 1969 February 1; 103(3): 444-63. Review. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=4885438

•

Progressive dosages of clomiphene in hypothalamic anovulation. Author(s): Garcia-Flores RF, Vazquez-Mendez J. Source: Fertility and Sterility. 1984 October; 42(4): 543-7. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=6489538

•

Prolonged anovulation subsequent to oral progestins. Author(s): Rankin RP. Source: American Journal of Obstetrics and Gynecology. 1969 April 1; 103(7): 919-24. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=4180206

•

Pulsatile gonadotropin secretion in women with hypothalamic amenorrhea: evidence that reduced frequency of gonadotropin-releasing hormone secretion is the mechanism of persistent anovulation. Author(s): Reame NE, Sauder SE, Case GD, Kelch RP, Marshall JC. Source: The Journal of Clinical Endocrinology and Metabolism. 1985 November; 61(5): 851-8. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=3900122

Studies

43

•

Recombinant follicle-stimulating hormone (FSH; Puregon) is more efficient than urinary FSH (Metrodin) in women with clomiphene citrate-resistant, normogonadotropic, chronic anovulation: a prospective, multicenter, assessor-blind, randomized, clinical trial. European Puregon Collaborative Anovulation Study Group. Author(s): Coelingh Bennink HJ, Fauser BC, Out HJ. Source: Fertility and Sterility. 1998 January; 69(1): 19-25. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=9457926

•

Relative contributions of anovulation and luteal phase defect to the reduced pregnancy rate of breastfeeding women. Author(s): Diaz S, Cardenas H, Brandeis A, Miranda P, Salvatierra AM, Croxatto HB. Source: Fertility and Sterility. 1992 September; 58(3): 498-503. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=1521642

•

Reproductive adaptations to a large-brained fetus open a vulnerability to anovulation similar to polycystic ovary syndrome. Author(s): Barnett DK, Abbott DH. Source: American Journal of Human Biology : the Official Journal of the Human Biology Council. 2003 May-June; 15(3): 296-319. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=12704707

•

Resistance of gonadotropin releasing hormone drive to sex steroid-induced suppression in hyperandrogenic anovulation. Author(s): Daniels TL, Berga SL. Source: The Journal of Clinical Endocrinology and Metabolism. 1997 December; 82(12): 4179-83. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=9398736

•

Results of treatment of longstanding oligomenorrhea and persistent anovulation with clomiphene citrate. Author(s): Batrinos ML, Panopoulos C, Eustratiades M. Source: Acta Eur Fertil. 1973 December; 4(4): 165-8. No Abstract Available. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=4795075

•

Reversal of persistent anovulation in polycystic ovarian disease by administration of chronic low-dose follicle-stimulating hormone. Author(s): Kamrava MM, Seibel MM, Berger MJ, Thompson I, Taymor ML. Source: Fertility and Sterility. 1982 April; 37(4): 520-3. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=6802679

44

Anovulation

•

Role of androgenic hyperactivity in anovulation. Author(s): Toaff R, Toaff ME, Gould S, Chayen R. Source: Fertility and Sterility. 1978 April; 29(4): 407-13. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=648645

•

Role of sex-hormone-binding globulin and free sex steroid hormones in hyperandrogenic anovulation. Author(s): Ohsawa M, Asai M, Masahashi T, Narita O, Tomoda Y, Matsui N. Source: Nippon Sanka Fujinka Gakkai Zasshi. 1986 November; 38(11): 2081-8. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=2947958

•

Spontaneous anovulation causing disappearance of cyclical symptoms in women with the premenstrual syndrome. Author(s): Hammarback S, Ekholm UB, Backstrom T. Source: Acta Endocrinol (Copenh). 1991 August; 125(2): 132-7. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=1897330

•

Stimulation of follicular growth with "pure" FSH in patients with anovulation and elevated LH levels. Author(s): Schoemaker J, Wentz AC, Jones GS, Dubin NH, Sapp KC. Source: Obstetrics and Gynecology. 1978 March; 51(3): 270-7. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=628528

•

Studies on oestrogen stimulated neurophysin in women with anovulation. Author(s): McHugh RE, Marvin SC, Shirley A, Butt WR, Lynch SS, Shaw RW. Source: Clinical Endocrinology. 1981 September; 15(3): 209-20. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=7030528

•

Syndrome of anovulation following the oral contraceptives. Author(s): Dodek OI Jr, Kotz HL. Source: American Journal of Obstetrics and Gynecology. 1967 August 15; 98(8): 1065-70. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=4951888

•

Tamoxifen in clomiphene-resistant hypothalamic anovulation. Author(s): Weseley AC, Melnick H. Source: Int J Fertil. 1987 May-June; 32(3): 226-8. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=2885287

Studies

45

•

Testosterone, a follicular regulator: key to anovulation. Author(s): Haning RV Jr, Hackett RJ, Flood CA, Loughlin JS, Zhao QY, Longcope C. Source: The Journal of Clinical Endocrinology and Metabolism. 1993 September; 77(3): 710-5. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=8370694

•

The association between pituitary adenomas and chronic anovulation syndrome. Author(s): Coulam CB, Annegers JF, Kranz JS. Source: American Journal of Obstetrics and Gynecology. 1982 June 1; 143(3): 319-24. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=7200727

•

The association of anovulation and endometriosis in the infertile female. Author(s): Arumugam K, Mahmood TA, Kong YF. Source: The Australian & New Zealand Journal of Obstetrics & Gynaecology. 1989 August; 29(3 Pt 2): 350-1. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=2619687

•

The choice of treatment for anovulation associated with polycystic ovary syndrome following failure to conceive with clomiphene. Author(s): Farhi J, Homburg R, Lerner A, Ben-Rafael Z. Source: Human Reproduction (Oxford, England). 1993 September; 8(9): 1367-71. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=8253919

•

The effect of alprazolam on serum cortisol and luteinizing hormone pulsatility in normal women and in women with stress-related anovulation. Author(s): Judd SJ, Wong J, Saloniklis S, Maiden M, Yeap B, Filmer S, Michailov L. Source: The Journal of Clinical Endocrinology and Metabolism. 1995 March; 80(3): 81823. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=7883836

•

The effect of different doses of human chorionic gonadotrophin in the treatment of anovulation with human gonadotrophins. Author(s): Starup J, Sele V. Source: Acta Endocrinol (Copenh). 1972 November; 71(3): 469-79. No Abstract Available. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=4678196

•

The effect of intravenous synthetic luteinizing hormone releasing hormone (LHRH) in infertile women with anovulation. Author(s): Pederden PH, Larsen JF, Micic S, Roos J, Sele V. Source: Acta Obstetricia Et Gynecologica Scandinavica. Supplement. 1974; 29: 89-95. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=4601472

46

Anovulation

•

The effectiveness and safety of recombinant human LH to support follicular development induced by recombinant human FSH in WHO group I anovulation: evidence from a multicentre study in Spain. Author(s): Burgues S; Spanish Collaborative Group on Female Hypogonadotrophic Hypogonadism. Source: Human Reproduction (Oxford, England). 2001 December; 16(12): 2525-32. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=11726569

•

The electroencephalogram in the investigation of anovulation and its treatment by clomiphene. Author(s): Sharf M, Sharf B, Bental E, Kuzminsky T. Source: Lancet. 1969 April 12; 1(7598): 750-3. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=4180217

•

The impairment of progesterone-induced pituitary release of prolactin and gonadotropin in patients with hypothalamic chronic anovulation. Author(s): Rakoff JS, Rigg LA, Yen SS. Source: American Journal of Obstetrics and Gynecology. 1978 April 1; 130(7): 807-12. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=637104

•

The luteinized unruptured follicle syndrome: anovulation in disguise. Author(s): LeMaire GS. Source: Journal of Obstetric, Gynecologic, and Neonatal Nursing : Jognn / Naacog. 1987 March-April; 16(2): 116-20. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=2952775

•

The mechanism of the effect of combination treatment with clomiphene and bromocriptine in patients with normoprolactinemic anovulation. Author(s): Yasui T, Irahara M, Shisukawa K, Azuma K, Aono T. Source: J Endocrinol Invest. 1990 July-August; 13(7): 549-54. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=2121818

•

The role of chronic anovulation in the polycystic ovary syndrome: normalization of sex-hormone-binding globulin levels after clomiphene-induced ovulation. Author(s): Eden JA, Place J, Carter GD, Alaghband-Zadeh J, Pawson ME. Source: Clinical Endocrinology. 1989 March; 30(3): 323-32. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=2512039

•

The use of clomiphene citrate in the treatment of anovulation. Author(s): Kistner RW. Source: Semin Drug Treat. 1973 Autumn; 3(2): 159-76. Review. No Abstract Available. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=4584285

Studies

47

•

The use of Ro 4-8347 in amenorrhea and anovulation. Author(s): Polishuk WZ, Schechter A, Kozminski T. Source: Bull Schweiz Akad Med Wiss. 1970 October; 25(4-6): 565-74. No Abstract Available. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=5510180

•

Transvaginal interstitial laser treatment of the ovary for the management of chronic hyperandrogenic anovulation: first clinical experience. Author(s): Kaaijk EM, van der Veen F, Beek JF, van Gemert MJ, Lammes FB. Source: Gynecologic and Obstetric Investigation. 1997; 44(2): 115-9. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=9286725

•

Treatment of anovulation due to polycystic ovarian syndrome by laparoscopic ovarian electrocautery. Author(s): Kovacs G, Buckler H, Bangah M, Outch K, Burger H, Healy D, Baker G, Phillips S. Source: British Journal of Obstetrics and Gynaecology. 1991 January; 98(1): 30-5. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=1825605

•

Treatment of anovulation in the Stein-Leventhal syndrome. Analysis of 90 cases. Author(s): Zarate A, Hernandez-Ayup S, Ris-Montiel A. Source: Fertility and Sterility. 1971 March; 22(3): 188-93. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=5548552

•

Treatment of anovulation with human menopausal and human chorionic gonadotropin. Author(s): Schultz JM. Source: J Fla Med Assoc. 1972 February; 59(2): 21-6. No Abstract Available. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=5060436

•

Treatment of anovulation with human menopausal gonadotrophin. Author(s): Freedman RS, van der Walt LA. Source: South African Medical Journal. Suid-Afrikaanse Tydskrif Vir Geneeskunde. 1976 March 24; 50(13): 519-22. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=1265551

•

Treatment of anovulation with menotropins. Author(s): Tyler ET. Source: Jama : the Journal of the American Medical Association. 1968 July 1; 205(1): 8692. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=5694897

48

Anovulation

•

Treatment of anovulation with pulsatile gonadotropin-releasing hormone: prognostic factors and clinical results in 600 cycles. Author(s): Filicori M, Flamigni C, Dellai P, Cognigni G, Michelacci L, Arnone R, Sambataro M, Falbo A. Source: The Journal of Clinical Endocrinology and Metabolism. 1994 October; 79(4): 1215-20. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=7962297

•

Treatment of anovulation with synthetic luteinizing hormone-releasing hormone. Author(s): Keller PJ. Source: American Journal of Obstetrics and Gynecology. 1973 July 1; 116(5): 698-705. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=4576558

•

Treatment of chronic anovulation and corpus luteum deficiency with epimestrol. Author(s): Cortes-Prieto J, Martinez MR, Pesenti B, Villalobos AS, Clavijo MG. Source: Reproduccion. 1981 January-March; 5(1): 49-57. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=7250485

•

Treatment of chronic anovulation resistant to clomiphene citrate (CC) by using oral contraceptive ovarian suppression followed by repeat CC treatment. Author(s): Branigan EF, Estes MA. Source: Fertility and Sterility. 1999 March; 71(3): 544-6. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=10065795

•

Treatment of hyperprolactinemia-anovulation syndrome. Author(s): Floersheim-Shachar Y, Keller PJ. Source: Fertility and Sterility. 1977 November; 28(11): 1158-63. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=562780

•

Treatment of refractory anovulation with increased dosage and prolonged duration of cyclic clomiphene citrate. Author(s): Adams R, Mishell DR Jr, Israel R. Source: Obstetrics and Gynecology. 1972 April; 39(4): 562-6. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=5062999

•

Upper body obesity and hyperinsulinemia are associated with anovulation. Author(s): Moran C, Hernandez E, Ruiz JE, Fonseca ME, Bermudez JA, Zarate A. Source: Gynecologic and Obstetric Investigation. 1999; 47(1): 1-5. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=9852383

Studies

49

•

Urinary follicle-stimulating hormone (FSH) versus recombinant FSH in clomiphene citrate-resistant, normogonadotropic,chronic anovulation: a prospective randomized study. Author(s): Yarali H, Bukulmez O, Gurgan T. Source: Fertility and Sterility. 1999 August; 72(2): 276-81. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=10438995

•

Use of bromocriptine in hyperprolactinaemic anovulation and related disorders. Author(s): Franks S. Source: Drugs. 1979 May; 17(5): 337-48. Review. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=378649

•

Use of LHRH agonists in the treatment of anovulation in women with polycystic ovary syndrome. Author(s): Franks S, Sagle M, Mason HD, Kiddy D. Source: Hormone Research. 1987; 28(2-4): 164-8. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=3136067

•

Women with functional hypothalamic amenorrhea but not other forms of anovulation display amplified cortisol concentrations. Author(s): Berga SL, Daniels TL, Giles DE. Source: Fertility and Sterility. 1997 June; 67(6): 1024-30. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=9176439

51

CHAPTER 2. NUTRITION AND ANOVULATION Overview In this chapter, we will show you how to find studies dedicated specifically to nutrition and anovulation.

Finding Nutrition Studies on Anovulation The National Institutes of Health’s Office of Dietary Supplements (ODS) offers a searchable bibliographic database called the IBIDS (International Bibliographic Information on Dietary Supplements; National Institutes of Health, Building 31, Room 1B29, 31 Center Drive, MSC 2086, Bethesda, Maryland 20892-2086, Tel: 301-435-2920, Fax: 301-480-1845, E-mail: [email protected]). The IBIDS contains over 460,000 scientific citations and summaries about dietary supplements and nutrition as well as references to published international, scientific literature on dietary supplements such as vitamins, minerals, and botanicals.4 The IBIDS includes references and citations to both human and animal research studies. As a service of the ODS, access to the IBIDS database is available free of charge at the following Web address: http://ods.od.nih.gov/databases/ibids.html. After entering the search area, you have three choices: (1) IBIDS Consumer Database, (2) Full IBIDS Database, or (3) Peer Reviewed Citations Only. Now that you have selected a database, click on the “Advanced” tab. An advanced search allows you to retrieve up to 100 fully explained references in a comprehensive format. Type “anovulation” (or synonyms) into the search box, and click “Go.” To narrow the search, you can also select the “Title” field.

4 Adapted from http://ods.od.nih.gov. IBIDS is produced by the Office of Dietary Supplements (ODS) at the National Institutes of Health to assist the public, healthcare providers, educators, and researchers in locating credible, scientific information on dietary supplements. IBIDS was developed and will be maintained through an interagency partnership with the Food and Nutrition Information Center of the National Agricultural Library, U.S. Department of Agriculture.

52

Anovulation

The following information is typical of that found when using the “Full IBIDS Database” to search for “anovulation” (or a synonym): •

Effect of acute nutritional restriction on incidence of anovulation and periovulatory estradiol and gonadotropin concentrations in beef heifers. Author(s): Teagasc, Research Centre, Athenry, Co. Galway, Ireland Faculty of Veterinary Medicine, National University of Ireland, Dublin, Ireland. Source: Mackey, D R Sreenan, J M Roche, J F Diskin, M G Biol-Reprod. 1999 December; 61(6): 1601-7 0006-3363

•

Nutritionally induced anovulation in beef Heifers: ovarian and endocrine function during realimentation and resumption of ovulation. Author(s): Department of Animal Science, Oklahoma Agricultural Experiment Station, Stillwater, Oklahoma 74078, USA. Source: Bossis, I Wettemann, R P Welty, S D Vizcarra, J Spicer, L J Biol-Reprod. 2000 May; 62(5): 1436-44 0006-3363

Federal Resources on Nutrition In addition to the IBIDS, the United States Department of Health and Human Services (HHS) and the United States Department of Agriculture (USDA) provide many sources of information on general nutrition and health. Recommended resources include: •

healthfinder®, HHS’s gateway to health information, including diet and nutrition: http://www.healthfinder.gov/scripts/SearchContext.asp?topic=238&page=0

•

The United States Department of Agriculture’s Web site dedicated to nutrition information: www.nutrition.gov

•

The Food and Drug Administration’s Web site for federal food safety information: www.foodsafety.gov

•

The National Action Plan on Overweight and Obesity sponsored by the United States Surgeon General: http://www.surgeongeneral.gov/topics/obesity/

•

The Center for Food Safety and Applied Nutrition has an Internet site sponsored by the Food and Drug Administration and the Department of Health and Human Services: http://vm.cfsan.fda.gov/

•

Center for Nutrition Policy and Promotion sponsored by the United States Department of Agriculture: http://www.usda.gov/cnpp/

•

Food and Nutrition Information Center, National Agricultural Library sponsored by the United States Department of Agriculture: http://www.nal.usda.gov/fnic/

•

Food and Nutrition Service sponsored by the United States Department of Agriculture: http://www.fns.usda.gov/fns/

Additional Web Resources A number of additional Web sites offer encyclopedic information covering food and nutrition. The following is a representative sample: •

AOL: http://search.aol.com/cat.adp?id=174&layer=&from=subcats

Nutrition

•

Family Village: http://www.familyvillage.wisc.edu/med_nutrition.html

•

Google: http://directory.google.com/Top/Health/Nutrition/

•

Healthnotes: http://www.healthnotes.com/

•

Open Directory Project: http://dmoz.org/Health/Nutrition/

•

Yahoo.com: http://dir.yahoo.com/Health/Nutrition/

•

WebMDHealth: http://my.webmd.com/nutrition

•

WholeHealthMD.com: http://www.wholehealthmd.com/reflib/0,1529,00.html

53

55

CHAPTER 3. ALTERNATIVE MEDICINE AND ANOVULATION Overview In this chapter, we will begin by introducing you to official information sources on complementary and alternative medicine (CAM) relating to anovulation. At the conclusion of this chapter, we will provide additional sources.

National Center for Complementary and Alternative Medicine The National Center for Complementary and Alternative Medicine (NCCAM) of the National Institutes of Health (http://nccam.nih.gov/) has created a link to the National Library of Medicine’s databases to facilitate research for articles that specifically relate to anovulation and complementary medicine. To search the database, go to the following Web site: http://www.nlm.nih.gov/nccam/camonpubmed.html. Select “CAM on PubMed.” Enter “anovulation” (or synonyms) into the search box. Click “Go.” The following references provide information on particular aspects of complementary and alternative medicine that are related to anovulation: •

A phytoestrogen diet induces the premature anovulatory syndrome in lactationally exposed female rats. Author(s): Whitten PL, Lewis C, Naftolin F. Source: Biology of Reproduction. 1993 November; 49(5): 1117-21. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=8286579

•

A review of treatment of premenstrual syndrome and premenstrual dysphoric disorder. Author(s): Rapkin A. Source: Psychoneuroendocrinology. 2003 August; 28 Suppl 3: 39-53. Review. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=12892989

•

Acupuncture normalizes dysfunction of hypothalamic-pituitary-ovarian axis. Author(s): Chen BY.

56

Anovulation

Source: Acupuncture & Electro-Therapeutics Research. 1997; 22(2): 97-108. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=9330669 •

Amenorrhea associated with carotenemia. Author(s): Kemmann E, Pasquale SA, Skaf R. Source: Jama : the Journal of the American Medical Association. 1983 February 18; 249(7): 926-9. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=6823046

•

Breastfeeding and postpartum amenorrhea in a traditional society: a hazards model analysis. Author(s): Nath DC, Singh KK, Land KC, Talukdar PK. Source: Soc Biol. 1993 Spring-Summer; 40(1-2): 74-86. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=8146695

•

Clinical observation on the effects of combined traditional Chinese and Western medicine therapy for excessive suppressive syndrome. Author(s): Wang Z. Source: J Tradit Chin Med. 1994 December; 14(4): 247-53. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=7877331

•

Clinical studies on the mechanism for acupuncture stimulation of ovulation. Author(s): Mo X, Li D, Pu Y, Xi G, Le X, Fu Z. Source: J Tradit Chin Med. 1993 June; 13(2): 115-9. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=8412285

•

Dietary recommendations and athletic menstrual dysfunction. Author(s): Manore MM. Source: Sports Medicine (Auckland, N.Z.). 2002; 32(14): 887-901. Review. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=12427050

•

Differential TCM treatment of anovulatory dysfunctional uterine bleeding. Author(s): Wang Z. Source: J Tradit Chin Med. 1995 December; 15(4): 270-2. No Abstract Available. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=8709607

•

Effects of electro-acupuncture on anovulation in women with polycystic ovary syndrome. Author(s): Stener-Victorin E, Waldenstrom U, Tagnfors U, Lundeberg T, Lindstedt G, Janson PO.

Alternative Medicine 57

Source: Acta Obstetricia Et Gynecologica Scandinavica. 2000 March; 79(3): 180-8. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=10716298 •

Effects of unkei-to, an herbal medicine, on endocrine function and ovulation in women with high basal levels of luteinizing hormone secretion. Author(s): Ushiroyama T, Ikeda A, Sakai M, Hosotani T, Suzuki Y, Tsubokura S, Ueki M. Source: J Reprod Med. 2001 May; 46(5): 451-6. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=11396371

•

Electro-acupuncture reverses nerve growth factor abundance in experimental polycystic ovaries in the rat. Author(s): Bai YH, Lim SC, Song CH, Bae CS, Jin CS, Choi BC, Jang CH, Lee SH, Pak SC. Source: Gynecologic and Obstetric Investigation. 2004; 57(2): 80-5. Epub 2003 December 09. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=14671415

•

Hyperprolactinemia and macrocytosis in women with alcohol and polysubstance dependence. Author(s): Teoh SK, Lex BW, Mendelson JH, Mello NK, Cochin J. Source: J Stud Alcohol. 1992 March; 53(2): 176-82. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=1560669

•

Induction of ovulation by Sairei-to for polycystic ovary syndrome patients. Author(s): Sakai A, Kondo Z, Kamei K, Izumi S, Sumi K. Source: Endocrine Journal. 1999 February; 46(1): 217-20. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=10426590

•

Induction Of ovulation. Author(s): Nandanwar YS, Shinde AA, Mayadeo NM. Source: Journal of Postgraduate Medicine. 1999 July-September; 45(3): 79-80. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=10734340

•

Neurobehavioral actions of coumestrol and related isoflavonoids in rodents. Author(s): Whitten PL, Patisaul HB, Young LJ. Source: Neurotoxicology and Teratology. 2002 January-February; 24(1): 47-54. Review. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=11836071

•

New IPPF statement on breast feeding, fertility and post-partum contraception. Author(s): International Planned Parenthood Federation IPPF. International Medical Advisory Panel IMAP.

58

Anovulation

Source: Ippf Med Bull. 1990 April; 24(2): 2-4. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=12316284 •

Ovulation following combined therapy with wen-jing-tang and clomiphene citrate therapy in anovulatory women. Author(s): Yoshimoto Y, Miyake A, Tasaka K, Aono T, Tanizawa O. Source: The American Journal of Chinese Medicine. 1989; 17(3-4): 243-4. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=2633625

•

Relationship between blood radioimmunoreactive beta-endorphin and hand skin temperature during the electro-acupuncture induction of ovulation. Author(s): Chen BY, Yu J. Source: Acupuncture & Electro-Therapeutics Research. 1991; 16(1-2): 1-5. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=1674830

•

Reproductive status in GTD treated with etoposide. Author(s): Matsui H, Seki K, Sekiya S, Takamizawa H. Source: J Reprod Med. 1997 February; 42(2): 104-10. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=9058346

•

The determinants of fertility among Australian Aborigines. Author(s): Cowlishaw G. Source: Mankind. 1981 June; 13(1): 37-55. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=12337490

•

The effect of a special herbal tea on obesity and anovulation in androgen-sterilized rats. Author(s): Sun F, Yu J. Source: Proceedings of the Society for Experimental Biology and Medicine. Society for Experimental Biology and Medicine (New York, N. Y.). 2000 March; 223(3): 295-301. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=10719843

•

The higher rate of multiple births after periconceptional multivitamin supplementation: an analysis of causes. Author(s): Czeizel AE, Metneki J, Dudas I. Source: Acta Genet Med Gemellol (Roma). 1994; 43(3-4): 175-84. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=8588492

•

The menstrual cycle and habituation. Author(s): Friedman J, Meares RA.

Alternative Medicine 59

Source: Psychosomatic Medicine. 1979 August; 41(5): 369-81. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=504539 •

Vegetarian vs nonvegetarian diets, dietary restraint, and subclinical ovulatory disturbances: prospective 6-mo study. Author(s): Barr SI, Janelle KC, Prior JC. Source: The American Journal of Clinical Nutrition. 1994 December; 60(6): 887-94. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=7985629

•

Vegetarianism and menstrual cycle disturbances: is there an association? Author(s): Barr SI. Source: The American Journal of Clinical Nutrition. 1999 September; 70(3 Suppl): 549S54S. Review. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=A bstract&list_uids=10479230

Additional Web Resources A number of additional Web sites offer encyclopedic information covering CAM and related topics. The following is a representative sample: •

Alternative Medicine Foundation, Inc.: http://www.herbmed.org/

•

AOL: http://search.aol.com/cat.adp?id=169&layer=&from=subcats

•

Chinese Medicine: http://www.newcenturynutrition.com/

•

drkoop.com: http://www.drkoop.com/InteractiveMedicine/IndexC.html

•

Family Village: http://www.familyvillage.wisc.edu/med_altn.htm

•

Google: http://directory.google.com/Top/Health/Alternative/

•

Healthnotes: http://www.healthnotes.com/

•

MedWebPlus: http://medwebplus.com/subject/Alternative_and_Complementary_Medicine

•

Open Directory Project: http://dmoz.org/Health/Alternative/

•

HealthGate: http://www.tnp.com/

•

WebMDHealth: http://my.webmd.com/drugs_and_herbs

•

WholeHealthMD.com: http://www.wholehealthmd.com/reflib/0,1529,00.html

•

Yahoo.com: http://dir.yahoo.com/Health/Alternative_Medicine/

60

Anovulation

The following is a specific Web list relating to anovulation; please note that any particular subject below may indicate either a therapeutic use, or a contraindication (potential danger), and does not reflect an official recommendation: •

General Overview Amenorrhea Source: Healthnotes, Inc.; www.healthnotes.com

•

Alternative Therapy Acupuncture Source: Integrative Medicine Communications; www.drkoop.com

General References A good place to find general background information on CAM is the National Library of Medicine. It has prepared within the MEDLINEplus system an information topic page dedicated to complementary and alternative medicine. To access this page, go to the MEDLINEplus site at http://www.nlm.nih.gov/medlineplus/alternativemedicine.html. This Web site provides a general overview of various topics and can lead to a number of general sources.

61

CHAPTER 4. PERIODICALS AND NEWS ON ANOVULATION Overview In this chapter, we suggest a number of news sources and present various periodicals that cover anovulation.

News Services and Press Releases One of the simplest ways of tracking press releases on anovulation is to search the news wires. In the following sample of sources, we will briefly describe how to access each service. These services only post recent news intended for public viewing. PR Newswire To access the PR Newswire archive, simply go to http://www.prnewswire.com/. Select your country. Type “anovulation” (or synonyms) into the search box. You will automatically receive information on relevant news releases posted within the last 30 days. The search results are shown by order of relevance. Reuters Health The Reuters’ Medical News and Health eLine databases can be very useful in exploring news archives relating to anovulation. While some of the listed articles are free to view, others are available for purchase for a nominal fee. To access this archive, go to http://www.reutershealth.com/en/index.html and search by “anovulation” (or synonyms). The following was recently listed in this archive for anovulation: •

Higher rate of anovulation seen in adolescent girls born small for gestational age Source: Reuters Medical News Date: August 06, 2002

62

Anovulation

The NIH Within MEDLINEplus, the NIH has made an agreement with the New York Times Syndicate, the AP News Service, and Reuters to deliver news that can be browsed by the public. Search news releases at http://www.nlm.nih.gov/medlineplus/alphanews_a.html. MEDLINEplus allows you to browse across an alphabetical index. Or you can search by date at the following Web page: http://www.nlm.nih.gov/medlineplus/newsbydate.html. Often, news items are indexed by MEDLINEplus within its search engine. Business Wire Business Wire is similar to PR Newswire. To access this archive, simply go to http://www.businesswire.com/. You can scan the news by industry category or company name. Market Wire Market Wire is more focused on technology than the other wires. To browse the latest press releases by topic, such as alternative medicine, biotechnology, fitness, healthcare, legal, nutrition, and pharmaceuticals, access Market Wire’s Medical/Health channel at http://www.marketwire.com/mw/release_index?channel=MedicalHealth. Or simply go to Market Wire’s home page at http://www.marketwire.com/mw/home, type “anovulation” (or synonyms) into the search box, and click on “Search News.” As this service is technology oriented, you may wish to use it when searching for press releases covering diagnostic procedures or tests. Search Engines Medical news is also available in the news sections of commercial Internet search engines. See the health news page at Yahoo (http://dir.yahoo.com/Health/News_and_Media/), or you can use this Web site’s general news search page at http://news.yahoo.com/. Type in “anovulation” (or synonyms). If you know the name of a company that is relevant to anovulation, you can go to any stock trading Web site (such as http://www.etrade.com/) and search for the company name there. News items across various news sources are reported on indicated hyperlinks. Google offers a similar service at http://news.google.com/. BBC Covering news from a more European perspective, the British Broadcasting Corporation (BBC) allows the public free access to their news archive located at http://www.bbc.co.uk/. Search by “anovulation” (or synonyms).

Academic Periodicals covering Anovulation Numerous periodicals are currently indexed within the National Library of Medicine’s PubMed database that are known to publish articles relating to anovulation. In addition to

Periodicals and News

63

these sources, you can search for articles covering anovulation that have been published by any of the periodicals listed in previous chapters. To find the latest studies published, go to http://www.ncbi.nlm.nih.gov/pubmed, type the name of the periodical into the search box, and click “Go.” If you want complete details about the historical contents of a journal, you can also visit the following Web site: http://www.ncbi.nlm.nih.gov/entrez/jrbrowser.cgi. Here, type in the name of the journal or its abbreviation, and you will receive an index of published articles. At http://locatorplus.gov/, you can retrieve more indexing information on medical periodicals (e.g. the name of the publisher). Select the button “Search LOCATORplus.” Then type in the name of the journal and select the advanced search option “Journal Title Search.”

65

CHAPTER 5. RESEARCHING MEDICATIONS Overview While a number of hard copy or CD-ROM resources are available for researching medications, a more flexible method is to use Internet-based databases. Broadly speaking, there are two sources of information on approved medications: public sources and private sources. We will emphasize free-to-use public sources.

U.S. Pharmacopeia Because of historical investments by various organizations and the emergence of the Internet, it has become rather simple to learn about the medications recommended for anovulation. One such source is the United States Pharmacopeia. In 1820, eleven physicians met in Washington, D.C. to establish the first compendium of standard drugs for the United States. They called this compendium the U.S. Pharmacopeia (USP). Today, the USP is a nonprofit organization consisting of 800 volunteer scientists, eleven elected officials, and 400 representatives of state associations and colleges of medicine and pharmacy. The USP is located in Rockville, Maryland, and its home page is located at http://www.usp.org/. The USP currently provides standards for over 3,700 medications. The resulting USP DI Advice for the Patient can be accessed through the National Library of Medicine of the National Institutes of Health. The database is partially derived from lists of federally approved medications in the Food and Drug Administration’s (FDA) Drug Approvals database, located at http://www.fda.gov/cder/da/da.htm. While the FDA database is rather large and difficult to navigate, the Phamacopeia is both user-friendly and free to use. It covers more than 9,000 prescription and over-the-counter medications. To access this database, simply type the following hyperlink into your Web browser: http://www.nlm.nih.gov/medlineplus/druginformation.html. To view examples of a given medication (brand names, category, description, preparation, proper use, precautions, side effects, etc.), simply follow the hyperlinks indicated within the United States Pharmacopeia (USP).

66

Anovulation

Commercial Databases In addition to the medications listed in the USP above, a number of commercial sites are available by subscription to physicians and their institutions. Or, you may be able to access these sources from your local medical library.

Mosby’s Drug Consult Mosby’s Drug Consult database (also available on CD-ROM and book format) covers 45,000 drug products including generics and international brands. It provides prescribing information, drug interactions, and patient information. Subscription information is available at the following hyperlink: http://www.mosbysdrugconsult.com/.

PDRhealth The PDRhealth database is a free-to-use, drug information search engine that has been written for the public in layman’s terms. It contains FDA-approved drug information adapted from the Physicians’ Desk Reference (PDR) database. PDRhealth can be searched by brand name, generic name, or indication. It features multiple drug interactions reports. Search PDRhealth at http://www.pdrhealth.com/drug_info/index.html. Other Web Sites Drugs.com (www.drugs.com) reproduces the information in the Pharmacopeia as well as commercial information. You may also want to consider the Web site of the Medical Letter, Inc. (http://www.medletter.com/) which allows users to download articles on various drugs and therapeutics for a nominal fee.

Researching Orphan Drugs Although the list of orphan drugs is revised on a daily basis, you can quickly research orphan drugs that might be applicable to anovulation by using the database managed by the National Organization for Rare Disorders, Inc. (NORD), at http://www.rarediseases.org/. Scroll down the page, and on the left toolbar, click on “Orphan Drug Designation Database.” On this page (http://www.rarediseases.org/search/noddsearch.html), type “anovulation” (or synonyms) into the search box, and click “Submit Query.” When you receive your results, note that not all of the drugs may be relevant, as some may have been withdrawn from orphan status. Write down or print out the name of each drug and the relevant contact information. From there, visit the Pharmacopeia Web site and type the name of each orphan drug into the search box at http://www.nlm.nih.gov/medlineplus/druginformation.html. You may need to contact the sponsor or NORD for further information. NORD conducts “early access programs for investigational new drugs (IND) under the Food and Drug Administration’s (FDA’s) approval ‘Treatment INDs’ programs which allow for a limited number of individuals to receive investigational drugs before FDA marketing approval.” If the orphan product about which you are seeking information is approved for

Researching Medications

67

marketing, information on side effects can be found on the product’s label. If the product is not approved, you may need to contact the sponsor. The following is a list of orphan drugs currently listed in the NORD Orphan Drug Designation Database for anovulation: •

Recombinant human luteinizing hormone http://www.rarediseases.org/nord/search/nodd_full?code=478

If you have any questions about a medical treatment, the FDA may have an office near you. Look for their number in the blue pages of the phone book. You can also contact the FDA through its toll-free number, 1-888-INFO-FDA (1-888-463-6332), or on the World Wide Web at www.fda.gov.

69

APPENDICES

71

APPENDIX A. PHYSICIAN RESOURCES Overview In this chapter, we focus on databases and Internet-based guidelines and information resources created or written for a professional audience.

NIH Guidelines Commonly referred to as “clinical” or “professional” guidelines, the National Institutes of Health publish physician guidelines for the most common diseases. Publications are available at the following by relevant Institute5: •

Office of the Director (OD); guidelines consolidated across agencies available at http://www.nih.gov/health/consumer/conkey.htm

•

National Institute of General Medical Sciences (NIGMS); fact sheets available at http://www.nigms.nih.gov/news/facts/

•

National Library of Medicine (NLM); extensive encyclopedia (A.D.A.M., Inc.) with guidelines: http://www.nlm.nih.gov/medlineplus/healthtopics.html

•

National Cancer Institute (NCI); guidelines available at http://www.cancer.gov/cancerinfo/list.aspx?viewid=5f35036e-5497-4d86-8c2c714a9f7c8d25

•

National Eye Institute (NEI); guidelines available at http://www.nei.nih.gov/order/index.htm

•

National Heart, Lung, and Blood Institute (NHLBI); guidelines available at http://www.nhlbi.nih.gov/guidelines/index.htm

•

National Human Genome Research Institute (NHGRI); research available at http://www.genome.gov/page.cfm?pageID=10000375

•

National Institute on Aging (NIA); guidelines available at http://www.nia.nih.gov/health/

5

These publications are typically written by one or more of the various NIH Institutes.

72

Anovulation

•

National Institute on Alcohol Abuse and Alcoholism (NIAAA); guidelines available at http://www.niaaa.nih.gov/publications/publications.htm

•

National Institute of Allergy and Infectious Diseases (NIAID); guidelines available at http://www.niaid.nih.gov/publications/

•

National Institute of Arthritis and Musculoskeletal and Skin Diseases (NIAMS); fact sheets and guidelines available at http://www.niams.nih.gov/hi/index.htm

•

National Institute of Child Health and Human Development (NICHD); guidelines available at http://www.nichd.nih.gov/publications/pubskey.cfm

•

National Institute on Deafness and Other Communication Disorders (NIDCD); fact sheets and guidelines at http://www.nidcd.nih.gov/health/

•

National Institute of Dental and Craniofacial Research (NIDCR); guidelines available at http://www.nidr.nih.gov/health/

•

National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK); guidelines available at http://www.niddk.nih.gov/health/health.htm

•

National Institute on Drug Abuse (NIDA); guidelines available at http://www.nida.nih.gov/DrugAbuse.html

•

National Institute of Environmental Health Sciences (NIEHS); environmental health information available at http://www.niehs.nih.gov/external/facts.htm

•

National Institute of Mental Health (NIMH); guidelines available at http://www.nimh.nih.gov/practitioners/index.cfm

•

National Institute of Neurological Disorders and Stroke (NINDS); neurological disorder information pages available at http://www.ninds.nih.gov/health_and_medical/disorder_index.htm

•

National Institute of Nursing Research (NINR); publications on selected illnesses at http://www.nih.gov/ninr/news-info/publications.html

•

National Institute of Biomedical Imaging and Bioengineering; general information at http://grants.nih.gov/grants/becon/becon_info.htm

•

Center for Information Technology (CIT); referrals to other agencies based on keyword searches available at http://kb.nih.gov/www_query_main.asp

•

National Center for Complementary and Alternative Medicine (NCCAM); health information available at http://nccam.nih.gov/health/

•

National Center for Research Resources (NCRR); various information directories available at http://www.ncrr.nih.gov/publications.asp

•

Office of Rare Diseases; various fact sheets available at http://rarediseases.info.nih.gov/html/resources/rep_pubs.html

•

Centers for Disease Control and Prevention; various fact sheets on infectious diseases available at http://www.cdc.gov/publications.htm

Physician Resources

73

NIH Databases In addition to the various Institutes of Health that publish professional guidelines, the NIH has designed a number of databases for professionals.6 Physician-oriented resources provide a wide variety of information related to the biomedical and health sciences, both past and present. The format of these resources varies. Searchable databases, bibliographic citations, full-text articles (when available), archival collections, and images are all available. The following are referenced by the National Library of Medicine:7 •

Bioethics: Access to published literature on the ethical, legal, and public policy issues surrounding healthcare and biomedical research. This information is provided in conjunction with the Kennedy Institute of Ethics located at Georgetown University, Washington, D.C.: http://www.nlm.nih.gov/databases/databases_bioethics.html

•

HIV/AIDS Resources: Describes various links and databases dedicated to HIV/AIDS research: http://www.nlm.nih.gov/pubs/factsheets/aidsinfs.html

•

NLM Online Exhibitions: Describes “Exhibitions in the History of Medicine”: http://www.nlm.nih.gov/exhibition/exhibition.html. Additional resources for historical scholarship in medicine: http://www.nlm.nih.gov/hmd/hmd.html

•

Biotechnology Information: Access to public databases. The National Center for Biotechnology Information conducts research in computational biology, develops software tools for analyzing genome data, and disseminates biomedical information for the better understanding of molecular processes affecting human health and disease: http://www.ncbi.nlm.nih.gov/

•

Population Information: The National Library of Medicine provides access to worldwide coverage of population, family planning, and related health issues, including family planning technology and programs, fertility, and population law and policy: http://www.nlm.nih.gov/databases/databases_population.html

•

Cancer Information: Access to cancer-oriented databases: http://www.nlm.nih.gov/databases/databases_cancer.html

•

Profiles in Science: Offering the archival collections of prominent twentieth-century biomedical scientists to the public through modern digital technology: http://www.profiles.nlm.nih.gov/

•

Chemical Information: Provides links to various chemical databases and references: http://sis.nlm.nih.gov/Chem/ChemMain.html

•

Clinical Alerts: Reports the release of findings from the NIH-funded clinical trials where such release could significantly affect morbidity and mortality: http://www.nlm.nih.gov/databases/alerts/clinical_alerts.html

•

Space Life Sciences: Provides links and information to space-based research (including NASA): http://www.nlm.nih.gov/databases/databases_space.html

•

MEDLINE: Bibliographic database covering the fields of medicine, nursing, dentistry, veterinary medicine, the healthcare system, and the pre-clinical sciences: http://www.nlm.nih.gov/databases/databases_medline.html

6 Remember, for the general public, the National Library of Medicine recommends the databases referenced in MEDLINEplus (http://medlineplus.gov/ or http://www.nlm.nih.gov/medlineplus/databases.html). 7 See http://www.nlm.nih.gov/databases/databases.html.

74

Anovulation

•

Toxicology and Environmental Health Information (TOXNET): Databases covering toxicology and environmental health: http://sis.nlm.nih.gov/Tox/ToxMain.html

•

Visible Human Interface: Anatomically detailed, three-dimensional representations of normal male and female human bodies: http://www.nlm.nih.gov/research/visible/visible_human.html

The NLM Gateway8 The NLM (National Library of Medicine) Gateway is a Web-based system that lets users search simultaneously in multiple retrieval systems at the U.S. National Library of Medicine (NLM). It allows users of NLM services to initiate searches from one Web interface, providing one-stop searching for many of NLM’s information resources or databases.9 To use the NLM Gateway, simply go to the search site at http://gateway.nlm.nih.gov/gw/Cmd. Type “anovulation” (or synonyms) into the search box and click “Search.” The results will be presented in a tabular form, indicating the number of references in each database category. Results Summary Category Journal Articles Books / Periodicals / Audio Visual Consumer Health Meeting Abstracts Other Collections Total

Items Found 2561 163 3 0 13 2740

HSTAT10 HSTAT is a free, Web-based resource that provides access to full-text documents used in healthcare decision-making.11 These documents include clinical practice guidelines, quickreference guides for clinicians, consumer health brochures, evidence reports and technology assessments from the Agency for Healthcare Research and Quality (AHRQ), as well as AHRQ’s Put Prevention Into Practice.12 Simply search by “anovulation” (or synonyms) at the following Web site: http://text.nlm.nih.gov.

8

Adapted from NLM: http://gateway.nlm.nih.gov/gw/Cmd?Overview.x.

9

The NLM Gateway is currently being developed by the Lister Hill National Center for Biomedical Communications (LHNCBC) at the National Library of Medicine (NLM) of the National Institutes of Health (NIH). 10 Adapted from HSTAT: http://www.nlm.nih.gov/pubs/factsheets/hstat.html. 11 12

The HSTAT URL is http://hstat.nlm.nih.gov/.

Other important documents in HSTAT include: the National Institutes of Health (NIH) Consensus Conference Reports and Technology Assessment Reports; the HIV/AIDS Treatment Information Service (ATIS) resource documents; the Substance Abuse and Mental Health Services Administration's Center for Substance Abuse Treatment (SAMHSA/CSAT) Treatment Improvement Protocols (TIP) and Center for Substance Abuse Prevention (SAMHSA/CSAP) Prevention Enhancement Protocols System (PEPS); the Public Health Service (PHS) Preventive Services Task Force's Guide to Clinical Preventive Services; the independent, nonfederal Task Force on Community Services’ Guide to Community Preventive Services; and the Health Technology Advisory Committee (HTAC) of the Minnesota Health Care Commission (MHCC) health technology evaluations.

Physician Resources

75

Coffee Break: Tutorials for Biologists13 Coffee Break is a general healthcare site that takes a scientific view of the news and covers recent breakthroughs in biology that may one day assist physicians in developing treatments. Here you will find a collection of short reports on recent biological discoveries. Each report incorporates interactive tutorials that demonstrate how bioinformatics tools are used as a part of the research process. Currently, all Coffee Breaks are written by NCBI staff.14 Each report is about 400 words and is usually based on a discovery reported in one or more articles from recently published, peer-reviewed literature.15 This site has new articles every few weeks, so it can be considered an online magazine of sorts. It is intended for general background information. You can access the Coffee Break Web site at the following hyperlink: http://www.ncbi.nlm.nih.gov/Coffeebreak/.

Other Commercial Databases In addition to resources maintained by official agencies, other databases exist that are commercial ventures addressing medical professionals. Here are some examples that may interest you: •

CliniWeb International: Index and table of contents to selected clinical information on the Internet; see http://www.ohsu.edu/cliniweb/.

•

Medical World Search: Searches full text from thousands of selected medical sites on the Internet; see http://www.mwsearch.com/.

13 Adapted 14

from http://www.ncbi.nlm.nih.gov/Coffeebreak/Archive/FAQ.html.

The figure that accompanies each article is frequently supplied by an expert external to NCBI, in which case the source of the figure is cited. The result is an interactive tutorial that tells a biological story. 15 After a brief introduction that sets the work described into a broader context, the report focuses on how a molecular understanding can provide explanations of observed biology and lead to therapies for diseases. Each vignette is accompanied by a figure and hypertext links that lead to a series of pages that interactively show how NCBI tools and resources are used in the research process.

77

APPENDIX B. PATIENT RESOURCES Overview Official agencies, as well as federally funded institutions supported by national grants, frequently publish a variety of guidelines written with the patient in mind. These are typically called “Fact Sheets” or “Guidelines.” They can take the form of a brochure, information kit, pamphlet, or flyer. Often they are only a few pages in length. Since new guidelines on anovulation can appear at any moment and be published by a number of sources, the best approach to finding guidelines is to systematically scan the Internet-based services that post them.

Patient Guideline Sources The remainder of this chapter directs you to sources which either publish or can help you find additional guidelines on topics related to anovulation. Due to space limitations, these sources are listed in a concise manner. Do not hesitate to consult the following sources by either using the Internet hyperlink provided, or, in cases where the contact information is provided, contacting the publisher or author directly. The National Institutes of Health The NIH gateway to patients is located at http://health.nih.gov/. From this site, you can search across various sources and institutes, a number of which are summarized below. Topic Pages: MEDLINEplus The National Library of Medicine has created a vast and patient-oriented healthcare information portal called MEDLINEplus. Within this Internet-based system are “health topic pages” which list links to available materials relevant to anovulation. To access this system, log on to http://www.nlm.nih.gov/medlineplus/healthtopics.html. From there you can either search using the alphabetical index or browse by broad topic areas. Recently, MEDLINEplus listed the following when searched for “anovulation”:

78

Anovulation

Hormones http://www.nlm.nih.gov/medlineplus/hormones.html Infertility http://www.nlm.nih.gov/medlineplus/infertility.html Ovarian Cysts http://www.nlm.nih.gov/medlineplus/ovariancysts.html Pituitary Disorders http://www.nlm.nih.gov/medlineplus/pituitarydisorders.html You may also choose to use the search utility provided by MEDLINEplus at the following Web address: http://www.nlm.nih.gov/medlineplus/. Simply type a keyword into the search box and click “Search.” This utility is similar to the NIH search utility, with the exception that it only includes materials that are linked within the MEDLINEplus system (mostly patient-oriented information). It also has the disadvantage of generating unstructured results. We recommend, therefore, that you use this method only if you have a very targeted search. The NIH Search Utility The NIH search utility allows you to search for documents on over 100 selected Web sites that comprise the NIH-WEB-SPACE. Each of these servers is “crawled” and indexed on an ongoing basis. Your search will produce a list of various documents, all of which will relate in some way to anovulation. The drawbacks of this approach are that the information is not organized by theme and that the references are often a mix of information for professionals and patients. Nevertheless, a large number of the listed Web sites provide useful background information. We can only recommend this route, therefore, for relatively rare or specific disorders, or when using highly targeted searches. To use the NIH search utility, visit the following Web page: http://search.nih.gov/index.html. Additional Web Sources A number of Web sites are available to the public that often link to government sites. These can also point you in the direction of essential information. The following is a representative sample: •

AOL: http://search.aol.com/cat.adp?id=168&layer=&from=subcats

•

Family Village: http://www.familyvillage.wisc.edu/specific.htm

•

Google: http://directory.google.com/Top/Health/Conditions_and_Diseases/

•

Med Help International: http://www.medhelp.org/HealthTopics/A.html

•

Open Directory Project: http://dmoz.org/Health/Conditions_and_Diseases/

•

Yahoo.com: http://dir.yahoo.com/Health/Diseases_and_Conditions/

•

WebMDHealth: http://my.webmd.com/health_topics

Patient Resources

79

Finding Associations There are several Internet directories that provide lists of medical associations with information on or resources relating to anovulation. By consulting all of associations listed in this chapter, you will have nearly exhausted all sources for patient associations concerned with anovulation. The National Health Information Center (NHIC) The National Health Information Center (NHIC) offers a free referral service to help people find organizations that provide information about anovulation. For more information, see the NHIC’s Web site at http://www.health.gov/NHIC/ or contact an information specialist by calling 1-800-336-4797. Directory of Health Organizations The Directory of Health Organizations, provided by the National Library of Medicine Specialized Information Services, is a comprehensive source of information on associations. The Directory of Health Organizations database can be accessed via the Internet at http://www.sis.nlm.nih.gov/Dir/DirMain.html. It is composed of two parts: DIRLINE and Health Hotlines. The DIRLINE database comprises some 10,000 records of organizations, research centers, and government institutes and associations that primarily focus on health and biomedicine. To access DIRLINE directly, go to the following Web site: http://dirline.nlm.nih.gov/. Simply type in “anovulation” (or a synonym), and you will receive information on all relevant organizations listed in the database. Health Hotlines directs you to toll-free numbers to over 300 organizations. You can access this database directly at http://www.sis.nlm.nih.gov/hotlines/. On this page, you are given the option to search by keyword or by browsing the subject list. When you have received your search results, click on the name of the organization for its description and contact information. The Combined Health Information Database Another comprehensive source of information on healthcare associations is the Combined Health Information Database. Using the “Detailed Search” option, you will need to limit your search to “Organizations” and “anovulation”. Type the following hyperlink into your Web browser: http://chid.nih.gov/detail/detail.html. To find associations, use the drop boxes at the bottom of the search page where “You may refine your search by.” For publication date, select “All Years.” Then, select your preferred language and the format option “Organization Resource Sheet.” Type “anovulation” (or synonyms) into the “For these words:” box. You should check back periodically with this database since it is updated every three months.

80

Anovulation

The National Organization for Rare Disorders, Inc. The National Organization for Rare Disorders, Inc. has prepared a Web site that provides, at no charge, lists of associations organized by health topic. You can access this database at the following Web site: http://www.rarediseases.org/search/orgsearch.html. Type “anovulation” (or a synonym) into the search box, and click “Submit Query.”

81

APPENDIX C. FINDING MEDICAL LIBRARIES Overview In this Appendix, we show you how to quickly find a medical library in your area.

Preparation Your local public library and medical libraries have interlibrary loan programs with the National Library of Medicine (NLM), one of the largest medical collections in the world. According to the NLM, most of the literature in the general and historical collections of the National Library of Medicine is available on interlibrary loan to any library. If you would like to access NLM medical literature, then visit a library in your area that can request the publications for you.16

Finding a Local Medical Library The quickest method to locate medical libraries is to use the Internet-based directory published by the National Network of Libraries of Medicine (NN/LM). This network includes 4626 members and affiliates that provide many services to librarians, health professionals, and the public. To find a library in your area, simply visit http://nnlm.gov/members/adv.html or call 1-800-338-7657.

Medical Libraries in the U.S. and Canada In addition to the NN/LM, the National Library of Medicine (NLM) lists a number of libraries with reference facilities that are open to the public. The following is the NLM’s list and includes hyperlinks to each library’s Web site. These Web pages can provide information on hours of operation and other restrictions. The list below is a small sample of

16

Adapted from the NLM: http://www.nlm.nih.gov/psd/cas/interlibrary.html.

82

Anovulation

libraries recommended by the National Library of Medicine (sorted alphabetically by name of the U.S. state or Canadian province where the library is located)17: •

Alabama: Health InfoNet of Jefferson County (Jefferson County Library Cooperative, Lister Hill Library of the Health Sciences), http://www.uab.edu/infonet/

•

Alabama: Richard M. Scrushy Library (American Sports Medicine Institute)

•

Arizona: Samaritan Regional Medical Center: The Learning Center (Samaritan Health System, Phoenix, Arizona), http://www.samaritan.edu/library/bannerlibs.htm

•

California: Kris Kelly Health Information Center (St. Joseph Health System, Humboldt), http://www.humboldt1.com/~kkhic/index.html

•

California: Community Health Library of Los Gatos, http://www.healthlib.org/orgresources.html

•

California: Consumer Health Program and Services (CHIPS) (County of Los Angeles Public Library, Los Angeles County Harbor-UCLA Medical Center Library) - Carson, CA, http://www.colapublib.org/services/chips.html

•

California: Gateway Health Library (Sutter Gould Medical Foundation)

•

California: Health Library (Stanford University Medical Center), http://wwwmed.stanford.edu/healthlibrary/

•

California: Patient Education Resource Center - Health Information and Resources (University of California, San Francisco), http://sfghdean.ucsf.edu/barnett/PERC/default.asp

•

California: Redwood Health Library (Petaluma Health Care District), http://www.phcd.org/rdwdlib.html

•

California: Los Gatos PlaneTree Health Library, http://planetreesanjose.org/

•

California: Sutter Resource Library (Sutter Hospitals Foundation, Sacramento), http://suttermedicalcenter.org/library/

•

California: Health Sciences Libraries (University of California, Davis), http://www.lib.ucdavis.edu/healthsci/

•

California: ValleyCare Health Library & Ryan Comer Cancer Resource Center (ValleyCare Health System, Pleasanton), http://gaelnet.stmarysca.edu/other.libs/gbal/east/vchl.html

•

California: Washington Community Health Resource Library (Fremont), http://www.healthlibrary.org/

•

Colorado: William V. Gervasini Memorial Library (Exempla Healthcare), http://www.saintjosephdenver.org/yourhealth/libraries/

•

Connecticut: Hartford Hospital Health Science Libraries (Hartford Hospital), http://www.harthosp.org/library/

•

Connecticut: Healthnet: Connecticut Consumer Health Information Center (University of Connecticut Health Center, Lyman Maynard Stowe Library), http://library.uchc.edu/departm/hnet/

17

Abstracted from http://www.nlm.nih.gov/medlineplus/libraries.html.

Finding Medical Libraries

83

•

Connecticut: Waterbury Hospital Health Center Library (Waterbury Hospital, Waterbury), http://www.waterburyhospital.com/library/consumer.shtml

•

Delaware: Consumer Health Library (Christiana Care Health System, Eugene du Pont Preventive Medicine & Rehabilitation Institute, Wilmington), http://www.christianacare.org/health_guide/health_guide_pmri_health_info.cfm

•

Delaware: Lewis B. Flinn Library (Delaware Academy of Medicine, Wilmington), http://www.delamed.org/chls.html

•

Georgia: Family Resource Library (Medical College of Georgia, Augusta), http://cmc.mcg.edu/kids_families/fam_resources/fam_res_lib/frl.htm

•

Georgia: Health Resource Center (Medical Center of Central Georgia, Macon), http://www.mccg.org/hrc/hrchome.asp

•

Hawaii: Hawaii Medical Library: Consumer Health Information Service (Hawaii Medical Library, Honolulu), http://hml.org/CHIS/

•

Idaho: DeArmond Consumer Health Library (Kootenai Medical Center, Coeur d’Alene), http://www.nicon.org/DeArmond/index.htm

•

Illinois: Health Learning Center of Northwestern Memorial Hospital (Chicago), http://www.nmh.org/health_info/hlc.html

•

Illinois: Medical Library (OSF Saint Francis Medical Center, Peoria), http://www.osfsaintfrancis.org/general/library/

•

Kentucky: Medical Library - Services for Patients, Families, Students & the Public (Central Baptist Hospital, Lexington), http://www.centralbap.com/education/community/library.cfm

•

Kentucky: University of Kentucky - Health Information Library (Chandler Medical Center, Lexington), http://www.mc.uky.edu/PatientEd/

•

Louisiana: Alton Ochsner Medical Foundation Library (Alton Ochsner Medical Foundation, New Orleans), http://www.ochsner.org/library/

•

Louisiana: Louisiana State University Health Sciences Center Medical LibraryShreveport, http://lib-sh.lsuhsc.edu/

•

Maine: Franklin Memorial Hospital Medical Library (Franklin Memorial Hospital, Farmington), http://www.fchn.org/fmh/lib.htm

•

Maine: Gerrish-True Health Sciences Library (Central Maine Medical Center, Lewiston), http://www.cmmc.org/library/library.html

•

Maine: Hadley Parrot Health Science Library (Eastern Maine Healthcare, Bangor), http://www.emh.org/hll/hpl/guide.htm

•

Maine: Maine Medical Center Library (Maine Medical Center, Portland), http://www.mmc.org/library/

•

Maine: Parkview Hospital (Brunswick), http://www.parkviewhospital.org/

•

Maine: Southern Maine Medical Center Health Sciences Library (Southern Maine Medical Center, Biddeford), http://www.smmc.org/services/service.php3?choice=10

•

Maine: Stephens Memorial Hospital’s Health Information Library (Western Maine Health, Norway), http://www.wmhcc.org/Library/

84

Anovulation

•

Manitoba, Canada: Consumer & Patient Health Information Service (University of Manitoba Libraries), http://www.umanitoba.ca/libraries/units/health/reference/chis.html

•

Manitoba, Canada: J.W. Crane Memorial Library (Deer Lodge Centre, Winnipeg), http://www.deerlodge.mb.ca/crane_library/about.asp

•

Maryland: Health Information Center at the Wheaton Regional Library (Montgomery County, Dept. of Public Libraries, Wheaton Regional Library), http://www.mont.lib.md.us/healthinfo/hic.asp

•

Massachusetts: Baystate Medical Center Library (Baystate Health System), http://www.baystatehealth.com/1024/

•

Massachusetts: Boston University Medical Center Alumni Medical Library (Boston University Medical Center), http://med-libwww.bu.edu/library/lib.html

•

Massachusetts: Lowell General Hospital Health Sciences Library (Lowell General Hospital, Lowell), http://www.lowellgeneral.org/library/HomePageLinks/WWW.htm

•

Massachusetts: Paul E. Woodard Health Sciences Library (New England Baptist Hospital, Boston), http://www.nebh.org/health_lib.asp

•

Massachusetts: St. Luke’s Hospital Health Sciences Library (St. Luke’s Hospital, Southcoast Health System, New Bedford), http://www.southcoast.org/library/

•

Massachusetts: Treadwell Library Consumer Health Reference Center (Massachusetts General Hospital), http://www.mgh.harvard.edu/library/chrcindex.html

•

Massachusetts: UMass HealthNet (University of Massachusetts Medical School, Worchester), http://healthnet.umassmed.edu/

•

Michigan: Botsford General Hospital Library - Consumer Health (Botsford General Hospital, Library & Internet Services), http://www.botsfordlibrary.org/consumer.htm

•

Michigan: Helen DeRoy Medical Library (Providence Hospital and Medical Centers), http://www.providence-hospital.org/library/

•

Michigan: Marquette General Hospital - Consumer Health Library (Marquette General Hospital, Health Information Center), http://www.mgh.org/center.html

•

Michigan: Patient Education Resouce Center - University of Michigan Cancer Center (University of Michigan Comprehensive Cancer Center, Ann Arbor), http://www.cancer.med.umich.edu/learn/leares.htm

•

Michigan: Sladen Library & Center for Health Information Resources - Consumer Health Information (Detroit), http://www.henryford.com/body.cfm?id=39330

•

Montana: Center for Health Information (St. Patrick Hospital and Health Sciences Center, Missoula)

•

National: Consumer Health Library Directory (Medical Library Association, Consumer and Patient Health Information Section), http://caphis.mlanet.org/directory/index.html

•

National: National Network of Libraries of Medicine (National Library of Medicine) provides library services for health professionals in the United States who do not have access to a medical library, http://nnlm.gov/

•

National: NN/LM List of Libraries Serving the Public (National Network of Libraries of Medicine), http://nnlm.gov/members/

Finding Medical Libraries

85

•

Nevada: Health Science Library, West Charleston Library (Las Vegas-Clark County Library District, Las Vegas), http://www.lvccld.org/special_collections/medical/index.htm

•

New Hampshire: Dartmouth Biomedical Libraries (Dartmouth College Library, Hanover), http://www.dartmouth.edu/~biomed/resources.htmld/conshealth.htmld/

•

New Jersey: Consumer Health Library (Rahway Hospital, Rahway), http://www.rahwayhospital.com/library.htm

•

New Jersey: Dr. Walter Phillips Health Sciences Library (Englewood Hospital and Medical Center, Englewood), http://www.englewoodhospital.com/links/index.htm

•

New Jersey: Meland Foundation (Englewood Hospital and Medical Center, Englewood), http://www.geocities.com/ResearchTriangle/9360/

•

New York: Choices in Health Information (New York Public Library) - NLM Consumer Pilot Project participant, http://www.nypl.org/branch/health/links.html

•

New York: Health Information Center (Upstate Medical University, State University of New York, Syracuse), http://www.upstate.edu/library/hic/

•

New York: Health Sciences Library (Long Island Jewish Medical Center, New Hyde Park), http://www.lij.edu/library/library.html

•

New York: ViaHealth Medical Library (Rochester General Hospital), http://www.nyam.org/library/

•

Ohio: Consumer Health Library (Akron General Medical Center, Medical & Consumer Health Library), http://www.akrongeneral.org/hwlibrary.htm

•

Oklahoma: The Health Information Center at Saint Francis Hospital (Saint Francis Health System, Tulsa), http://www.sfh-tulsa.com/services/healthinfo.asp

•

Oregon: Planetree Health Resource Center (Mid-Columbia Medical Center, The Dalles), http://www.mcmc.net/phrc/

•

Pennsylvania: Community Health Information Library (Milton S. Hershey Medical Center, Hershey), http://www.hmc.psu.edu/commhealth/

•

Pennsylvania: Community Health Resource Library (Geisinger Medical Center, Danville), http://www.geisinger.edu/education/commlib.shtml

•

Pennsylvania: HealthInfo Library (Moses Taylor Hospital, Scranton), http://www.mth.org/healthwellness.html

•

Pennsylvania: Hopwood Library (University of Pittsburgh, Health Sciences Library System, Pittsburgh), http://www.hsls.pitt.edu/guides/chi/hopwood/index_html

•

Pennsylvania: Koop Community Health Information Center (College of Physicians of Philadelphia), http://www.collphyphil.org/kooppg1.shtml

•

Pennsylvania: Learning Resources Center - Medical Library (Susquehanna Health System, Williamsport), http://www.shscares.org/services/lrc/index.asp

•

Pennsylvania: Medical Library (UPMC Health System, Pittsburgh), http://www.upmc.edu/passavant/library.htm

•

Quebec, Canada: Medical Library (Montreal General Hospital), http://www.mghlib.mcgill.ca/

86

Anovulation

•

South Dakota: Rapid City Regional Hospital Medical Library (Rapid City Regional Hospital), http://www.rcrh.org/Services/Library/Default.asp

•

Texas: Houston HealthWays (Houston Academy of Medicine-Texas Medical Center Library), http://hhw.library.tmc.edu/

•

Washington: Community Health Library (Kittitas Valley Community Hospital), http://www.kvch.com/

•

Washington: Southwest Washington Medical Center Library (Southwest Washington Medical Center, Vancouver), http://www.swmedicalcenter.com/body.cfm?id=72

87

ONLINE GLOSSARIES The Internet provides access to a number of free-to-use medical dictionaries. The National Library of Medicine has compiled the following list of online dictionaries: •

ADAM Medical Encyclopedia (A.D.A.M., Inc.), comprehensive medical reference: http://www.nlm.nih.gov/medlineplus/encyclopedia.html

•

MedicineNet.com Medical Dictionary (MedicineNet, Inc.): http://www.medterms.com/Script/Main/hp.asp

•

Merriam-Webster Medical Dictionary (Inteli-Health, Inc.): http://www.intelihealth.com/IH/

•

Multilingual Glossary of Technical and Popular Medical Terms in Eight European Languages (European Commission) - Danish, Dutch, English, French, German, Italian, Portuguese, and Spanish: http://allserv.rug.ac.be/~rvdstich/eugloss/welcome.html

•

On-line Medical Dictionary (CancerWEB): http://cancerweb.ncl.ac.uk/omd/

•

Rare Diseases Terms (Office of Rare Diseases): http://ord.aspensys.com/asp/diseases/diseases.asp

•

Technology Glossary (National Library of Medicine) - Health Care Technology: http://www.nlm.nih.gov/nichsr/ta101/ta10108.htm

Beyond these, MEDLINEplus contains a very patient-friendly encyclopedia covering every aspect of medicine (licensed from A.D.A.M., Inc.). The ADAM Medical Encyclopedia can be accessed at http://www.nlm.nih.gov/medlineplus/encyclopedia.html. ADAM is also available on commercial Web sites such as drkoop.com (http://www.drkoop.com/) and Web MD (http://my.webmd.com/adam/asset/adam_disease_articles/a_to_z/a).

Online Dictionary Directories The following are additional online directories compiled by the National Library of Medicine, including a number of specialized medical dictionaries: •

Medical Dictionaries: Medical & Biological (World Health Organization): http://www.who.int/hlt/virtuallibrary/English/diction.htm#Medical

•

MEL-Michigan Electronic Library List of Online Health and Medical Dictionaries (Michigan Electronic Library): http://mel.lib.mi.us/health/health-dictionaries.html

•

Patient Education: Glossaries (DMOZ Open Directory Project): http://dmoz.org/Health/Education/Patient_Education/Glossaries/

•

Web of Online Dictionaries (Bucknell University): http://www.yourdictionary.com/diction5.html#medicine

89

ANOVULATION DICTIONARY The definitions below are derived from official public sources, including the National Institutes of Health [NIH] and the European Union [EU]. Abdominal: Having to do with the abdomen, which is the part of the body between the chest and the hips that contains the pancreas, stomach, intestines, liver, gallbladder, and other organs. [NIH] Abdominal fat: Fat (adipose tissue) that is centrally distributed between the thorax and pelvis and that induces greater health risk. [NIH] Aberrant: Wandering or deviating from the usual or normal course. [EU] Acetylcholine: A neurotransmitter. Acetylcholine in vertebrates is the major transmitter at neuromuscular junctions, autonomic ganglia, parasympathetic effector junctions, a subset of sympathetic effector junctions, and at many sites in the central nervous system. It is generally not used as an administered drug because it is broken down very rapidly by cholinesterases, but it is useful in some ophthalmological applications. [NIH] Acne: A disorder of the skin marked by inflammation of oil glands and hair glands. [NIH] Adaptation: 1. The adjustment of an organism to its environment, or the process by which it enhances such fitness. 2. The normal ability of the eye to adjust itself to variations in the intensity of light; the adjustment to such variations. 3. The decline in the frequency of firing of a neuron, particularly of a receptor, under conditions of constant stimulation. 4. In dentistry, (a) the proper fitting of a denture, (b) the degree of proximity and interlocking of restorative material to a tooth preparation, (c) the exact adjustment of bands to teeth. 5. In microbiology, the adjustment of bacterial physiology to a new environment. [EU] Adipocytes: Fat-storing cells found mostly in the abdominal cavity and subcutaneous tissue. Fat is usually stored in the form of tryglycerides. [NIH] Adipose Tissue: Connective tissue composed of fat cells lodged in the meshes of areolar tissue. [NIH] Adjustment: The dynamic process wherein the thoughts, feelings, behavior, and biophysiological mechanisms of the individual continually change to adjust to the environment. [NIH] Adolescence: The period of life beginning with the appearance of secondary sex characteristics and terminating with the cessation of somatic growth. The years usually referred to as adolescence lie between 13 and 18 years of age. [NIH] Adrenal Cortex: The outer layer of the adrenal gland. It secretes mineralocorticoids, androgens, and glucocorticoids. [NIH] Adrenal Medulla: The inner part of the adrenal gland; it synthesizes, stores and releases catecholamines. [NIH] Adrenergic: Activated by, characteristic of, or secreting epinephrine or substances with similar activity; the term is applied to those nerve fibres that liberate norepinephrine at a synapse when a nerve impulse passes, i.e., the sympathetic fibres. [EU] Adverse Effect: An unwanted side effect of treatment. [NIH] Afferent: Concerned with the transmission of neural impulse toward the central part of the nervous system. [NIH] Affinity: 1. Inherent likeness or relationship. 2. A special attraction for a specific element,

90

Anovulation

organ, or structure. 3. Chemical affinity; the force that binds atoms in molecules; the tendency of substances to combine by chemical reaction. 4. The strength of noncovalent chemical binding between two substances as measured by the dissociation constant of the complex. 5. In immunology, a thermodynamic expression of the strength of interaction between a single antigen-binding site and a single antigenic determinant (and thus of the stereochemical compatibility between them), most accurately applied to interactions among simple, uniform antigenic determinants such as haptens. Expressed as the association constant (K litres mole -1), which, owing to the heterogeneity of affinities in a population of antibody molecules of a given specificity, actually represents an average value (mean intrinsic association constant). 6. The reciprocal of the dissociation constant. [EU] Age of Onset: The age or period of life at which a disease or the initial symptoms or manifestations of a disease appear in an individual. [NIH] Agonist: In anatomy, a prime mover. In pharmacology, a drug that has affinity for and stimulates physiologic activity at cell receptors normally stimulated by naturally occurring substances. [EU] Algorithms: A procedure consisting of a sequence of algebraic formulas and/or logical steps to calculate or determine a given task. [NIH] Alimentary: Pertaining to food or nutritive material, or to the organs of digestion. [EU] Alkaloid: A member of a large group of chemicals that are made by plants and have nitrogen in them. Some alkaloids have been shown to work against cancer. [NIH] Alleles: Mutually exclusive forms of the same gene, occupying the same locus on homologous chromosomes, and governing the same biochemical and developmental process. [NIH] Allergen: An antigenic substance capable of producing immediate-type hypersensitivity (allergy). [EU] Alopecia: Absence of hair from areas where it is normally present. [NIH] Alternative medicine: Practices not generally recognized by the medical community as standard or conventional medical approaches and used instead of standard treatments. Alternative medicine includes the taking of dietary supplements, megadose vitamins, and herbal preparations; the drinking of special teas; and practices such as massage therapy, magnet therapy, spiritual healing, and meditation. [NIH] Amenorrhea: Absence of menstruation. [NIH] Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining protein conformation. [NIH] Amino Acids: Organic compounds that generally contain an amino (-NH2) and a carboxyl (COOH) group. Twenty alpha-amino acids are the subunits which are polymerized to form proteins. [NIH] Amino Acids: Organic compounds that generally contain an amino (-NH2) and a carboxyl (COOH) group. Twenty alpha-amino acids are the subunits which are polymerized to form proteins. [NIH] Amniotic Fluid: Amniotic cavity fluid which is produced by the amnion and fetal lungs and kidneys. [NIH] Anaesthesia: Loss of feeling or sensation. Although the term is used for loss of tactile sensibility, or of any of the other senses, it is applied especially to loss of the sensation of pain, as it is induced to permit performance of surgery or other painful procedures. [EU]

Dictionary 91

Anatomical: Pertaining to anatomy, or to the structure of the organism. [EU] Androgenic: Producing masculine characteristics. [EU] Androgens: A class of sex hormones associated with the development and maintenance of the secondary male sex characteristics, sperm induction, and sexual differentiation. In addition to increasing virility and libido, they also increase nitrogen and water retention and stimulate skeletal growth. [NIH] Androstenedione: A steroid with androgenic properties that is produced in the testis, ovary, and adrenal cortex. It is a precursor to testosterone and other androgenic hormones. [NIH] Anestrus: Period of sexual inactivity between estrus periods in animals. [NIH] Animal model: An animal with a disease either the same as or like a disease in humans. Animal models are used to study the development and progression of diseases and to test new treatments before they are given to humans. Animals with transplanted human cancers or other tissues are called xenograft models. [NIH] Annealing: The spontaneous alignment of two single DNA strands to form a double helix. [NIH]

Anorexia: Lack or loss of appetite for food. Appetite is psychologic, dependent on memory and associations. Anorexia can be brought about by unattractive food, surroundings, or company. [NIH] Anorexia Nervosa: The chief symptoms are inability to eat, weight loss, and amenorrhea. [NIH]

Anovulation: Suspension or cessation of ovulation in animals and humans. [NIH] Antibody: A type of protein made by certain white blood cells in response to a foreign substance (antigen). Each antibody can bind to only a specific antigen. The purpose of this binding is to help destroy the antigen. Antibodies can work in several ways, depending on the nature of the antigen. Some antibodies destroy antigens directly. Others make it easier for white blood cells to destroy the antigen. [NIH] Antigen: Any substance which is capable, under appropriate conditions, of inducing a specific immune response and of reacting with the products of that response, that is, with specific antibody or specifically sensitized T-lymphocytes, or both. Antigens may be soluble substances, such as toxins and foreign proteins, or particulate, such as bacteria and tissue cells; however, only the portion of the protein or polysaccharide molecule known as the antigenic determinant (q.v.) combines with antibody or a specific receptor on a lymphocyte. Abbreviated Ag. [EU] Anti-inflammatory: Having to do with reducing inflammation. [NIH] Arterial: Pertaining to an artery or to the arteries. [EU] Arteries: The vessels carrying blood away from the heart. [NIH] Artery: Vessel-carrying blood from the heart to various parts of the body. [NIH] Ascites: Accumulation or retention of free fluid within the peritoneal cavity. [NIH] Aseptic: Free from infection or septic material; sterile. [EU] Assay: Determination of the amount of a particular constituent of a mixture, or of the biological or pharmacological potency of a drug. [EU] Bacteria: Unicellular prokaryotic microorganisms which generally possess rigid cell walls, multiply by cell division, and exhibit three principal forms: round or coccal, rodlike or bacillary, and spiral or spirochetal. [NIH] Basal Ganglia: Large subcortical nuclear masses derived from the telencephalon and located in the basal regions of the cerebral hemispheres. [NIH]

92

Anovulation

Base: In chemistry, the nonacid part of a salt; a substance that combines with acids to form salts; a substance that dissociates to give hydroxide ions in aqueous solutions; a substance whose molecule or ion can combine with a proton (hydrogen ion); a substance capable of donating a pair of electrons (to an acid) for the formation of a coordinate covalent bond. [EU] Behavior Therapy: The application of modern theories of learning and conditioning in the treatment of behavior disorders. [NIH] Behavioral Medicine: The interdisciplinary field concerned with the development and integration of behavioral and biomedical science, knowledge, and techniques relevant to health and illness and the application of this knowledge and these techniques to prevention, diagnosis, treatment, and rehabilitation. [NIH] Beta-Endorphin: A peptide consisting of amino acid sequence 61-91 of the endogenous pituitary hormone beta-lipotropin. The first four amino acids show a common tetrapeptide sequence with methionine- and leucine enkephalin. The compound shows opiate-like activity. Injection of beta-endorphin induces a profound analgesia of the whole body for several hours. This action is reversed after administration of naloxone. [NIH] Bilateral: Affecting both the right and left side of body. [NIH] Bile: An emulsifying agent produced in the liver and secreted into the duodenum. Its composition includes bile acids and salts, cholesterol, and electrolytes. It aids digestion of fats in the duodenum. [NIH] Biomarkers: Substances sometimes found in an increased amount in the blood, other body fluids, or tissues and that may suggest the presence of some types of cancer. Biomarkers include CA 125 (ovarian cancer), CA 15-3 (breast cancer), CEA (ovarian, lung, breast, pancreas, and GI tract cancers), and PSA (prostate cancer). Also called tumor markers. [NIH] Biopsy: Removal and pathologic examination of specimens in the form of small pieces of tissue from the living body. [NIH] Biosynthesis: The building up of a chemical compound in the physiologic processes of a living organism. [EU] Biotechnology: Body of knowledge related to the use of organisms, cells or cell-derived constituents for the purpose of developing products which are technically, scientifically and clinically useful. Alteration of biologic function at the molecular level (i.e., genetic engineering) is a central focus; laboratory methods used include transfection and cloning technologies, sequence and structure analysis algorithms, computer databases, and gene and protein structure function analysis and prediction. [NIH] Bladder: The organ that stores urine. [NIH] Blastocyst: The mammalian embryo in the post-morula stage in which a fluid-filled cavity, enclosed primarily by trophoblast, contains an inner cell mass which becomes the embryonic disc. [NIH] Blood Glucose: Glucose in blood. [NIH] Blood pressure: The pressure of blood against the walls of a blood vessel or heart chamber. Unless there is reference to another location, such as the pulmonary artery or one of the heart chambers, it refers to the pressure in the systemic arteries, as measured, for example, in the forearm. [NIH] Blood vessel: A tube in the body through which blood circulates. Blood vessels include a network of arteries, arterioles, capillaries, venules, and veins. [NIH] Blot: To transfer DNA, RNA, or proteins to an immobilizing matrix such as nitrocellulose. [NIH]

Body Composition: The relative amounts of various components in the body, such as

Dictionary 93

percent body fat. [NIH] Body Fluids: Liquid components of living organisms. [NIH] Bone Marrow: The soft tissue filling the cavities of bones. Bone marrow exists in two types, yellow and red. Yellow marrow is found in the large cavities of large bones and consists mostly of fat cells and a few primitive blood cells. Red marrow is a hematopoietic tissue and is the site of production of erythrocytes and granular leukocytes. Bone marrow is made up of a framework of connective tissue containing branching fibers with the frame being filled with marrow cells. [NIH] Brain Stem: The part of the brain that connects the cerebral hemispheres with the spinal cord. It consists of the mesencephalon, pons, and medulla oblongata. [NIH] Breast Feeding: The nursing of an infant at the mother's breast. [NIH] Breeding: The science or art of changing the constitution of a population of plants or animals through sexual reproduction. [NIH] Bromocriptine: A semisynthetic ergot alkaloid that is a dopamine D2 agonist. It suppresses prolactin secretion and is used to treat amenorrhea, galactorrhea, and female infertility, and has been proposed for Parkinson disease. [NIH] Calcification: Deposits of calcium in the tissues of the breast. Calcification in the breast can be seen on a mammogram, but cannot be detected by touch. There are two types of breast calcification, macrocalcification and microcalcification. Macrocalcifications are large deposits and are usually not related to cancer. Microcalcifications are specks of calcium that may be found in an area of rapidly dividing cells. Many microcalcifications clustered together may be a sign of cancer. [NIH] Calcium: A basic element found in nearly all organized tissues. It is a member of the alkaline earth family of metals with the atomic symbol Ca, atomic number 20, and atomic weight 40. Calcium is the most abundant mineral in the body and combines with phosphorus to form calcium phosphate in the bones and teeth. It is essential for the normal functioning of nerves and muscles and plays a role in blood coagulation (as factor IV) and in many enzymatic processes. [NIH] Carbohydrate: An aldehyde or ketone derivative of a polyhydric alcohol, particularly of the pentahydric and hexahydric alcohols. They are so named because the hydrogen and oxygen are usually in the proportion to form water, (CH2O)n. The most important carbohydrates are the starches, sugars, celluloses, and gums. They are classified into mono-, di-, tri-, polyand heterosaccharides. [EU] Carcinogenic: Producing carcinoma. [EU] Carcinoma: Cancer that begins in the skin or in tissues that line or cover internal organs. [NIH]

Cardiac: Having to do with the heart. [NIH] Cardiovascular: Having to do with the heart and blood vessels. [NIH] Cardiovascular disease: Any abnormal condition characterized by dysfunction of the heart and blood vessels. CVD includes atherosclerosis (especially coronary heart disease, which can lead to heart attacks), cerebrovascular disease (e.g., stroke), and hypertension (high blood pressure). [NIH] Carotid Arteries: Either of the two principal arteries on both sides of the neck that supply blood to the head and neck; each divides into two branches, the internal carotid artery and the external carotid artery. [NIH] Case report: A detailed report of the diagnosis, treatment, and follow-up of an individual patient. Case reports also contain some demographic information about the patient (for

94

Anovulation

example, age, gender, ethnic origin). [NIH] Catecholamine: A group of chemical substances manufactured by the adrenal medulla and secreted during physiological stress. [NIH] Caudal: Denoting a position more toward the cauda, or tail, than some specified point of reference; same as inferior, in human anatomy. [EU] Caudate Nucleus: Elongated gray mass of the neostriatum located adjacent to the lateral ventricle of the brain. [NIH] Causal: Pertaining to a cause; directed against a cause. [EU] Causality: The relating of causes to the effects they produce. Causes are termed necessary when they must always precede an effect and sufficient when they initiate or produce an effect. Any of several factors may be associated with the potential disease causation or outcome, including predisposing factors, enabling factors, precipitating factors, reinforcing factors, and risk factors. [NIH] Cell: The individual unit that makes up all of the tissues of the body. All living things are made up of one or more cells. [NIH] Cell Cycle: The complex series of phenomena, occurring between the end of one cell division and the end of the next, by which cellular material is divided between daughter cells. [NIH] Cell Differentiation: Progressive restriction of the developmental potential and increasing specialization of function which takes place during the development of the embryo and leads to the formation of specialized cells, tissues, and organs. [NIH] Cell Division: The fission of a cell. [NIH] Cell proliferation: An increase in the number of cells as a result of cell growth and cell division. [NIH] Cerebellum: Part of the metencephalon that lies in the posterior cranial fossa behind the brain stem. It is concerned with the coordination of movement. [NIH] Cerebral: Of or pertaining of the cerebrum or the brain. [EU] Cerebral Cortex: The thin layer of gray matter on the surface of the cerebral hemisphere that develops from the telencephalon and folds into gyri. It reaches its highest development in man and is responsible for intellectual faculties and higher mental functions. [NIH] Cerebrovascular: Pertaining to the blood vessels of the cerebrum, or brain. [EU] Cervical: Relating to the neck, or to the neck of any organ or structure. Cervical lymph nodes are located in the neck; cervical cancer refers to cancer of the uterine cervix, which is the lower, narrow end (the "neck") of the uterus. [NIH] Cervix: The lower, narrow end of the uterus that forms a canal between the uterus and vagina. [NIH] Cholesterol: The principal sterol of all higher animals, distributed in body tissues, especially the brain and spinal cord, and in animal fats and oils. [NIH] Choline: A basic constituent of lecithin that is found in many plants and animal organs. It is important as a precursor of acetylcholine, as a methyl donor in various metabolic processes, and in lipid metabolism. [NIH] Cholinergic: Resembling acetylcholine in pharmacological action; stimulated by or releasing acetylcholine or a related compound. [EU] Chromosome: Part of a cell that contains genetic information. Except for sperm and eggs, all human cells contain 46 chromosomes. [NIH]

Dictionary 95

Chronic: A disease or condition that persists or progresses over a long period of time. [NIH] Chronic renal: Slow and progressive loss of kidney function over several years, often resulting in end-stage renal disease. People with end-stage renal disease need dialysis or transplantation to replace the work of the kidneys. [NIH] Clamp: A u-shaped steel rod used with a pin or wire for skeletal traction in the treatment of certain fractures. [NIH] Clinical study: A research study in which patients receive treatment in a clinic or other medical facility. Reports of clinical studies can contain results for single patients (case reports) or many patients (case series or clinical trials). [NIH] Clinical trial: A research study that tests how well new medical treatments or other interventions work in people. Each study is designed to test new methods of screening, prevention, diagnosis, or treatment of a disease. [NIH] Clomiphene: A stilbene derivative that functions both as a partial estrogen agonist and complete estrogen antagonist depending on the target tissue. It antagonizes the estrogen receptor thereby initiating or augmenting ovulation in anovulatory women. [NIH] Cloning: The production of a number of genetically identical individuals; in genetic engineering, a process for the efficient replication of a great number of identical DNA molecules. [NIH] Cognitive behavior therapy: A system of psychotherapy based on the premise that distorted or dysfunctional thinking, which influences a person's mood or behavior, is common to all psychosocial problems. The focus of therapy is to identify the distorted thinking and to replace it with more rational, adaptive thoughts and beliefs. [NIH] Combination Therapy: Association of 3 drugs to treat AIDS (AZT + DDC or DDI + protease inhibitor). [NIH] Complement: A term originally used to refer to the heat-labile factor in serum that causes immune cytolysis, the lysis of antibody-coated cells, and now referring to the entire functionally related system comprising at least 20 distinct serum proteins that is the effector not only of immune cytolysis but also of other biologic functions. Complement activation occurs by two different sequences, the classic and alternative pathways. The proteins of the classic pathway are termed 'components of complement' and are designated by the symbols C1 through C9. C1 is a calcium-dependent complex of three distinct proteins C1q, C1r and C1s. The proteins of the alternative pathway (collectively referred to as the properdin system) and complement regulatory proteins are known by semisystematic or trivial names. Fragments resulting from proteolytic cleavage of complement proteins are designated with lower-case letter suffixes, e.g., C3a. Inactivated fragments may be designated with the suffix 'i', e.g. C3bi. Activated components or complexes with biological activity are designated by a bar over the symbol e.g. C1 or C4b,2a. The classic pathway is activated by the binding of C1 to classic pathway activators, primarily antigen-antibody complexes containing IgM, IgG1, IgG3; C1q binds to a single IgM molecule or two adjacent IgG molecules. The alternative pathway can be activated by IgA immune complexes and also by nonimmunologic materials including bacterial endotoxins, microbial polysaccharides, and cell walls. Activation of the classic pathway triggers an enzymatic cascade involving C1, C4, C2 and C3; activation of the alternative pathway triggers a cascade involving C3 and factors B, D and P. Both result in the cleavage of C5 and the formation of the membrane attack complex. Complement activation also results in the formation of many biologically active complement fragments that act as anaphylatoxins, opsonins, or chemotactic factors. [EU] Complementary and alternative medicine: CAM. Forms of treatment that are used in addition to (complementary) or instead of (alternative) standard treatments. These practices

96

Anovulation

are not considered standard medical approaches. CAM includes dietary supplements, megadose vitamins, herbal preparations, special teas, massage therapy, magnet therapy, spiritual healing, and meditation. [NIH] Complementary medicine: Practices not generally recognized by the medical community as standard or conventional medical approaches and used to enhance or complement the standard treatments. Complementary medicine includes the taking of dietary supplements, megadose vitamins, and herbal preparations; the drinking of special teas; and practices such as massage therapy, magnet therapy, spiritual healing, and meditation. [NIH] Compliance: Distensibility measure of a chamber such as the lungs (lung compliance) or bladder. Compliance is expressed as a change in volume per unit change in pressure. [NIH] Computational Biology: A field of biology concerned with the development of techniques for the collection and manipulation of biological data, and the use of such data to make biological discoveries or predictions. This field encompasses all computational methods and theories applicable to molecular biology and areas of computer-based techniques for solving biological problems including manipulation of models and datasets. [NIH] Conception: The onset of pregnancy, marked by implantation of the blastocyst; the formation of a viable zygote. [EU] Concomitant: Accompanying; accessory; joined with another. [EU] Connective Tissue: Tissue that supports and binds other tissues. It consists of connective tissue cells embedded in a large amount of extracellular matrix. [NIH] Connective Tissue: Tissue that supports and binds other tissues. It consists of connective tissue cells embedded in a large amount of extracellular matrix. [NIH] Connective Tissue Cells: A group of cells that includes fibroblasts, cartilage cells, adipocytes, smooth muscle cells, and bone cells. [NIH] Contraception: Use of agents, devices, methods, or procedures which diminish the likelihood of or prevent conception. [NIH] Contraceptive: An agent that diminishes the likelihood of or prevents conception. [EU] Contraindications: Any factor or sign that it is unwise to pursue a certain kind of action or treatment, e. g. giving a general anesthetic to a person with pneumonia. [NIH] Controlled clinical trial: A clinical study that includes a comparison (control) group. The comparison group receives a placebo, another treatment, or no treatment at all. [NIH] Coordination: Muscular or motor regulation or the harmonious cooperation of muscles or groups of muscles, in a complex action or series of actions. [NIH] Cornea: The transparent part of the eye that covers the iris and the pupil and allows light to enter the inside. [NIH] Coronary: Encircling in the manner of a crown; a term applied to vessels; nerves, ligaments, etc. The term usually denotes the arteries that supply the heart muscle and, by extension, a pathologic involvement of them. [EU] Coronary heart disease: A type of heart disease caused by narrowing of the coronary arteries that feed the heart, which needs a constant supply of oxygen and nutrients carried by the blood in the coronary arteries. When the coronary arteries become narrowed or clogged by fat and cholesterol deposits and cannot supply enough blood to the heart, CHD results. [NIH] Corpus: The body of the uterus. [NIH] Corpus Luteum: The yellow glandular mass formed in the ovary by an ovarian follicle that has ruptured and discharged its ovum. [NIH]

Dictionary 97

Cortex: The outer layer of an organ or other body structure, as distinguished from the internal substance. [EU] Cortical: Pertaining to or of the nature of a cortex or bark. [EU] Cortisol: A steroid hormone secreted by the adrenal cortex as part of the body's response to stress. [NIH] Cortisone: A natural steroid hormone produced in the adrenal gland. It can also be made in the laboratory. Cortisone reduces swelling and can suppress immune responses. [NIH] Coumarin: A fluorescent dye. [NIH] Coumestrol: A coumarin derivative occurring naturally in forage crops which has estrogenic activity. [NIH] Cranial: Pertaining to the cranium, or to the anterior (in animals) or superior (in humans) end of the body. [EU] Curative: Tending to overcome disease and promote recovery. [EU] Cyclic: Pertaining to or occurring in a cycle or cycles; the term is applied to chemical compounds that contain a ring of atoms in the nucleus. [EU] Cyclin: Molecule that regulates the cell cycle. [NIH] Cyclin-Dependent Kinases: Protein kinases that control cell cycle progression in all eukaryotes and require physical association with cyclins to achieve full enzymatic activity. Cyclin-dependent kinases are regulated by phosphorylation and dephosphorylation events. [NIH]

Cyproterone: An anti-androgen that, in the form of its acetate, also has progestational properties. It is used in the treatment of hypersexuality in males, as a palliative in prostatic carcinoma, and, in combination with estrogen, for the therapy of severe acne and hirsutism in females. [NIH] Cyst: A sac or capsule filled with fluid. [NIH] Cytokines: Non-antibody proteins secreted by inflammatory leukocytes and some nonleukocytic cells, that act as intercellular mediators. They differ from classical hormones in that they are produced by a number of tissue or cell types rather than by specialized glands. They generally act locally in a paracrine or autocrine rather than endocrine manner. [NIH] Denaturation: Rupture of the hydrogen bonds by heating a DNA solution and then cooling it rapidly causes the two complementary strands to separate. [NIH] Dendrites: Extensions of the nerve cell body. They are short and branched and receive stimuli from other neurons. [NIH] Dentate Gyrus: Gray matter situated above the gyrus hippocampi. It is composed of three layers. The molecular layer is continuous with the hippocampus in the hippocampal fissure. The granular layer consists of closely arranged spherical or oval neurons, called granule cells, whose axons pass through the polymorphic layer ending on the dendrites of pyramidal cells in the hippocampus. [NIH] Deoxyribonucleic: A polymer of subunits called deoxyribonucleotides which is the primary genetic material of a cell, the material equivalent to genetic information. [NIH] Deoxyribonucleic acid: A polymer of subunits called deoxyribonucleotides which is the primary genetic material of a cell, the material equivalent to genetic information. [NIH] Diabetes Insipidus: A metabolic disorder due to disorders in the production or release of vasopressin. It is characterized by the chronic excretion of large amounts of low specific gravity urine and great thirst. [NIH]

98

Anovulation

Diabetes Mellitus: A heterogeneous group of disorders that share glucose intolerance in common. [NIH] Diagnostic procedure: A method used to identify a disease. [NIH] Diastole: Period of relaxation of the heart, especially the ventricles. [NIH] Diastolic: Of or pertaining to the diastole. [EU] Digestion: The process of breakdown of food for metabolism and use by the body. [NIH] Direct: 1. Straight; in a straight line. 2. Performed immediately and without the intervention of subsidiary means. [EU] Discrete: Made up of separate parts or characterized by lesions which do not become blended; not running together; separate. [NIH] Dopamine: An endogenous catecholamine and prominent neurotransmitter in several systems of the brain. In the synthesis of catecholamines from tyrosine, it is the immediate precursor to norepinephrine and epinephrine. Dopamine is a major transmitter in the extrapyramidal system of the brain, and important in regulating movement. A family of dopaminergic receptor subtypes mediate its action. Dopamine is used pharmacologically for its direct (beta adrenergic agonist) and indirect (adrenergic releasing) sympathomimetic effects including its actions as an inotropic agent and as a renal vasodilator. [NIH] Double-blind: Pertaining to a clinical trial or other experiment in which neither the subject nor the person administering treatment knows which treatment any particular subject is receiving. [EU] Drive: A state of internal activity of an organism that is a necessary condition before a given stimulus will elicit a class of responses; e.g., a certain level of hunger (drive) must be present before food will elicit an eating response. [NIH] Drug Interactions: The action of a drug that may affect the activity, metabolism, or toxicity of another drug. [NIH] Duct: A tube through which body fluids pass. [NIH] Duodenum: The first part of the small intestine. [NIH] Dynorphins: A class of opioid peptides including dynorphin A, dynorphin B, and smaller fragments of these peptides. Dynorphins prefer kappa-opioid receptors (receptors, opioid, kappa) and have been shown to play a role as central nervous system transmitters. [NIH] Dyslipidemia: Disorders in the lipoprotein metabolism; classified as hypercholesterolemia, hypertriglyceridemia, combined hyperlipidemia, and low levels of high-density lipoprotein (HDL) cholesterol. All of the dyslipidemias can be primary or secondary. Both elevated levels of low-density lipoprotein (LDL) cholesterol and low levels of HDL cholesterol predispose to premature atherosclerosis. [NIH] Dysmenorrhea: Painful menstruation. [NIH] Dysphoric: A feeling of unpleasantness and discomfort. [NIH] Eating Disorders: A group of disorders characterized by physiological and psychological disturbances in appetite or food intake. [NIH] Edema: Excessive amount of watery fluid accumulated in the intercellular spaces, most commonly present in subcutaneous tissue. [NIH] Effector: It is often an enzyme that converts an inactive precursor molecule into an active second messenger. [NIH] Efferent: Nerve fibers which conduct impulses from the central nervous system to muscles and glands. [NIH]

Dictionary 99

Efficacy: The extent to which a specific intervention, procedure, regimen, or service produces a beneficial result under ideal conditions. Ideally, the determination of efficacy is based on the results of a randomized control trial. [NIH] Ejaculation: The release of semen through the penis during orgasm. [NIH] Elective: Subject to the choice or decision of the patient or physician; applied to procedures that are advantageous to the patient but not urgent. [EU] Electrolysis: Destruction by passage of a galvanic electric current, as in disintegration of a chemical compound in solution. [NIH] Electrolyte: A substance that dissociates into ions when fused or in solution, and thus becomes capable of conducting electricity; an ionic solute. [EU] Embryo: The prenatal stage of mammalian development characterized by rapid morphological changes and the differentiation of basic structures. [NIH] Embryo Transfer: Removal of a mammalian embryo from one environment and replacement in the same or a new environment. The embryo is usually in the pre-nidation phase, i.e., a blastocyst. The process includes embryo or blastocyst transplantation or transfer after in vitro fertilization and transfer of the inner cell mass of the blastocyst. It is not used for transfer of differentiated embryonic tissue, e.g., germ layer cells. [NIH] Endocrine System: The system of glands that release their secretions (hormones) directly into the circulatory system. In addition to the endocrine glands, included are the chromaffin system and the neurosecretory systems. [NIH] Endocrinology: A subspecialty of internal medicine concerned with the metabolism, physiology, and disorders of the endocrine system. [NIH] Endogenous: Produced inside an organism or cell. The opposite is external (exogenous) production. [NIH] Endometrial: Having to do with the endometrium (the layer of tissue that lines the uterus). [NIH]

Endometriosis: A condition in which tissue more or less perfectly resembling the uterine mucous membrane (the endometrium) and containing typical endometrial granular and stromal elements occurs aberrantly in various locations in the pelvic cavity. [NIH] Endometrium: The layer of tissue that lines the uterus. [NIH] Endorphins: One of the three major groups of endogenous opioid peptides. They are large peptides derived from the pro-opiomelanocortin precursor. The known members of this group are alpha-, beta-, and gamma-endorphin. The term endorphin is also sometimes used to refer to all opioid peptides, but the narrower sense is used here; opioid peptides is used for the broader group. [NIH] End-stage renal: Total chronic kidney failure. When the kidneys fail, the body retains fluid and harmful wastes build up. A person with ESRD needs treatment to replace the work of the failed kidneys. [NIH] Energy balance: Energy is the capacity of a body or a physical system for doing work. Energy balance is the state in which the total energy intake equals total energy needs. [NIH] Enkephalin: A natural opiate painkiller, in the hypothalamus. [NIH] Entorhinal Cortex: Cortex where the signals are combined with those from other sensory systems. [NIH] Environmental Exposure: The exposure to potentially harmful chemical, physical, or biological agents in the environment or to environmental factors that may include ionizing radiation, pathogenic organisms, or toxic chemicals. [NIH]

100

Anovulation

Environmental Health: The science of controlling or modifying those conditions, influences, or forces surrounding man which relate to promoting, establishing, and maintaining health. [NIH]

Enzymatic: Phase where enzyme cuts the precursor protein. [NIH] Enzyme: A protein that speeds up chemical reactions in the body. [NIH] Epidemiological: Relating to, or involving epidemiology. [EU] Epimestrol: A synthetic steroid with estrogenic activity. [NIH] Epinephrine: The active sympathomimetic hormone from the adrenal medulla in most species. It stimulates both the alpha- and beta- adrenergic systems, causes systemic vasoconstriction and gastrointestinal relaxation, stimulates the heart, and dilates bronchi and cerebral vessels. It is used in asthma and cardiac failure and to delay absorption of local anesthetics. [NIH] Ergot: Cataract due to ergot poisoning caused by eating of rye cereals contaminated by a fungus. [NIH] Erythrocytes: Red blood cells. Mature erythrocytes are non-nucleated, biconcave disks containing hemoglobin whose function is to transport oxygen. [NIH] Estradiol: The most potent mammalian estrogenic hormone. It is produced in the ovary, placenta, testis, and possibly the adrenal cortex. [NIH] Estrogen: One of the two female sex hormones. [NIH] Estrogen receptor: ER. Protein found on some cancer cells to which estrogen will attach. [NIH]

Etoposide: A semisynthetic derivative of podophyllotoxin that exhibits antitumor activity. Etoposide inhibits DNA synthesis by forming a complex with topoisomerase II and DNA. This complex induces breaks in double stranded DNA and prevents repair by topoisomerase II binding. Accumulated breaks in DNA prevent entry into the mitotic phase of cell division, and lead to cell death. Etoposide acts primarily in the G2 and S phases of the cell cycle. [NIH] Eukaryotic Cells: Cells of the higher organisms, containing a true nucleus bounded by a nuclear membrane. [NIH] Evoke: The electric response recorded from the cerebral cortex after stimulation of a peripheral sense organ. [NIH] Excitation: An act of irritation or stimulation or of responding to a stimulus; the addition of energy, as the excitation of a molecule by absorption of photons. [EU] Exogenous: Developed or originating outside the organism, as exogenous disease. [EU] Extrapyramidal: Outside of the pyramidal tracts. [EU] Family Planning: Programs or services designed to assist the family in controlling reproduction by either improving or diminishing fertility. [NIH] Fat: Total lipids including phospholipids. [NIH] Feeding Behavior: Behavioral responses or sequences associated with eating including modes of feeding, rhythmic patterns of eating, and time intervals. [NIH] Fertilization in Vitro: Fertilization of an egg outside the body when the egg is normally fertilized in the body. [NIH] Fetal Weight: The weight of the fetus in utero, which is usually estimated by various formulas based on measurements made during prenatal ultrasonography. [NIH] Fetus: The developing offspring from 7 to 8 weeks after conception until birth. [NIH]

Dictionary 101

Fixation: 1. The act or operation of holding, suturing, or fastening in a fixed position. 2. The condition of being held in a fixed position. 3. In psychiatry, a term with two related but distinct meanings : (1) arrest of development at a particular stage, which like regression (return to an earlier stage), if temporary is a normal reaction to setbacks and difficulties but if protracted or frequent is a cause of developmental failures and emotional problems, and (2) a close and suffocating attachment to another person, especially a childhood figure, such as one's mother or father. Both meanings are derived from psychoanalytic theory and refer to 'fixation' of libidinal energy either in a specific erogenous zone, hence fixation at the oral, anal, or phallic stage, or in a specific object, hence mother or father fixation. 4. The use of a fixative (q.v.) to preserve histological or cytological specimens. 5. In chemistry, the process whereby a substance is removed from the gaseous or solution phase and localized, as in carbon dioxide fixation or nitrogen fixation. 6. In ophthalmology, direction of the gaze so that the visual image of the object falls on the fovea centralis. 7. In film processing, the chemical removal of all undeveloped salts of the film emulsion, leaving only the developed silver to form a permanent image. [EU] Flutamide: An antiandrogen with about the same potency as cyproterone in rodent and canine species. [NIH] Foetoplacental: Pertaining to the fetus and placenta. [EU] Follicles: Shafts through which hair grows. [NIH] Follicular Fluid: A fluid consisting of sex steroid hormones, plasma proteins, mucopolysaccharides, and electrolytes that is present in the vesicular ovarian follicle (Graafian follicle) surrounding the ovum. [NIH] Follicular Phase: The period of the menstrual cycle that begins with menstruation and ends with ovulation. [NIH] Forearm: The part between the elbow and the wrist. [NIH] Fossa: A cavity, depression, or pit. [NIH] Fourth Ventricle: An irregularly shaped cavity in the rhombencephalon, between the medulla oblongata, the pons, and the isthmus in front, and the cerebellum behind. It is continuous with the central canal of the cord below and with the cerebral aqueduct above, and through its lateral and median apertures it communicates with the subarachnoid space. [NIH]

Fractionation: Dividing the total dose of radiation therapy into several smaller, equal doses delivered over a period of several days. [NIH] Gallbladder: The pear-shaped organ that sits below the liver. Bile is concentrated and stored in the gallbladder. [NIH] Ganglia: Clusters of multipolar neurons surrounded by a capsule of loosely organized connective tissue located outside the central nervous system. [NIH] Gastrin: A hormone released after eating. Gastrin causes the stomach to produce more acid. [NIH]

Gene: The functional and physical unit of heredity passed from parent to offspring. Genes are pieces of DNA, and most genes contain the information for making a specific protein. [NIH]

Gene Expression: The phenotypic manifestation of a gene or genes by the processes of gene action. [NIH] Generator: Any system incorporating a fixed parent radionuclide from which is produced a daughter radionuclide which is to be removed by elution or by any other method and used in a radiopharmaceutical. [NIH]

102

Anovulation

Genetic testing: Analyzing DNA to look for a genetic alteration that may indicate an increased risk for developing a specific disease or disorder. [NIH] Genotype: The genetic constitution of the individual; the characterization of the genes. [NIH] Germ Cells: The reproductive cells in multicellular organisms. [NIH] Gestation: The period of development of the young in viviparous animals, from the time of fertilization of the ovum until birth. [EU] Gestational: Psychosis attributable to or occurring during pregnancy. [NIH] Gestational Age: Age of the conceptus. In humans, this may be assessed by medical history, physical examination, early immunologic pregnancy tests, radiography, ultrasonography, and amniotic fluid analysis. [NIH] Gland: An organ that produces and releases one or more substances for use in the body. Some glands produce fluids that affect tissues or organs. Others produce hormones or participate in blood production. [NIH] Globus Pallidus: The representation of the phylogenetically oldest part of the corpus striatum called the paleostriatum. It forms the smaller, more medial part of the lentiform nucleus. [NIH] Glucocorticoid: A compound that belongs to the family of compounds called corticosteroids (steroids). Glucocorticoids affect metabolism and have anti-inflammatory and immunosuppressive effects. They may be naturally produced (hormones) or synthetic (drugs). [NIH] Glucose: D-Glucose. A primary source of energy for living organisms. It is naturally occurring and is found in fruits and other parts of plants in its free state. It is used therapeutically in fluid and nutrient replacement. [NIH] Glucose Intolerance: A pathological state in which the fasting plasma glucose level is less than 140 mg per deciliter and the 30-, 60-, or 90-minute plasma glucose concentration following a glucose tolerance test exceeds 200 mg per deciliter. This condition is seen frequently in diabetes mellitus but also occurs with other diseases. [NIH] Glucose tolerance: The power of the normal liver to absorb and store large quantities of glucose and the effectiveness of intestinal absorption of glucose. The glucose tolerance test is a metabolic test of carbohydrate tolerance that measures active insulin, a hepatic function based on the ability of the liver to absorb glucose. The test consists of ingesting 100 grams of glucose into a fasting stomach; blood sugar should return to normal in 2 to 21 hours after ingestion. [NIH] Glucose Tolerance Test: Determination of whole blood or plasma sugar in a fasting state before and at prescribed intervals (usually 1/2 hr, 1 hr, 3 hr, 4 hr) after taking a specified amount (usually 100 gm orally) of glucose. [NIH] Glutamic Acid: A non-essential amino acid naturally occurring in the L-form. Glutamic acid (glutamate) is the most common excitatory neurotransmitter in the central nervous system. [NIH]

Glycine: A non-essential amino acid. It is found primarily in gelatin and silk fibroin and used therapeutically as a nutrient. It is also a fast inhibitory neurotransmitter. [NIH] Gonad: A sex organ, such as an ovary or a testicle, which produces the gametes in most multicellular animals. [NIH] Gonadal: Pertaining to a gonad. [EU] Gonadotropic: Stimulating the gonads; applied to hormones of the anterior pituitary which influence the gonads. [EU]

Dictionary 103

Gonadotropin: The water-soluble follicle stimulating substance, by some believed to originate in chorionic tissue, obtained from the serum of pregnant mares. It is used to supplement the action of estrogens. [NIH] Governing Board: The group in which legal authority is vested for the control of healthrelated institutions and organizations. [NIH] Grafting: The operation of transfer of tissue from one site to another. [NIH] Granulosa Cells: Cells of the membrana granulosa lining the vesicular ovarian follicle which become luteal cells after ovulation. [NIH] Habituation: Decline in response of an organism to environmental or other stimuli with repeated or maintained exposure. [NIH] Haplotypes: The genetic constitution of individuals with respect to one member of a pair of allelic genes, or sets of genes that are closely linked and tend to be inherited together such as those of the major histocompatibility complex. [NIH] Headache: Pain in the cranial region that may occur as an isolated and benign symptom or as a manifestation of a wide variety of conditions including subarachnoid hemorrhage; craniocerebral trauma; central nervous system infections; intracranial hypertension; and other disorders. In general, recurrent headaches that are not associated with a primary disease process are referred to as headache disorders (e.g., migraine). [NIH] Heart attack: A seizure of weak or abnormal functioning of the heart. [NIH] Hepatic: Refers to the liver. [NIH] Hereditary: Of, relating to, or denoting factors that can be transmitted genetically from one generation to another. [NIH] Heredity: 1. The genetic transmission of a particular quality or trait from parent to offspring. 2. The genetic constitution of an individual. [EU] Hippocampus: A curved elevation of gray matter extending the entire length of the floor of the temporal horn of the lateral ventricle (Dorland, 28th ed). The hippocampus, subiculum, and dentate gyrus constitute the hippocampal formation. Sometimes authors include the entorhinal cortex in the hippocampal formation. [NIH] Hirsutism: Excess hair in females and children with an adult male pattern of distribution. The concept does not include hypertrichosis, which is localized or generalized excess hair. [NIH]

Homeostasis: The processes whereby the internal environment of an organism tends to remain balanced and stable. [NIH] Homologous: Corresponding in structure, position, origin, etc., as (a) the feathers of a bird and the scales of a fish, (b) antigen and its specific antibody, (c) allelic chromosomes. [EU] Hormonal: Pertaining to or of the nature of a hormone. [EU] Hormone: A substance in the body that regulates certain organs. Hormones such as gastrin help in breaking down food. Some hormones come from cells in the stomach and small intestine. [NIH] Hospital Records: Compilations of data on hospital activities and programs; excludes patient medical records. [NIH] Hybrid: Cross fertilization between two varieties or, more usually, two species of vines, see also crossing. [NIH] Hybridization: The genetic process of crossbreeding to produce a hybrid. Hybrid nucleic acids can be formed by nucleic acid hybridization of DNA and RNA molecules. Protein hybridization allows for hybrid proteins to be formed from polypeptide chains. [NIH]

104

Anovulation

Hydrogen: The first chemical element in the periodic table. It has the atomic symbol H, atomic number 1, and atomic weight 1. It exists, under normal conditions, as a colorless, odorless, tasteless, diatomic gas. Hydrogen ions are protons. Besides the common H1 isotope, hydrogen exists as the stable isotope deuterium and the unstable, radioactive isotope tritium. [NIH] Hyperandrogenism: A state characterized or caused by an excessive secretion of androgens by the adrenal cortex, ovaries, or testes. The clinical significance in males is negligible, so the term is used most commonly with reference to the female. The common manifestations in women are hirsutism and virilism. It is often caused by ovarian disease (particularly the polycystic ovary syndrome) and by adrenal diseases (particularly adrenal gland hyperfunction). [NIH] Hypercholesterolemia: Abnormally high levels of cholesterol in the blood. [NIH] Hyperlipidemia: An excess of lipids in the blood. [NIH] Hyperplasia: An increase in the number of cells in a tissue or organ, not due to tumor formation. It differs from hypertrophy, which is an increase in bulk without an increase in the number of cells. [NIH] Hypersecretion: Excessive secretion. [EU] Hypersensitivity: Altered reactivity to an antigen, which can result in pathologic reactions upon subsequent exposure to that particular antigen. [NIH] Hyperstimulation: Excessive stimulation. [EU] Hypertension: Persistently high arterial blood pressure. Currently accepted threshold levels are 140 mm Hg systolic and 90 mm Hg diastolic pressure. [NIH] Hypertrichosis: Localized or generalized excess hair. The concept does not include hirsutism, which is excess hair in females and children with an adult male pattern of distribution. [NIH] Hypertriglyceridemia: Condition of elevated triglyceride concentration in the blood; an inherited form occurs in familial hyperlipoproteinemia IIb and hyperlipoproteinemia type IV. It has been linked to higher risk of heart disease and arteriosclerosis. [NIH] Hypertrophy: General increase in bulk of a part or organ, not due to tumor formation, nor to an increase in the number of cells. [NIH] Hypothalamic: Of or involving the hypothalamus. [EU] Hypothalamus: Ventral part of the diencephalon extending from the region of the optic chiasm to the caudal border of the mammillary bodies and forming the inferior and lateral walls of the third ventricle. [NIH] Idiopathic: Describes a disease of unknown cause. [NIH] Immune response: The activity of the immune system against foreign substances (antigens). [NIH]

Immunization: Deliberate stimulation of the host's immune response. Active immunization involves administration of antigens or immunologic adjuvants. Passive immunization involves administration of immune sera or lymphocytes or their extracts (e.g., transfer factor, immune RNA) or transplantation of immunocompetent cell producing tissue (thymus or bone marrow). [NIH] Immunologic: The ability of the antibody-forming system to recall a previous experience with an antigen and to respond to a second exposure with the prompt production of large amounts of antibody. [NIH] Impairment: In the context of health experience, an impairment is any loss or abnormality of

Dictionary 105

psychological, physiological, or anatomical structure or function. [NIH] Implantation: The insertion or grafting into the body of biological, living, inert, or radioactive material. [EU] In situ: In the natural or normal place; confined to the site of origin without invasion of neighbouring tissues. [EU] In Situ Hybridization: A technique that localizes specific nucleic acid sequences within intact chromosomes, eukaryotic cells, or bacterial cells through the use of specific nucleic acid-labeled probes. [NIH] In vitro: In the laboratory (outside the body). The opposite of in vivo (in the body). [NIH] In vivo: In the body. The opposite of in vitro (outside the body or in the laboratory). [NIH] Incision: A cut made in the body during surgery. [NIH] Induction: The act or process of inducing or causing to occur, especially the production of a specific morphogenetic effect in the developing embryo through the influence of evocators or organizers, or the production of anaesthesia or unconsciousness by use of appropriate agents. [EU] Infection: 1. Invasion and multiplication of microorganisms in body tissues, which may be clinically unapparent or result in local cellular injury due to competitive metabolism, toxins, intracellular replication, or antigen-antibody response. The infection may remain localized, subclinical, and temporary if the body's defensive mechanisms are effective. A local infection may persist and spread by extension to become an acute, subacute, or chronic clinical infection or disease state. A local infection may also become systemic when the microorganisms gain access to the lymphatic or vascular system. 2. An infectious disease. [EU]

Infertility: The diminished or absent ability to conceive or produce an offspring while sterility is the complete inability to conceive or produce an offspring. [NIH] Inflammation: A pathological process characterized by injury or destruction of tissues caused by a variety of cytologic and chemical reactions. It is usually manifested by typical signs of pain, heat, redness, swelling, and loss of function. [NIH] Infusion: A method of putting fluids, including drugs, into the bloodstream. Also called intravenous infusion. [NIH] Ingestion: Taking into the body by mouth [NIH] Inhibin: Glyceroprotein hormone produced in the seminiferous tubules by the Sertoli cells in the male and by the granulosa cells in the female follicles. The hormone inhibits FSH and LH synthesis and secretion by the pituitary cells thereby affecting sexual maturation and fertility. [NIH] Initiation: Mutation induced by a chemical reactive substance causing cell changes; being a step in a carcinogenic process. [NIH] Inorganic: Pertaining to substances not of organic origin. [EU] Inositol: An isomer of glucose that has traditionally been considered to be a B vitamin although it has an uncertain status as a vitamin and a deficiency syndrome has not been identified in man. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1379) Inositol phospholipids are important in signal transduction. [NIH] Inotropic: Affecting the force or energy of muscular contractions. [EU] Insecticides: Pesticides designed to control insects that are harmful to man. The insects may be directly harmful, as those acting as disease vectors, or indirectly harmful, as destroyers of crops, food products, or textile fabrics. [NIH]

106

Anovulation

Insight: The capacity to understand one's own motives, to be aware of one's own psychodynamics, to appreciate the meaning of symbolic behavior. [NIH] Insomnia: Difficulty in going to sleep or getting enough sleep. [NIH] Insulin: A protein hormone secreted by beta cells of the pancreas. Insulin plays a major role in the regulation of glucose metabolism, generally promoting the cellular utilization of glucose. It is also an important regulator of protein and lipid metabolism. Insulin is used as a drug to control insulin-dependent diabetes mellitus. [NIH] Insulin-dependent diabetes mellitus: A disease characterized by high levels of blood glucose resulting from defects in insulin secretion, insulin action, or both. Autoimmune, genetic, and environmental factors are involved in the development of type I diabetes. [NIH] Insulin-like: Muscular growth factor. [NIH] Internal Capsule: White matter pathway, flanked by nuclear masses, consisting of both afferent and efferent fibers projecting between the cerebral cortex and the brainstem. It consists of three distinct parts: an anterior limb, posterior limb, and genu. [NIH] Internal Medicine: A medical specialty concerned with the diagnosis and treatment of diseases of the internal organ systems of adults. [NIH] Interstitial: Pertaining to or situated between parts or in the interspaces of a tissue. [EU] Intestinal: Having to do with the intestines. [NIH] Intestines: The section of the alimentary canal from the stomach to the anus. It includes the large intestine and small intestine. [NIH] Intoxication: Poisoning, the state of being poisoned. [EU] Intracellular: Inside a cell. [NIH] Intramuscular: IM. Within or into muscle. [NIH] Intravascular: Within a vessel or vessels. [EU] Intravenous: IV. Into a vein. [NIH] Intrinsic: Situated entirely within or pertaining exclusively to a part. [EU] Invasive: 1. Having the quality of invasiveness. 2. Involving puncture or incision of the skin or insertion of an instrument or foreign material into the body; said of diagnostic techniques. [EU]

Ionizing: Radiation comprising charged particles, e. g. electrons, protons, alpha-particles, etc., having sufficient kinetic energy to produce ionization by collision. [NIH] Ions: An atom or group of atoms that have a positive or negative electric charge due to a gain (negative charge) or loss (positive charge) of one or more electrons. Atoms with a positive charge are known as cations; those with a negative charge are anions. [NIH] Kb: A measure of the length of DNA fragments, 1 Kb = 1000 base pairs. The largest DNA fragments are up to 50 kilobases long. [NIH] Lactation: The period of the secretion of milk. [EU] Laparoscopy: Examination, therapy or surgery of the abdomen's interior by means of a laparoscope. [NIH] Leptin: A 16-kD peptide hormone secreted from white adipocytes and implicated in the regulation of food intake and energy balance. Leptin provides the key afferent signal from fat cells in the feedback system that controls body fat stores. [NIH] Lesion: An area of abnormal tissue change. [NIH] Leucine: An essential branched-chain amino acid important for hemoglobin formation. [NIH]

Dictionary 107

Libido: The psychic drive or energy associated with sexual instinct in the broad sense (pleasure and love-object seeking). It may also connote the psychic energy associated with instincts in general that motivate behavior. [NIH] Ligaments: Shiny, flexible bands of fibrous tissue connecting together articular extremities of bones. They are pliant, tough, and inextensile. [NIH] Linkage: The tendency of two or more genes in the same chromosome to remain together from one generation to the next more frequently than expected according to the law of independent assortment. [NIH] Linkage Disequilibrium: Nonrandom association of linked genes. This is the tendency of the alleles of two separate but already linked loci to be found together more frequently than would be expected by chance alone. [NIH] Lipid: Fat. [NIH] Lipoprotein: Any of the lipid-protein complexes in which lipids are transported in the blood; lipoprotein particles consist of a spherical hydrophobic core of triglycerides or cholesterol esters surrounded by an amphipathic monolayer of phospholipids, cholesterol, and apolipoproteins; the four principal classes are high-density, low-density, and very-lowdensity lipoproteins and chylomicrons. [EU] Liver: A large, glandular organ located in the upper abdomen. The liver cleanses the blood and aids in digestion by secreting bile. [NIH] Localization: The process of determining or marking the location or site of a lesion or disease. May also refer to the process of keeping a lesion or disease in a specific location or site. [NIH] Localized: Cancer which has not metastasized yet. [NIH] Locus Coeruleus: Bluish region in the superior angle of the fourth ventricle floor, corresponding to melanin-like pigmented nerve cells which lie lateral to the pontomesencephalic central gray (griseum centrale). It is also known as nucleus pigmentosus pontis. [NIH] Loop: A wire usually of platinum bent at one end into a small loop (usually 4 mm inside diameter) and used in transferring microorganisms. [NIH] Low-density lipoprotein: Lipoprotein that contains most of the cholesterol in the blood. LDL carries cholesterol to the tissues of the body, including the arteries. A high level of LDL increases the risk of heart disease. LDL typically contains 60 to 70 percent of the total serum cholesterol and both are directly correlated with CHD risk. [NIH] Luciferase: Any one of several enzymes that catalyze the bioluminescent reaction in certain marine crustaceans, fish, bacteria, and insects. The enzyme is a flavoprotein; it oxidizes luciferins to an electronically excited compound that emits energy in the form of light. The color of light emitted varies with the organism. The firefly enzyme is a valuable reagent for measurement of ATP concentration. (Dorland, 27th ed) EC 1.13.12.-. [NIH] Lupus: A form of cutaneous tuberculosis. It is seen predominantly in women and typically involves the nasal, buccal, and conjunctival mucosa. [NIH] Luteal Phase: The period of the menstrual cycle that begins with ovulation and ends with menstruation. [NIH] Lutein Cells: The cells of the corpus luteum which are derived from the granulosa cells and the theca cells of the Graafian follicle. [NIH] Lymph: The almost colorless fluid that travels through the lymphatic system and carries cells that help fight infection and disease. [NIH]

108

Anovulation

Lymph node: A rounded mass of lymphatic tissue that is surrounded by a capsule of connective tissue. Also known as a lymph gland. Lymph nodes are spread out along lymphatic vessels and contain many lymphocytes, which filter the lymphatic fluid (lymph). [NIH]

Lymphocytes: White blood cells formed in the body's lymphoid tissue. The nucleus is round or ovoid with coarse, irregularly clumped chromatin while the cytoplasm is typically pale blue with azurophilic (if any) granules. Most lymphocytes can be classified as either T or B (with subpopulations of each); those with characteristics of neither major class are called null cells. [NIH] Major Histocompatibility Complex: The genetic region which contains the loci of genes which determine the structure of the serologically defined (SD) and lymphocyte-defined (LD) transplantation antigens, genes which control the structure of the immune responseassociated (Ia) antigens, the immune response (Ir) genes which control the ability of an animal to respond immunologically to antigenic stimuli, and genes which determine the structure and/or level of the first four components of complement. [NIH] Malnutrition: A condition caused by not eating enough food or not eating a balanced diet. [NIH]

Mammary: Pertaining to the mamma, or breast. [EU] Mammogram: An x-ray of the breast. [NIH] Manifest: Being the part or aspect of a phenomenon that is directly observable : concretely expressed in behaviour. [EU] Mediate: Indirect; accomplished by the aid of an intervening medium. [EU] Mediator: An object or substance by which something is mediated, such as (1) a structure of the nervous system that transmits impulses eliciting a specific response; (2) a chemical substance (transmitter substance) that induces activity in an excitable tissue, such as nerve or muscle; or (3) a substance released from cells as the result of the interaction of antigen with antibody or by the action of antigen with a sensitized lymphocyte. [EU] Medical Records: Recording of pertinent information concerning patient's illness or illnesses. [NIH] MEDLINE: An online database of MEDLARS, the computerized bibliographic Medical Literature Analysis and Retrieval System of the National Library of Medicine. [NIH] Medullary: Pertaining to the marrow or to any medulla; resembling marrow. [EU] Meiosis: A special method of cell division, occurring in maturation of the germ cells, by means of which each daughter nucleus receives half the number of chromosomes characteristic of the somatic cells of the species. [NIH] Melanin: The substance that gives the skin its color. [NIH] Membrane: A very thin layer of tissue that covers a surface. [NIH] Membrane Glycoproteins: Glycoproteins found on the membrane or surface of cells. [NIH] Memory: Complex mental function having four distinct phases: (1) memorizing or learning, (2) retention, (3) recall, and (4) recognition. Clinically, it is usually subdivided into immediate, recent, and remote memory. [NIH] Menarche: The establishment or beginning of the menstrual function. [EU] Menopause: Permanent cessation of menstruation. [NIH] Menotropins: Extracts from human menopausal urine containing FSH and LH activity. They are used to treat infertility disorders. [NIH] Menstrual Cycle: The period of the regularly recurring physiologic changes in the

Dictionary 109

endometrium occurring during the reproductive period in human females and some primates and culminating in partial sloughing of the endometrium (menstruation). [NIH] Menstruation: The normal physiologic discharge through the vagina of blood and mucosal tissues from the nonpregnant uterus. [NIH] Mental: Pertaining to the mind; psychic. 2. (L. mentum chin) pertaining to the chin. [EU] Mental Disorders: Psychiatric illness or diseases manifested by breakdowns in the adaptational process expressed primarily as abnormalities of thought, feeling, and behavior producing either distress or impairment of function. [NIH] Mental Health: The state wherein the person is well adjusted. [NIH] Mesencephalic: Ipsilateral oculomotor paralysis and contralateral tremor, spasm. or choreic movements of the face and limbs. [NIH] Metabolic disorder: A condition in which normal metabolic processes are disrupted, usually because of a missing enzyme. [NIH] Metabolite: Any substance produced by metabolism or by a metabolic process. [EU] Microcalcifications: Tiny deposits of calcium in the breast that cannot be felt but can be detected on a mammogram. A cluster of these very small specks of calcium may indicate that cancer is present. [NIH] Microorganism: An organism that can be seen only through a microscope. Microorganisms include bacteria, protozoa, algae, and fungi. Although viruses are not considered living organisms, they are sometimes classified as microorganisms. [NIH] Mitotic: Cell resulting from mitosis. [NIH] Modulator: A specific inductor that brings out characteristics peculiar to a definite region. [EU]

Molecular: Of, pertaining to, or composed of molecules : a very small mass of matter. [EU] Molecule: A chemical made up of two or more atoms. The atoms in a molecule can be the same (an oxygen molecule has two oxygen atoms) or different (a water molecule has two hydrogen atoms and one oxygen atom). Biological molecules, such as proteins and DNA, can be made up of many thousands of atoms. [NIH] Monitor: An apparatus which automatically records such physiological signs as respiration, pulse, and blood pressure in an anesthetized patient or one undergoing surgical or other procedures. [NIH] Morphological: Relating to the configuration or the structure of live organs. [NIH] Morphology: The science of the form and structure of organisms (plants, animals, and other forms of life). [NIH] Morula: The early embryo at the developmental stage in which the blastomeres, resulting from repeated mitotic divisions of the fertilized ovum, form a compact mass. [NIH] Motility: The ability to move spontaneously. [EU] Mucosa: A mucous membrane, or tunica mucosa. [EU] Mucus: The viscous secretion of mucous membranes. It contains mucin, white blood cells, water, inorganic salts, and exfoliated cells. [NIH] Naloxone: A specific opiate antagonist that has no agonist activity. It is a competitive antagonist at mu, delta, and kappa opioid receptors. [NIH] Nausea: An unpleasant sensation in the stomach usually accompanied by the urge to vomit. Common causes are early pregnancy, sea and motion sickness, emotional stress, intense pain, food poisoning, and various enteroviruses. [NIH]

110

Anovulation

Neoplasia: Abnormal and uncontrolled cell growth. [NIH] Neostriatum: The phylogenetically newer part of the corpus striatum consisting of the caudate nucleus and putamen. It is often called simply the striatum. [NIH] Nerve Growth Factor: Nerve growth factor is the first of a series of neurotrophic factors that were found to influence the growth and differentiation of sympathetic and sensory neurons. It is comprised of alpha, beta, and gamma subunits. The beta subunit is responsible for its growth stimulating activity. [NIH] Nervous System: The entire nerve apparatus composed of the brain, spinal cord, nerves and ganglia. [NIH] Neural: 1. Pertaining to a nerve or to the nerves. 2. Situated in the region of the spinal axis, as the neutral arch. [EU] Neuroendocrine: Having to do with the interactions between the nervous system and the endocrine system. Describes certain cells that release hormones into the blood in response to stimulation of the nervous system. [NIH] Neuromuscular: Pertaining to muscles and nerves. [EU] Neuromuscular Junction: The synapse between a neuron and a muscle. [NIH] Neuronal: Pertaining to a neuron or neurons (= conducting cells of the nervous system). [EU] Neurons: The basic cellular units of nervous tissue. Each neuron consists of a body, an axon, and dendrites. Their purpose is to receive, conduct, and transmit impulses in the nervous system. [NIH] Neuropeptide: A member of a class of protein-like molecules made in the brain. Neuropeptides consist of short chains of amino acids, with some functioning as neurotransmitters and some functioning as hormones. [NIH] Neurotransmitter: Any of a group of substances that are released on excitation from the axon terminal of a presynaptic neuron of the central or peripheral nervous system and travel across the synaptic cleft to either excite or inhibit the target cell. Among the many substances that have the properties of a neurotransmitter are acetylcholine, norepinephrine, epinephrine, dopamine, glycine, y-aminobutyrate, glutamic acid, substance P, enkephalins, endorphins, and serotonin. [EU] Nitrogen: An element with the atomic symbol N, atomic number 7, and atomic weight 14. Nitrogen exists as a diatomic gas and makes up about 78% of the earth's atmosphere by volume. It is a constituent of proteins and nucleic acids and found in all living cells. [NIH] Norepinephrine: Precursor of epinephrine that is secreted by the adrenal medulla and is a widespread central and autonomic neurotransmitter. Norepinephrine is the principal transmitter of most postganglionic sympathetic fibers and of the diffuse projection system in the brain arising from the locus ceruleus. It is also found in plants and is used pharmacologically as a sympathomimetic. [NIH] Nuclear: A test of the structure, blood flow, and function of the kidneys. The doctor injects a mildly radioactive solution into an arm vein and uses x-rays to monitor its progress through the kidneys. [NIH] Nucleic acid: Either of two types of macromolecule (DNA or RNA) formed by polymerization of nucleotides. Nucleic acids are found in all living cells and contain the information (genetic code) for the transfer of genetic information from one generation to the next. [NIH] Nucleic Acid Hybridization: The process whereby two single-stranded polynucleotides form a double-stranded molecule, with hydrogen bonding between the complementary

Dictionary 111

bases in the two strains. [NIH] Nucleus: A body of specialized protoplasm found in nearly all cells and containing the chromosomes. [NIH] Occupational Exposure: The exposure to potentially harmful chemical, physical, or biological agents that occurs as a result of one's occupation. [NIH] Oestrogen: A generic term for oestrus-producing steroid compounds; the female sex hormones. In humans, oestrogen is formed in the ovary, possibly the adrenal cortex, the testis, and the foetoplacental unit; it has various functions in both sexes. It is responsible for the development of the female secondary sex characteristics, and during the menstrual cycle it acts on the female genitalia to produce an environment suitable for the fertilization, implantation, and nutrition of the early embryo. Oestrogen is used in oral contraceptives and as a palliative in cancer of the breast after menopause and cancer of the prostate; other uses include the relief of the discomforts of menopause, inhibition of lactation, and treatment of osteoporosis, threatened abortion, and various functional ovarian disorders. [EU]

Oligomenorrhea: Abnormally infrequent menstruation. [NIH] Oocytes: Female germ cells in stages between the prophase of the first maturation division and the completion of the second maturation division. [NIH] Opiate: A remedy containing or derived from opium; also any drug that induces sleep. [EU] Opioid Peptides: The endogenous peptides with opiate-like activity. The three major classes currently recognized are the enkephalins, the dynorphins, and the endorphins. Each of these families derives from different precursors, proenkephalin, prodynorphin, and proopiomelanocortin, respectively. There are also at least three classes of opioid receptors, but the peptide families do not map to the receptors in a simple way. [NIH] Optic Chiasm: The X-shaped structure formed by the meeting of the two optic nerves. At the optic chiasm the fibers from the medial part of each retina cross to project to the other side of the brain while the lateral retinal fibers continue on the same side. As a result each half of the brain receives information about the contralateral visual field from both eyes. [NIH]

Osteoporosis: Reduction of bone mass without alteration in the composition of bone, leading to fractures. Primary osteoporosis can be of two major types: postmenopausal osteoporosis and age-related (or senile) osteoporosis. [NIH] Ovarian Follicle: Spheroidal cell aggregation in the ovary containing an ovum. It consists of an external fibro-vascular coat, an internal coat of nucleated cells, and a transparent, albuminous fluid in which the ovum is suspended. [NIH] Ovarian Hyperstimulation Syndrome: Syndrome composed of a combination of ovarian enlargement and an acute fluid shift out of the intravascular space. The enlargement is caused by ovarian cyst formation and the fluid shift may result in ascites, hydrothorax, or generalized edema. The syndrome is most usually seen as a complication of ovulation induction, a treatment for infertility. [NIH] Ovaries: The pair of female reproductive glands in which the ova, or eggs, are formed. The ovaries are located in the pelvis, one on each side of the uterus. [NIH] Ovary: Either of the paired glands in the female that produce the female germ cells and secrete some of the female sex hormones. [NIH] Ovulation: The discharge of a secondary oocyte from a ruptured graafian follicle. [NIH] Ovulation Induction: Techniques for the artifical induction of ovulation. [NIH] Ovum: A female germ cell extruded from the ovary at ovulation. [NIH]

112

Anovulation

Palliative: 1. Affording relief, but not cure. 2. An alleviating medicine. [EU] Pancreas: A mixed exocrine and endocrine gland situated transversely across the posterior abdominal wall in the epigastric and hypochondriac regions. The endocrine portion is comprised of the Islets of Langerhans, while the exocrine portion is a compound acinar gland that secretes digestive enzymes. [NIH] Pancreatic: Having to do with the pancreas. [NIH] Parenteral: Not through the alimentary canal but rather by injection through some other route, as subcutaneous, intramuscular, intraorbital, intracapsular, intraspinal, intrasternal, intravenous, etc. [EU] Parturition: The act or process of given birth to a child. [EU] Pathologic: 1. Indicative of or caused by a morbid condition. 2. Pertaining to pathology (= branch of medicine that treats the essential nature of the disease, especially the structural and functional changes in tissues and organs of the body caused by the disease). [EU] Pathophysiology: Altered functions in an individual or an organ due to disease. [NIH] Pelvic: Pertaining to the pelvis. [EU] Pelvis: The lower part of the abdomen, located between the hip bones. [NIH] Pepsin: An enzyme made in the stomach that breaks down proteins. [NIH] Peptide: Any compound consisting of two or more amino acids, the building blocks of proteins. Peptides are combined to make proteins. [NIH] Perfusion: Bathing an organ or tissue with a fluid. In regional perfusion, a specific area of the body (usually an arm or a leg) receives high doses of anticancer drugs through a blood vessel. Such a procedure is performed to treat cancer that has not spread. [NIH] Pericardium: The fibroserous sac surrounding the heart and the roots of the great vessels. [NIH]

Perimenopausal: The time of a woman's life when menstrual periods become irregular. Refers to the time near menopause. [NIH] Peripheral Nervous System: The nervous system outside of the brain and spinal cord. The peripheral nervous system has autonomic and somatic divisions. The autonomic nervous system includes the enteric, parasympathetic, and sympathetic subdivisions. The somatic nervous system includes the cranial and spinal nerves and their ganglia and the peripheral sensory receptors. [NIH] Peritoneal: Having to do with the peritoneum (the tissue that lines the abdominal wall and covers most of the organs in the abdomen). [NIH] Peritoneum: Endothelial lining of the abdominal cavity, the parietal peritoneum covering the inside of the abdominal wall and the visceral peritoneum covering the bowel, the mesentery, and certain of the organs. The portion that covers the bowel becomes the serosal layer of the bowel wall. [NIH] Pesticides: Chemicals used to destroy pests of any sort. The concept includes fungicides (industrial fungicides), insecticides, rodenticides, etc. [NIH] Pharmacologic: Pertaining to pharmacology or to the properties and reactions of drugs. [EU] Phenotype: The outward appearance of the individual. It is the product of interactions between genes and between the genotype and the environment. This includes the killer phenotype, characteristic of yeasts. [NIH] Phenylalanine: An aromatic amino acid that is essential in the animal diet. It is a precursor of melanin, dopamine, noradrenalin, and thyroxine. [NIH]

Dictionary 113

Phospholipids: Lipids containing one or more phosphate groups, particularly those derived from either glycerol (phosphoglycerides; glycerophospholipids) or sphingosine (sphingolipids). They are polar lipids that are of great importance for the structure and function of cell membranes and are the most abundant of membrane lipids, although not stored in large amounts in the system. [NIH] Phosphorylation: The introduction of a phosphoryl group into a compound through the formation of an ester bond between the compound and a phosphorus moiety. [NIH] Physical Examination: Systematic and thorough inspection of the patient for physical signs of disease or abnormality. [NIH] Physiologic: Having to do with the functions of the body. When used in the phrase "physiologic age," it refers to an age assigned by general health, as opposed to calendar age. [NIH]

Physiology: The science that deals with the life processes and functions of organismus, their cells, tissues, and organs. [NIH] Placenta: A highly vascular fetal organ through which the fetus absorbs oxygen and other nutrients and excretes carbon dioxide and other wastes. It begins to form about the eighth day of gestation when the blastocyst adheres to the decidua. [NIH] Plants: Multicellular, eukaryotic life forms of the kingdom Plantae. They are characterized by a mainly photosynthetic mode of nutrition; essentially unlimited growth at localized regions of cell divisions (meristems); cellulose within cells providing rigidity; the absence of organs of locomotion; absense of nervous and sensory systems; and an alteration of haploid and diploid generations. [NIH] Plasma: The clear, yellowish, fluid part of the blood that carries the blood cells. The proteins that form blood clots are in plasma. [NIH] Plasma protein: One of the hundreds of different proteins present in blood plasma, including carrier proteins ( such albumin, transferrin, and haptoglobin), fibrinogen and other coagulation factors, complement components, immunoglobulins, enzyme inhibitors, precursors of substances such as angiotension and bradykinin, and many other types of proteins. [EU] Plasmids: Any extrachromosomal hereditary determinant. Plasmids are self-replicating circular molecules of DNA that are found in a variety of bacterial, archaeal, fungal, algal, and plant species. [NIH] Plasticity: In an individual or a population, the capacity for adaptation: a) through gene changes (genetic plasticity) or b) through internal physiological modifications in response to changes of environment (physiological plasticity). [NIH] Pneumonia: Inflammation of the lungs. [NIH] Podophyllotoxin: The main active constituent of the resin from the roots of may apple or mandrake (Podophyllum peltatum and P. emodi). It is a potent spindle poison, toxic if taken internally, and has been used as a cathartic. It is very irritating to skin and mucous membranes, has keratolytic actions, has been used to treat warts and keratoses, and may have antineoplastic properties, as do some of its congeners and derivatives. [NIH] Polycystic: An inherited disorder characterized by many grape-like clusters of fluid-filled cysts that make both kidneys larger over time. These cysts take over and destroy working kidney tissue. PKD may cause chronic renal failure and end-stage renal disease. [NIH] Polycystic Ovary Syndrome: Clinical symptom complex characterized by oligomenorrhea or amenorrhea, anovulation, and regularly associated with bilateral polycystic ovaries. [NIH] Polymerase: An enzyme which catalyses the synthesis of DNA using a single DNA strand

114

Anovulation

as a template. The polymerase copies the template in the 5'-3'direction provided that sufficient quantities of free nucleotides, dATP and dTTP are present. [NIH] Polymerase Chain Reaction: In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships. [NIH] Polypeptide: A peptide which on hydrolysis yields more than two amino acids; called tripeptides, tetrapeptides, etc. according to the number of amino acids contained. [EU] Polysaccharide: A type of carbohydrate. It contains sugar molecules that are linked together chemically. [NIH] Posterior: Situated in back of, or in the back part of, or affecting the back or dorsal surface of the body. In lower animals, it refers to the caudal end of the body. [EU] Postmenopausal: Refers to the time after menopause. Menopause is the time in a woman's life when menstrual periods stop permanently; also called "change of life." [NIH] Postnatal: Occurring after birth, with reference to the newborn. [EU] Potassium: An element that is in the alkali group of metals. It has an atomic symbol K, atomic number 19, and atomic weight 39.10. It is the chief cation in the intracellular fluid of muscle and other cells. Potassium ion is a strong electrolyte and it plays a significant role in the regulation of fluid volume and maintenance of the water-electrolyte balance. [NIH] Potassium Channels: Cell membrane glycoproteins selective for potassium ions. [NIH] Practice Guidelines: Directions or principles presenting current or future rules of policy for the health care practitioner to assist him in patient care decisions regarding diagnosis, therapy, or related clinical circumstances. The guidelines may be developed by government agencies at any level, institutions, professional societies, governing boards, or by the convening of expert panels. The guidelines form a basis for the evaluation of all aspects of health care and delivery. [NIH] Precipitating Factors: Factors associated with the definitive onset of a disease, illness, accident, behavioral response, or course of action. Usually one factor is more important or more obviously recognizable than others, if several are involved, and one may often be regarded as "necessary". Examples include exposure to specific disease; amount or level of an infectious organism, drug, or noxious agent, etc. [NIH] Precursor: Something that precedes. In biological processes, a substance from which another, usually more active or mature substance is formed. In clinical medicine, a sign or symptom that heralds another. [EU] Prednisolone: A glucocorticoid with the general properties of the corticosteroids. It is the drug of choice for all conditions in which routine systemic corticosteroid therapy is indicated, except adrenal deficiency states. [NIH] Prednisone: A synthetic anti-inflammatory glucocorticoid derived from cortisone. It is biologically inert and converted to prednisolone in the liver. [NIH] Pregnancy Outcome: Results of conception and ensuing pregnancy, including live birth, stillbirth, spontaneous abortion, induced abortion. The outcome may follow natural or artificial insemination or any of the various reproduction techniques, such as embryo transfer or fertilization in vitro. [NIH]

Dictionary 115

Pregnancy Tests: Tests to determine whether or not an individual is pregnant. [NIH] Premenopausal: Refers to the time before menopause. Menopause is the time of life when a women's menstrual periods stop permanently; also called "change of life." [NIH] Premenstrual Syndrome: A syndrome occurring most often during the last week of the menstrual cycle and ending soon after the onset of menses. Some of the symptoms are emotional instability, insomnia, headache, nausea, vomiting, abdominal distension, and painful breasts. [NIH] Prenatal: Existing or occurring before birth, with reference to the fetus. [EU] Presynaptic: Situated proximal to a synapse, or occurring before the synapse is crossed. [EU] Prevalence: The total number of cases of a given disease in a specified population at a designated time. It is differentiated from incidence, which refers to the number of new cases in the population at a given time. [NIH] Probe: An instrument used in exploring cavities, or in the detection and dilatation of strictures, or in demonstrating the potency of channels; an elongated instrument for exploring or sounding body cavities. [NIH] Progesterone: Pregn-4-ene-3,20-dione. The principal progestational hormone of the body, secreted by the corpus luteum, adrenal cortex, and placenta. Its chief function is to prepare the uterus for the reception and development of the fertilized ovum. It acts as an antiovulatory agent when administered on days 5-25 of the menstrual cycle. [NIH] Prognostic factor: A situation or condition, or a characteristic of a patient, that can be used to estimate the chance of recovery from a disease, or the chance of the disease recurring (coming back). [NIH] Progression: Increase in the size of a tumor or spread of cancer in the body. [NIH] Progressive: Advancing; going forward; going from bad to worse; increasing in scope or severity. [EU] Projection: A defense mechanism, operating unconsciously, whereby that which is emotionally unacceptable in the self is rejected and attributed (projected) to others. [NIH] Prolactin: Pituitary lactogenic hormone. A polypeptide hormone with a molecular weight of about 23,000. It is essential in the induction of lactation in mammals at parturition and is synergistic with estrogen. The hormone also brings about the release of progesterone from lutein cells, which renders the uterine mucosa suited for the embedding of the ovum should fertilization occur. [NIH] Prone: Having the front portion of the body downwards. [NIH] Pro-Opiomelanocortin: A precursor protein, MW 30,000, synthesized mainly in the anterior pituitary gland but also found in the hypothalamus, brain, and several peripheral tissues. It incorporates the amino acid sequences of ACTH and beta-lipotropin. These two hormones, in turn, contain the biologically active peptides MSH, corticotropin-like intermediate lobe peptide, alpha-lipotropin, endorphins, and methionine enkephalin. [NIH] Prophase: The first phase of cell division, in which the chromosomes become visible, the nucleus starts to lose its identity, the spindle appears, and the centrioles migrate toward opposite poles. [NIH] Prospective Studies: Observation of a population for a sufficient number of persons over a sufficient number of years to generate incidence or mortality rates subsequent to the selection of the study group. [NIH] Prospective study: An epidemiologic study in which a group of individuals (a cohort), all free of a particular disease and varying in their exposure to a possible risk factor, is followed

116

Anovulation

over a specific amount of time to determine the incidence rates of the disease in the exposed and unexposed groups. [NIH] Prostate: A gland in males that surrounds the neck of the bladder and the urethra. It secretes a substance that liquifies coagulated semen. It is situated in the pelvic cavity behind the lower part of the pubic symphysis, above the deep layer of the triangular ligament, and rests upon the rectum. [NIH] Protease: Proteinase (= any enzyme that catalyses the splitting of interior peptide bonds in a protein). [EU] Protein Binding: The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific proteinbinding measures are often used as assays in diagnostic assessments. [NIH] Protein S: The vitamin K-dependent cofactor of activated protein C. Together with protein C, it inhibits the action of factors VIIIa and Va. A deficiency in protein S can lead to recurrent venous and arterial thrombosis. [NIH] Proteins: Polymers of amino acids linked by peptide bonds. The specific sequence of amino acids determines the shape and function of the protein. [NIH] Proximate cause: The abnormal event in a causal chain lying closest to an accidental event. [NIH]

Psychiatry: The medical science that deals with the origin, diagnosis, prevention, and treatment of mental disorders. [NIH] Psychic: Pertaining to the psyche or to the mind; mental. [EU] Psychoactive: Those drugs which alter sensation, mood, consciousness or other psychological or behavioral functions. [NIH] Psychogenic: Produced or caused by psychic or mental factors rather than organic factors. [EU]

Psychotherapy: A generic term for the treatment of mental illness or emotional disturbances primarily by verbal or nonverbal communication. [NIH] Puberty: The period during which the secondary sex characteristics begin to develop and the capability of sexual reproduction is attained. [EU] Public Health: Branch of medicine concerned with the prevention and control of disease and disability, and the promotion of physical and mental health of the population on the international, national, state, or municipal level. [NIH] Public Policy: A course or method of action selected, usually by a government, from among alternatives to guide and determine present and future decisions. [NIH] Pulmonary: Relating to the lungs. [NIH] Pulmonary Artery: The short wide vessel arising from the conus arteriosus of the right ventricle and conveying unaerated blood to the lungs. [NIH] Pulse: The rhythmical expansion and contraction of an artery produced by waves of pressure caused by the ejection of blood from the left ventricle of the heart as it contracts. [NIH]

Putamen: The largest and most lateral of the basal ganglia lying between the lateral medullary lamina of the globus pallidus and the external capsule. It is part of the neostriatum and forms part of the lentiform nucleus along with the globus pallidus. [NIH] Race: A population within a species which exhibits general similarities within itself, but is both discontinuous and distinct from other populations of that species, though not sufficiently so as to achieve the status of a taxon. [NIH]

Dictionary 117

Radiation: Emission or propagation of electromagnetic energy (waves/rays), or the waves/rays themselves; a stream of electromagnetic particles (electrons, neutrons, protons, alpha particles) or a mixture of these. The most common source is the sun. [NIH] Radiation therapy: The use of high-energy radiation from x-rays, gamma rays, neutrons, and other sources to kill cancer cells and shrink tumors. Radiation may come from a machine outside the body (external-beam radiation therapy), or it may come from radioactive material placed in the body in the area near cancer cells (internal radiation therapy, implant radiation, or brachytherapy). Systemic radiation therapy uses a radioactive substance, such as a radiolabeled monoclonal antibody, that circulates throughout the body. Also called radiotherapy. [NIH] Radioactive: Giving off radiation. [NIH] Radiography: Examination of any part of the body for diagnostic purposes by means of roentgen rays, recording the image on a sensitized surface (such as photographic film). [NIH] Radiopharmaceutical: Any medicinal product which, when ready for use, contains one or more radionuclides (radioactive isotopes) included for a medicinal purpose. [NIH] Randomized: Describes an experiment or clinical trial in which animal or human subjects are assigned by chance to separate groups that compare different treatments. [NIH] Randomized clinical trial: A study in which the participants are assigned by chance to separate groups that compare different treatments; neither the researchers nor the participants can choose which group. Using chance to assign people to groups means that the groups will be similar and that the treatments they receive can be compared objectively. At the time of the trial, it is not known which treatment is best. It is the patient's choice to be in a randomized trial. [NIH] Reagent: A substance employed to produce a chemical reaction so as to detect, measure, produce, etc., other substances. [EU] Receptor: A molecule inside or on the surface of a cell that binds to a specific substance and causes a specific physiologic effect in the cell. [NIH] Receptor, Insulin: A cell surface receptor for insulin. It is comprised of a tetramer of two alpha and two beta subunits which are derived from cleavage of a single precusor protein. The receptor contains an intrinsic tyrosine kinase domain that is located within the beta subunit. Activation of the receptor by insulin results in numerous metabolic changes including increased uptake of glucose into the liver, muscle, and adipose tissue. EC 2.7.11.-. [NIH]

Recombinant: A cell or an individual with a new combination of genes not found together in either parent; usually applied to linked genes. [EU] Refer: To send or direct for treatment, aid, information, de decision. [NIH] Refractory: Not readily yielding to treatment. [EU] Regimen: A treatment plan that specifies the dosage, the schedule, and the duration of treatment. [NIH] Reproductive History: An important aggregate factor in epidemiological studies of women's health. The concept usually includes the number and timing of pregnancies and their outcomes, the incidence of breast feeding, and may include age of menarche and menopause, regularity of menstruation, fertility, gynecological or obstetric problems, or contraceptive usage. [NIH] Respiration: The act of breathing with the lungs, consisting of inspiration, or the taking into the lungs of the ambient air, and of expiration, or the expelling of the modified air which contains more carbon dioxide than the air taken in (Blakiston's Gould Medical Dictionary,

118

Anovulation

4th ed.). This does not include tissue respiration (= oxygen consumption) or cell respiration (= cell respiration). [NIH] Retrospective: Looking back at events that have already taken place. [NIH] Retrospective Studies: Studies used to test etiologic hypotheses in which inferences about an exposure to putative causal factors are derived from data relating to characteristics of persons under study or to events or experiences in their past. The essential feature is that some of the persons under study have the disease or outcome of interest and their characteristics are compared with those of unaffected persons. [NIH] Ribonucleic acid: RNA. One of the two nucleic acids found in all cells. The other is deoxyribonucleic acid (DNA). Ribonucleic acid transfers genetic information from DNA to proteins produced by the cell. [NIH] Risk factor: A habit, trait, condition, or genetic alteration that increases a person's chance of developing a disease. [NIH] Rod: A reception for vision, located in the retina. [NIH] Rodenticides: Substances used to destroy or inhibit the action of rats, mice, or other rodents. [NIH]

Rosiglitazone: A drug taken to help reduce the amount of sugar in the blood. Rosiglitazone helps make insulin more effective and improves regulation of blood sugar. It belongs to the family of drugs called thiazolidinediones. [NIH] Saliva: The clear, viscous fluid secreted by the salivary glands and mucous glands of the mouth. It contains mucins, water, organic salts, and ptylin. [NIH] Salivary: The duct that convey saliva to the mouth. [NIH] Saponins: Sapogenin glycosides. A type of glycoside widely distributed in plants. Each consists of a sapogenin as the aglycon moiety, and a sugar. The sapogenin may be a steroid or a triterpene and the sugar may be glucose, galactose, a pentose, or a methylpentose. Sapogenins are poisonous towards the lower forms of life and are powerful hemolytics when injected into the blood stream able to dissolve red blood cells at even extreme dilutions. [NIH] Schizoid: Having qualities resembling those found in greater degree in schizophrenics; a person of schizoid personality. [NIH] Schizophrenia: A mental disorder characterized by a special type of disintegration of the personality. [NIH] Schizotypal Personality Disorder: A personality disorder in which there are oddities of thought (magical thinking, paranoid ideation, suspiciousness), perception (illusions, depersonalization), speech (digressive, vague, overelaborate), and behavior (inappropriate affect in social interactions, frequently social isolation) that are not severe enough to characterize schizophrenia. [NIH] Screening: Checking for disease when there are no symptoms. [NIH] Secretin: A hormone made in the duodenum. Causes the stomach to make pepsin, the liver to make bile, and the pancreas to make a digestive juice. [NIH] Secretion: 1. The process of elaborating a specific product as a result of the activity of a gland; this activity may range from separating a specific substance of the blood to the elaboration of a new chemical substance. 2. Any substance produced by secretion. [EU] Secretory: Secreting; relating to or influencing secretion or the secretions. [NIH] Selective estrogen receptor modulator: SERM. A drug that acts like estrogen on some tissues, but blocks the effect of estrogen on other tissues. Tamoxifen and raloxifene are

Dictionary 119

SERMs. [NIH] Semen: The thick, yellowish-white, viscid fluid secretion of male reproductive organs discharged upon ejaculation. In addition to reproductive organ secretions, it contains spermatozoa and their nutrient plasma. [NIH] Seminiferous tubule: Tube used to transport sperm made in the testes. [NIH] Semisynthetic: Produced by chemical manipulation of naturally occurring substances. [EU] Sensitization: 1. Administration of antigen to induce a primary immune response; priming; immunization. 2. Exposure to allergen that results in the development of hypersensitivity. 3. The coating of erythrocytes with antibody so that they are subject to lysis by complement in the presence of homologous antigen, the first stage of a complement fixation test. [EU] Septal: An abscess occurring at the root of the tooth on the proximal surface. [NIH] Septum: A dividing wall or partition; a general term for such a structure. The term is often used alone to refer to the septal area or to the septum pellucidum. [EU] Septum Pellucidum: A triangular double membrane separating the anterior horns of the lateral ventricles of the brain. It is situated in the median plane and bounded by the corpus callosum and the body and columns of the fornix. [NIH] Sequencing: The determination of the order of nucleotides in a DNA or RNA chain. [NIH] Serotonin: A biochemical messenger and regulator, synthesized from the essential amino acid L-tryptophan. In humans it is found primarily in the central nervous system, gastrointestinal tract, and blood platelets. Serotonin mediates several important physiological functions including neurotransmission, gastrointestinal motility, hemostasis, and cardiovascular integrity. Multiple receptor families (receptors, serotonin) explain the broad physiological actions and distribution of this biochemical mediator. [NIH] Serum: The clear liquid part of the blood that remains after blood cells and clotting proteins have been removed. [NIH] Sex Characteristics: Those characteristics that distinguish one sex from the other. The primary sex characteristics are the ovaries and testes and their related hormones. Secondary sex characteristics are those which are masculine or feminine but not directly related to reproduction. [NIH] Side effect: A consequence other than the one(s) for which an agent or measure is used, as the adverse effects produced by a drug, especially on a tissue or organ system other than the one sought to be benefited by its administration. [EU] Signal Transduction: The intercellular or intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GABA-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptormediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway. [NIH] Signs and Symptoms: Clinical manifestations that can be either objective when observed by a physician, or subjective when perceived by the patient. [NIH]

120

Anovulation

Skeletal: Having to do with the skeleton (boney part of the body). [NIH] Skeleton: The framework that supports the soft tissues of vertebrate animals and protects many of their internal organs. The skeletons of vertebrates are made of bone and/or cartilage. [NIH] Small intestine: The part of the digestive tract that is located between the stomach and the large intestine. [NIH] Somatic: 1. Pertaining to or characteristic of the soma or body. 2. Pertaining to the body wall in contrast to the viscera. [EU] Specialist: In medicine, one who concentrates on 1 special branch of medical science. [NIH] Species: A taxonomic category subordinate to a genus (or subgenus) and superior to a subspecies or variety, composed of individuals possessing common characters distinguishing them from other categories of individuals of the same taxonomic level. In taxonomic nomenclature, species are designated by the genus name followed by a Latin or Latinized adjective or noun. [EU] Specificity: Degree of selectivity shown by an antibody with respect to the number and types of antigens with which the antibody combines, as well as with respect to the rates and the extents of these reactions. [NIH] Sperm: The fecundating fluid of the male. [NIH] Spermatozoa: Mature male germ cells that develop in the seminiferous tubules of the testes. Each consists of a head, a body, and a tail that provides propulsion. The head consists mainly of chromatin. [NIH] Spinal cord: The main trunk or bundle of nerves running down the spine through holes in the spinal bone (the vertebrae) from the brain to the level of the lower back. [NIH] Spontaneous Abortion: The non-induced birth of an embryo or of fetus prior to the stage of viability at about 20 weeks of gestation. [NIH] Steel: A tough, malleable, iron-based alloy containing up to, but no more than, two percent carbon and often other metals. It is used in medicine and dentistry in implants and instrumentation. [NIH] Sterility: 1. The inability to produce offspring, i.e., the inability to conceive (female s.) or to induce conception (male s.). 2. The state of being aseptic, or free from microorganisms. [EU] Steroid: A group name for lipids that contain a hydrogenated cyclopentanoperhydrophenanthrene ring system. Some of the substances included in this group are progesterone, adrenocortical hormones, the gonadal hormones, cardiac aglycones, bile acids, sterols (such as cholesterol), toad poisons, saponins, and some of the carcinogenic hydrocarbons. [EU] Stillbirth: The birth of a dead fetus or baby. [NIH] Stimulus: That which can elicit or evoke action (response) in a muscle, nerve, gland or other excitable issue, or cause an augmenting action upon any function or metabolic process. [NIH] Stomach: An organ of digestion situated in the left upper quadrant of the abdomen between the termination of the esophagus and the beginning of the duodenum. [NIH] Strand: DNA normally exists in the bacterial nucleus in a helix, in which two strands are coiled together. [NIH] Stress: Forcibly exerted influence; pressure. Any condition or situation that causes strain or tension. Stress may be either physical or psychologic, or both. [NIH] Stroke: Sudden loss of function of part of the brain because of loss of blood flow. Stroke may be caused by a clot (thrombosis) or rupture (hemorrhage) of a blood vessel to the brain. [NIH]

Dictionary 121

Stroma: The middle, thickest layer of tissue in the cornea. [NIH] Stromal: Large, veil-like cell in the bone marrow. [NIH] Stromal Cells: Connective tissue cells of an organ found in the loose connective tissue. These are most often associated with the uterine mucosa and the ovary as well as the hematopoietic system and elsewhere. [NIH] Subclinical: Without clinical manifestations; said of the early stage(s) of an infection or other disease or abnormality before symptoms and signs become apparent or detectable by clinical examination or laboratory tests, or of a very mild form of an infection or other disease or abnormality. [EU] Subcutaneous: Beneath the skin. [NIH] Subiculum: A region of the hippocampus that projects to other areas of the brain. [NIH] Subspecies: A category intermediate in rank between species and variety, based on a smaller number of correlated characters than are used to differentiate species and generally conditioned by geographical and/or ecological occurrence. [NIH] Substance P: An eleven-amino acid neurotransmitter that appears in both the central and peripheral nervous systems. It is involved in transmission of pain, causes rapid contractions of the gastrointestinal smooth muscle, and modulates inflammatory and immune responses. [NIH]

Supplementation: Adding nutrients to the diet. [NIH] Suppression: A conscious exclusion of disapproved desire contrary with repression, in which the process of exclusion is not conscious. [NIH] Suppressive: Tending to suppress : effecting suppression; specifically : serving to suppress activity, function, symptoms. [EU] Sympathomimetic: 1. Mimicking the effects of impulses conveyed by adrenergic postganglionic fibres of the sympathetic nervous system. 2. An agent that produces effects similar to those of impulses conveyed by adrenergic postganglionic fibres of the sympathetic nervous system. Called also adrenergic. [EU] Synapse: The region where the processes of two neurons come into close contiguity, and the nervous impulse passes from one to the other; the fibers of the two are intermeshed, but, according to the general view, there is no direct contiguity. [NIH] Synapsis: The pairing between homologous chromosomes of maternal and paternal origin during the prophase of meiosis, leading to the formation of gametes. [NIH] Synaptic: Pertaining to or affecting a synapse (= site of functional apposition between neurons, at which an impulse is transmitted from one neuron to another by electrical or chemical means); pertaining to synapsis (= pairing off in point-for-point association of homologous chromosomes from the male and female pronuclei during the early prophase of meiosis). [EU] Synergistic: Acting together; enhancing the effect of another force or agent. [EU] Systemic: Affecting the entire body. [NIH] Systemic lupus erythematosus: SLE. A chronic inflammatory connective tissue disease marked by skin rashes, joint pain and swelling, inflammation of the kidneys, inflammation of the fibrous tissue surrounding the heart (i.e., the pericardium), as well as other problems. Not all affected individuals display all of these problems. May be referred to as lupus. [NIH] Systolic: Indicating the maximum arterial pressure during contraction of the left ventricle of the heart. [EU] Systolic blood pressure: The maximum pressure in the artery produced as the heart

122

Anovulation

contracts and blood begins to flow. [NIH] Tamoxifen: A first generation selective estrogen receptor modulator (SERM). It acts as an agonist for bone tissue and cholesterol metabolism but is an estrogen antagonist in mammary and uterine. [NIH] Temporal: One of the two irregular bones forming part of the lateral surfaces and base of the skull, and containing the organs of hearing. [NIH] Testicular: Pertaining to a testis. [EU] Testis: Either of the paired male reproductive glands that produce the male germ cells and the male hormones. [NIH] Testosterone: A hormone that promotes the development and maintenance of male sex characteristics. [NIH] Theca Cells: The connective tissue cells of the ovarian follicle. [NIH] Therapeutics: The branch of medicine which is concerned with the treatment of diseases, palliative or curative. [NIH] Thermal: Pertaining to or characterized by heat. [EU] Third Ventricle: A narrow cleft inferior to the corpus callosum, within the diencephalon, between the paired thalami. Its floor is formed by the hypothalamus, its anterior wall by the lamina terminalis, and its roof by ependyma. It communicates with the fourth ventricle by the cerebral aqueduct, and with the lateral ventricles by the interventricular foramina. [NIH] Threshold: For a specified sensory modality (e. g. light, sound, vibration), the lowest level (absolute threshold) or smallest difference (difference threshold, difference limen) or intensity of the stimulus discernible in prescribed conditions of stimulation. [NIH] Thyroid: A gland located near the windpipe (trachea) that produces thyroid hormone, which helps regulate growth and metabolism. [NIH] Tissue: A group or layer of cells that are alike in type and work together to perform a specific function. [NIH] Tissue Distribution: Accumulation of a drug or chemical substance in various organs (including those not relevant to its pharmacologic or therapeutic action). This distribution depends on the blood flow or perfusion rate of the organ, the ability of the drug to penetrate organ membranes, tissue specificity, protein binding. The distribution is usually expressed as tissue to plasma ratios. [NIH] Tolerance: 1. The ability to endure unusually large doses of a drug or toxin. 2. Acquired drug tolerance; a decreasing response to repeated constant doses of a drug or the need for increasing doses to maintain a constant response. [EU] Tone: 1. The normal degree of vigour and tension; in muscle, the resistance to passive elongation or stretch; tonus. 2. A particular quality of sound or of voice. 3. To make permanent, or to change, the colour of silver stain by chemical treatment, usually with a heavy metal. [EU] Tonic: 1. Producing and restoring the normal tone. 2. Characterized by continuous tension. 3. A term formerly used for a class of medicinal preparations believed to have the power of restoring normal tone to tissue. [EU] Toxic: Having to do with poison or something harmful to the body. Toxic substances usually cause unwanted side effects. [NIH] Toxicity: The quality of being poisonous, especially the degree of virulence of a toxic microbe or of a poison. [EU] Toxicology: The science concerned with the detection, chemical composition, and

Dictionary 123

pharmacologic action of toxic substances or poisons and the treatment and prevention of toxic manifestations. [NIH] Toxins: Specific, characterizable, poisonous chemicals, often proteins, with specific biological properties, including immunogenicity, produced by microbes, higher plants, or animals. [NIH] Traction: The act of pulling. [NIH] Transcriptase: An enzyme which catalyses the synthesis of a complementary mRNA molecule from a DNA template in the presence of a mixture of the four ribonucleotides (ATP, UTP, GTP and CTP). [NIH] Transfection: The uptake of naked or purified DNA into cells, usually eukaryotic. It is analogous to bacterial transformation. [NIH] Translational: The cleavage of signal sequence that directs the passage of the protein through a cell or organelle membrane. [NIH] Transmitter: A chemical substance which effects the passage of nerve impulses from one cell to the other at the synapse. [NIH] Transplantation: Transference of a tissue or organ, alive or dead, within an individual, between individuals of the same species, or between individuals of different species. [NIH] Troglitazone: A drug used in diabetes treatment that is being studied for its effect on reducing the risk of cancer cell growth in fat tissue. [NIH] Tumor marker: A substance sometimes found in an increased amount in the blood, other body fluids, or tissues and which may mean that a certain type of cancer is in the body. Examples of tumor markers include CA 125 (ovarian cancer), CA 15-3 (breast cancer), CEA (ovarian, lung, breast, pancreas, and gastrointestinal tract cancers), and PSA (prostate cancer). Also called biomarker. [NIH] Type 2 diabetes: Usually characterized by a gradual onset with minimal or no symptoms of metabolic disturbance and no requirement for exogenous insulin. The peak age of onset is 50 to 60 years. Obesity and possibly a genetic factor are usually present. [NIH] Tyrosine: A non-essential amino acid. In animals it is synthesized from phenylalanine. It is also the precursor of epinephrine, thyroid hormones, and melanin. [NIH] Ultrasonography: The visualization of deep structures of the body by recording the reflections of echoes of pulses of ultrasonic waves directed into the tissues. Use of ultrasound for imaging or diagnostic purposes employs frequencies ranging from 1.6 to 10 megahertz. [NIH] Urethra: The tube through which urine leaves the body. It empties urine from the bladder. [NIH]

Urinary: Having to do with urine or the organs of the body that produce and get rid of urine. [NIH] Urine: Fluid containing water and waste products. Urine is made by the kidneys, stored in the bladder, and leaves the body through the urethra. [NIH] Uterus: The small, hollow, pear-shaped organ in a woman's pelvis. This is the organ in which a fetus develops. Also called the womb. [NIH] Vagina: The muscular canal extending from the uterus to the exterior of the body. Also called the birth canal. [NIH] Vaginal: Of or having to do with the vagina, the birth canal. [NIH] Vascular: Pertaining to blood vessels or indicative of a copious blood supply. [EU]

124

Anovulation

Vasodilator: An agent that widens blood vessels. [NIH] Vein: Vessel-carrying blood from various parts of the body to the heart. [NIH] Ventricle: One of the two pumping chambers of the heart. The right ventricle receives oxygen-poor blood from the right atrium and pumps it to the lungs through the pulmonary artery. The left ventricle receives oxygen-rich blood from the left atrium and pumps it to the body through the aorta. [NIH] Vesicular: 1. Composed of or relating to small, saclike bodies. 2. Pertaining to or made up of vesicles on the skin. [EU] Veterinary Medicine: The medical science concerned with the prevention, diagnosis, and treatment of diseases in animals. [NIH] Virilism: Development of masculine traits in the female. [NIH] Vitamin A: A substance used in cancer prevention; it belongs to the family of drugs called retinoids. [NIH] Vitro: Descriptive of an event or enzyme reaction under experimental investigation occurring outside a living organism. Parts of an organism or microorganism are used together with artificial substrates and/or conditions. [NIH] Vivo: Outside of or removed from the body of a living organism. [NIH] White blood cell: A type of cell in the immune system that helps the body fight infection and disease. White blood cells include lymphocytes, granulocytes, macrophages, and others. [NIH]

Withdrawal: 1. A pathological retreat from interpersonal contact and social involvement, as may occur in schizophrenia, depression, or schizoid avoidant and schizotypal personality disorders. 2. (DSM III-R) A substance-specific organic brain syndrome that follows the cessation of use or reduction in intake of a psychoactive substance that had been regularly used to induce a state of intoxication. [EU] Xenograft: The cells of one species transplanted to another species. [NIH] Yeasts: A general term for single-celled rounded fungi that reproduce by budding. Brewers' and bakers' yeasts are Saccharomyces cerevisiae; therapeutic dried yeast is dried yeast. [NIH] Zygote: The fertilized ovum. [NIH]

125

INDEX A Abdominal, 27, 89, 112, 115 Abdominal fat, 27, 89 Aberrant, 20, 21, 89 Acetylcholine, 14, 89, 94, 110 Acne, 4, 12, 23, 89, 97 Adaptation, 89, 113 Adipocytes, 89, 96, 106 Adipose Tissue, 89, 117 Adjustment, 9, 89 Adolescence, 26, 89 Adrenal Cortex, 89, 91, 97, 100, 104, 111, 115 Adrenal Medulla, 89, 94, 100, 110 Adrenergic, 14, 89, 98, 100, 121 Adverse Effect, 19, 89, 119 Afferent, 89, 106 Affinity, 89, 90 Age of Onset, 90, 123 Agonist, 36, 90, 93, 95, 98, 109, 122 Algorithms, 90, 92 Alimentary, 90, 106, 112 Alkaloid, 90, 93 Alleles, 90, 107 Allergen, 90, 119 Alopecia, 4, 90 Alternative medicine, 62, 90 Amenorrhea, 5, 7, 16, 17, 19, 26, 37, 38, 40, 42, 47, 49, 56, 60, 90, 91, 93, 113 Amino Acid Sequence, 90, 92, 115 Amino Acids, 90, 92, 110, 112, 114, 116 Amniotic Fluid, 90, 102 Anaesthesia, 90, 105 Anatomical, 15, 91, 105 Androgenic, 24, 27, 44, 91 Androgens, 3, 6, 9, 14, 21, 89, 91, 104 Androstenedione, 19, 24, 91 Anestrus, 15, 91 Animal model, 7, 10, 16, 91 Annealing, 91, 114 Anorexia, 7, 91 Anorexia Nervosa, 7, 91 Antibody, 90, 91, 95, 97, 103, 104, 105, 108, 117, 119, 120 Antigen, 11, 90, 91, 95, 103, 104, 105, 108, 119 Anti-inflammatory, 91, 102, 114 Arterial, 91, 104, 116, 121

Arteries, 91, 92, 93, 96, 107 Artery, 91, 93, 116, 121 Ascites, 91, 111 Aseptic, 91, 120 Assay, 9, 17, 20, 91 B Bacteria, 91, 107, 109 Basal Ganglia, 91, 116 Base, 92, 106, 122 Behavior Therapy, 92 Behavioral Medicine, 20, 92 Beta-Endorphin, 58, 92 Bilateral, 25, 92, 113 Bile, 92, 101, 107, 118, 120 Biomarkers, 17, 92 Biopsy, 25, 92 Biosynthesis, 24, 92 Biotechnology, 25, 62, 73, 92 Bladder, 92, 96, 116, 123 Blastocyst, 19, 92, 96, 99, 113 Blood Glucose, 3, 92, 106 Blood pressure, 11, 23, 92, 93, 104, 109 Blood vessel, 92, 93, 94, 112, 120, 123, 124 Blot, 18, 92 Body Composition, 5, 12, 92 Body Fluids, 92, 93, 98, 123 Bone Marrow, 93, 104, 121 Brain Stem, 93, 94 Breast Feeding, 57, 93, 117 Breeding, 15, 93 Bromocriptine, 29, 39, 46, 49, 93 C Calcification, 23, 93 Calcium, 93, 95, 109, 119 Carbohydrate, 4, 93, 102, 114 Carcinogenic, 93, 105, 120 Carcinoma, 23, 33, 93, 97 Cardiac, 93, 100, 120 Cardiovascular, 7, 22, 93, 119 Cardiovascular disease, 7, 93 Carotid Arteries, 23, 93 Case report, 33, 34, 93, 95 Catecholamine, 94, 98 Caudal, 94, 104, 114 Caudate Nucleus, 14, 94, 110 Causal, 21, 94, 116, 118 Causality, 19, 94

126

Anovulation

Cell, 9, 10, 14, 15, 18, 19, 20, 24, 90, 91, 92, 94, 95, 97, 99, 100, 104, 105, 106, 108, 109, 110, 111, 113, 114, 115, 117, 118, 119, 121, 123, 124 Cell Cycle, 18, 94, 97, 100 Cell Differentiation, 19, 94, 119 Cell Division, 91, 94, 100, 108, 113, 115 Cell proliferation, 14, 19, 94, 119 Cerebellum, 14, 94, 101 Cerebral, 91, 93, 94, 100, 101, 106, 122 Cerebral Cortex, 94, 100, 106 Cerebrovascular, 93, 94 Cervical, 28, 94 Cervix, 94 Cholesterol, 18, 92, 94, 96, 98, 104, 107, 120, 122 Choline, 15, 94 Cholinergic, 15, 94 Chromosome, 9, 94, 107 Chronic renal, 39, 95, 113 Clamp, 8, 95 Clinical study, 95, 96 Clinical trial, 4, 12, 34, 43, 73, 95, 98, 117 Clomiphene, 11, 23, 25, 28, 30, 31, 34, 35, 36, 37, 39, 42, 43, 44, 45, 46, 48, 49, 58, 95 Cloning, 92, 95 Cognitive behavior therapy, 19, 95 Combination Therapy, 11, 95 Complement, 95, 96, 108, 113, 119 Complementary and alternative medicine, 55, 60, 95 Complementary medicine, 55, 96 Compliance, 17, 96 Computational Biology, 73, 96 Conception, 9, 17, 96, 100, 114, 120 Concomitant, 7, 96 Connective Tissue, 93, 96, 101, 108, 121, 122 Connective Tissue Cells, 96, 122 Contraception, 28, 57, 96 Contraceptive, 9, 25, 36, 39, 48, 96, 117 Contraindications, ii, 96 Controlled clinical trial, 12, 96 Coordination, 94, 96 Cornea, 96, 121 Coronary, 23, 93, 96 Coronary heart disease, 93, 96 Corpus, 48, 96, 102, 107, 110, 115, 119, 122 Corpus Luteum, 48, 96, 107, 115 Cortex, 14, 97, 99 Cortical, 13, 97 Cortisol, 45, 49, 97

Cortisone, 97, 114 Coumarin, 97 Coumestrol, 57, 97 Cranial, 94, 97, 103, 112 Curative, 97, 122 Cyclic, 4, 48, 97 Cyclin, 18, 97 Cyclin-Dependent Kinases, 18, 97 Cyproterone, 97, 101 Cyst, 97, 111 Cytokines, 32, 97 D Denaturation, 97, 114 Dendrites, 97, 110 Dentate Gyrus, 97, 103 Deoxyribonucleic, 97, 118 Deoxyribonucleic acid, 97, 118 Diabetes Insipidus, 40, 97 Diabetes Mellitus, 30, 98, 102 Diagnostic procedure, 62, 98 Diastole, 98 Diastolic, 23, 98, 104 Digestion, 90, 92, 98, 107, 120 Direct, iii, 7, 98, 117, 121 Discrete, 22, 98 Dopamine, 25, 29, 32, 93, 98, 110, 112 Double-blind, 36, 98 Drive, ii, vi, 21, 43, 51, 98, 107 Drug Interactions, 66, 98 Duct, 98, 118 Duodenum, 92, 98, 118, 120 Dynorphins, 98, 111 Dyslipidemia, 6, 11, 26, 27, 98 Dysmenorrhea, 17, 98 Dysphoric, 55, 98 E Eating Disorders, 16, 98 Edema, 98, 111 Effector, 89, 95, 98 Efferent, 98, 106 Efficacy, 6, 12, 20, 99 Ejaculation, 99, 119 Elective, 99, 114 Electrolysis, 33, 99 Electrolyte, 99, 114 Embryo, 18, 92, 94, 99, 105, 109, 111, 114, 120 Embryo Transfer, 99, 114 Endocrine System, 99, 110 Endocrinology, 18, 20, 26, 27, 29, 30, 31, 32, 34, 36, 39, 40, 41, 42, 43, 44, 45, 46, 48, 99

127

Endogenous, 5, 23, 92, 98, 99, 111, 116 Endometrial, 22, 23, 33, 99 Endometriosis, 33, 45, 99 Endometrium, 22, 99, 109 Endorphins, 99, 110, 111, 115 End-stage renal, 95, 99, 113 Energy balance, 7, 99, 106 Enkephalin, 92, 99, 115 Entorhinal Cortex, 99, 103 Environmental Exposure, 17, 99 Environmental Health, 17, 35, 72, 74, 100 Enzymatic, 24, 93, 95, 97, 100, 114 Enzyme, 14, 98, 100, 107, 109, 112, 113, 116, 119, 123, 124 Epidemiological, 100, 117 Epimestrol, 48, 100 Epinephrine, 89, 98, 100, 110, 123 Ergot, 93, 100 Erythrocytes, 93, 100, 119 Estradiol, 14, 15, 19, 21, 22, 33, 52, 100 Estrogen, 7, 8, 10, 15, 17, 22, 23, 28, 33, 95, 97, 100, 115, 118, 122 Estrogen receptor, 15, 95, 100 Etoposide, 58, 100 Eukaryotic Cells, 100, 105 Evoke, 5, 100, 120 Excitation, 100, 110 Exogenous, 22, 99, 100, 116, 123 Extrapyramidal, 98, 100 F Family Planning, 73, 100 Fat, 3, 89, 93, 96, 100, 106, 107, 123 Feeding Behavior, 16, 100 Fertilization in Vitro, 100, 114 Fetal Weight, 37, 100 Fetus, 9, 21, 43, 100, 101, 113, 115, 120, 123 Fixation, 101, 119 Flutamide, 21, 101 Foetoplacental, 101, 111 Follicles, 18, 101, 105 Follicular Fluid, 6, 101 Follicular Phase, 8, 17, 22, 31, 101 Forearm, 92, 101 Fossa, 94, 101 Fourth Ventricle, 101, 107, 122 Fractionation, 14, 101 G Gallbladder, 89, 101 Ganglia, 89, 101, 110, 112 Gastrin, 101, 103 Gene, 9, 15, 17, 24, 29, 90, 92, 101, 113 Gene Expression, 24, 101

Generator, 6, 101 Genetic testing, 102, 114 Genotype, 24, 25, 102, 112 Germ Cells, 102, 108, 111, 120, 122 Gestation, 21, 23, 102, 113, 120 Gestational, 27, 61, 102 Gestational Age, 27, 61, 102 Gland, 89, 97, 102, 104, 108, 112, 115, 116, 118, 120, 122 Globus Pallidus, 102, 116 Glucocorticoid, 102, 114 Glucose, 6, 8, 11, 12, 16, 23, 24, 33, 92, 98, 102, 105, 106, 117, 118 Glucose Intolerance, 11, 33, 98, 102 Glucose tolerance, 11, 12, 24, 102 Glucose Tolerance Test, 24, 102 Glutamic Acid, 102, 110 Glycine, 102, 110 Gonad, 102 Gonadal, 4, 20, 102, 120 Gonadotropic, 21, 102 Governing Board, 103, 114 Grafting, 103, 105 Granulosa Cells, 10, 41, 103, 105, 107 H Habituation, 58, 103 Haplotypes, 29, 103 Headache, 103, 115 Heart attack, 93, 103 Hepatic, 102, 103 Hereditary, 103, 113 Heredity, 101, 103 Hippocampus, 14, 97, 103, 121 Hirsutism, 4, 12, 23, 41, 97, 103, 104 Homeostasis, 19, 103 Homologous, 90, 103, 119, 121 Hormonal, 11, 21, 22, 30, 103 Hospital Records, 17, 103 Hybrid, 103 Hybridization, 24, 103 Hydrogen, 92, 93, 97, 104, 109, 110 Hyperandrogenism, 5, 7, 9, 11, 12, 18, 21, 22, 23, 24, 26, 27, 29, 104 Hypercholesterolemia, 98, 104 Hyperlipidemia, 98, 104 Hyperplasia, 13, 18, 104 Hypersecretion, 6, 18, 21, 29, 104 Hypersensitivity, 90, 104, 119 Hyperstimulation, 34, 104 Hypertension, 11, 23, 93, 103, 104 Hypertrichosis, 103, 104 Hypertriglyceridemia, 98, 104

128

Anovulation

Hypertrophy, 13, 104 Hypothalamic, 4, 6, 14, 15, 19, 22, 33, 35, 38, 39, 40, 42, 44, 46, 49, 55, 104 Hypothalamus, 14, 15, 99, 104, 115, 122 I Idiopathic, 41, 104 Immune response, 91, 97, 104, 108, 119, 121 Immunization, 104, 119 Immunologic, 102, 104 Impairment, 18, 46, 104, 109 Implantation, 17, 96, 105, 111 In situ, 15, 18, 24, 105 In Situ Hybridization, 15, 105 In vitro, 7, 8, 10, 18, 99, 105, 114 In vivo, 7, 8, 9, 10, 105 Incision, 105, 106 Induction, 6, 7, 18, 23, 29, 36, 40, 57, 58, 91, 105, 111, 115 Infection, 91, 105, 107, 121, 124 Infertility, 4, 5, 7, 10, 13, 15, 16, 18, 19, 20, 21, 23, 25, 29, 37, 78, 93, 105, 108, 111 Inflammation, 89, 91, 105, 113, 121 Infusion, 10, 22, 105 Ingestion, 102, 105 Inhibin, 17, 22, 31, 105 Initiation, 11, 105 Inorganic, 105, 109 Inositol, 8, 105 Inotropic, 98, 105 Insecticides, 105, 112 Insight, 19, 20, 106 Insomnia, 106, 115 Insulin, 3, 5, 7, 9, 10, 11, 12, 16, 18, 20, 21, 22, 23, 24, 26, 27, 30, 35, 102, 106, 117, 118, 123 Insulin-dependent diabetes mellitus, 35, 106 Insulin-like, 24, 106 Internal Capsule, 14, 106 Internal Medicine, 7, 39, 99, 106 Interstitial, 18, 24, 47, 106 Intestinal, 102, 106 Intestines, 89, 106 Intoxication, 106, 124 Intracellular, 105, 106, 114, 119 Intramuscular, 106, 112 Intravascular, 106, 111 Intravenous, 30, 45, 105, 106, 112 Intrinsic, 90, 106, 117 Invasive, 11, 106 Ionizing, 99, 106

Ions, 92, 99, 104, 106, 114 K Kb, 72, 106 L Lactation, 106, 111, 115 Laparoscopy, 25, 106 Leptin, 5, 16, 106 Lesion, 106, 107 Leucine, 92, 106 Libido, 91, 107 Ligaments, 96, 107 Linkage, 10, 107 Linkage Disequilibrium, 10, 107 Lipid, 14, 94, 106, 107 Lipoprotein, 98, 107 Liver, 3, 14, 16, 89, 92, 101, 102, 103, 107, 114, 117, 118 Localization, 24, 107 Localized, 101, 103, 104, 105, 107, 113 Locus Coeruleus, 14, 107 Loop, 20, 107 Low-density lipoprotein, 98, 107 Luciferase, 24, 107 Lupus, 107, 121 Luteal Phase, 4, 7, 8, 17, 28, 34, 36, 38, 43, 107 Lutein Cells, 107, 115 Lymph, 94, 107, 108 Lymph node, 94, 108 Lymphocytes, 91, 104, 108, 124 M Major Histocompatibility Complex, 103, 108 Malnutrition, 16, 108 Mammary, 108, 122 Mammogram, 93, 108, 109 Manifest, 10, 108 Mediate, 98, 108 Mediator, 8, 108, 119 Medical Records, 103, 108 MEDLINE, 73, 108 Medullary, 13, 108, 116 Meiosis, 108, 121 Melanin, 107, 108, 112, 123 Membrane, 95, 99, 100, 108, 109, 113, 114, 119, 123 Membrane Glycoproteins, 108, 114 Memory, 91, 108 Menarche, 6, 108, 117 Menopause, 22, 34, 108, 111, 112, 114, 115, 117 Menotropins, 47, 108

129

Menstrual Cycle, 4, 7, 32, 58, 59, 101, 107, 108, 111, 115 Menstruation, 9, 17, 90, 98, 101, 107, 108, 109, 111, 117 Mental, iv, 4, 72, 74, 94, 108, 109, 116, 118 Mental Disorders, 109, 116 Mental Health, iv, 4, 72, 74, 109, 116 Mesencephalic, 107, 109 Metabolic disorder, 97, 109 Metabolite, 8, 17, 109 Microcalcifications, 93, 109 Microorganism, 109, 124 Mitotic, 100, 109 Modulator, 5, 23, 109 Molecular, 10, 15, 18, 19, 20, 24, 34, 73, 75, 92, 96, 97, 109, 115 Molecule, 14, 91, 92, 95, 97, 98, 100, 109, 110, 117, 119, 123 Monitor, 24, 109, 110 Morphological, 99, 109 Morphology, 5, 13, 17, 21, 109 Morula, 92, 109 Motility, 17, 109, 119 Mucosa, 107, 109, 115, 121 Mucus, 28, 109 N Naloxone, 92, 109 Nausea, 109, 115 Neoplasia, 30, 110 Neostriatum, 94, 110, 116 Nerve Growth Factor, 57, 110 Nervous System, 89, 98, 101, 102, 103, 108, 110, 112, 119, 121 Neural, 14, 15, 89, 110 Neuroendocrine, 19, 26, 39, 110 Neuromuscular, 89, 110 Neuromuscular Junction, 89, 110 Neuronal, 7, 110 Neurons, 9, 14, 97, 101, 110, 121 Neuropeptide, 14, 110 Neurotransmitter, 15, 89, 98, 102, 110, 119, 121 Nitrogen, 90, 91, 101, 110 Norepinephrine, 14, 89, 98, 110 Nuclear, 91, 100, 106, 110 Nucleic acid, 103, 105, 110, 118 Nucleic Acid Hybridization, 103, 110 Nucleus, 97, 100, 102, 107, 108, 111, 115, 116, 120 O Occupational Exposure, 9, 111 Oestrogen, 39, 44, 111

Oligomenorrhea, 17, 43, 111, 113 Oocytes, 19, 111 Opiate, 92, 99, 109, 111 Opioid Peptides, 5, 98, 99, 111 Optic Chiasm, 104, 111 Osteoporosis, 111 Ovarian Follicle, 96, 101, 103, 111, 122 Ovarian Hyperstimulation Syndrome, 10, 23, 111 Ovaries, 9, 10, 21, 24, 41, 57, 104, 111, 113, 119 Ovary, 6, 7, 10, 11, 13, 18, 21, 22, 24, 27, 35, 41, 47, 91, 96, 100, 102, 111, 121 Ovulation, 6, 8, 10, 11, 15, 19, 21, 23, 25, 27, 29, 34, 36, 39, 40, 46, 52, 56, 57, 58, 91, 95, 101, 103, 107, 111 Ovulation Induction, 10, 11, 23, 25, 39, 111 Ovum, 96, 101, 102, 109, 111, 115, 124 P Palliative, 97, 111, 112, 122 Pancreas, 89, 92, 106, 112, 118, 123 Pancreatic, 8, 9, 112 Parenteral, 23, 112 Parturition, 112, 115 Pathologic, 92, 96, 104, 112 Pathophysiology, 40, 42, 112 Pelvic, 99, 112, 116 Pelvis, 89, 111, 112, 123 Pepsin, 112, 118 Peptide, 14, 92, 106, 111, 112, 114, 115, 116 Perfusion, 112, 122 Pericardium, 112, 121 Perimenopausal, 14, 22, 112 Peripheral Nervous System, 110, 112, 121 Peritoneal, 32, 91, 112 Peritoneum, 112 Pesticides, 17, 105, 112 Pharmacologic, 12, 16, 19, 21, 112, 122, 123 Phenotype, 9, 11, 14, 15, 24, 112 Phenylalanine, 112, 123 Phospholipids, 100, 105, 107, 113 Phosphorylation, 97, 113 Physical Examination, 102, 113 Physiologic, 6, 8, 15, 16, 22, 90, 92, 108, 109, 113, 117 Physiology, 15, 20, 89, 99, 113 Placenta, 100, 101, 113, 115 Plants, 90, 93, 94, 102, 109, 110, 113, 118, 123 Plasma, 7, 8, 9, 26, 39, 41, 101, 102, 113, 119, 122 Plasma protein, 101, 113

130

Anovulation

Plasmids, 24, 113 Plasticity, 15, 113 Pneumonia, 96, 113 Podophyllotoxin, 100, 113 Polycystic Ovary Syndrome, 3, 10, 11, 12, 23, 25, 33, 35, 39, 41, 43, 45, 46, 49, 56, 57, 104, 113 Polymerase, 14, 24, 113, 114 Polymerase Chain Reaction, 14, 24, 114 Polypeptide, 90, 103, 114, 115 Polysaccharide, 91, 114 Posterior, 94, 106, 112, 114 Postmenopausal, 30, 111, 114 Postnatal, 22, 114 Potassium, 9, 114 Potassium Channels, 9, 114 Practice Guidelines, 74, 114 Precipitating Factors, 94, 114 Precursor, 91, 94, 98, 99, 100, 110, 112, 114, 115, 123 Prednisolone, 114 Prednisone, 34, 114 Pregnancy Outcome, 8, 17, 19, 114 Pregnancy Tests, 102, 115 Premenopausal, 9, 13, 33, 115 Premenstrual Syndrome, 44, 55, 115 Prenatal, 5, 10, 21, 99, 100, 115 Presynaptic, 110, 115 Prevalence, 23, 24, 33, 41, 115 Probe, 15, 115 Progesterone, 6, 7, 14, 19, 22, 24, 31, 35, 36, 46, 115, 120 Prognostic factor, 48, 115 Progression, 17, 18, 23, 91, 97, 115 Progressive, 10, 42, 94, 95, 115 Projection, 110, 115 Prolactin, 29, 32, 39, 46, 93, 115 Prone, 20, 115 Pro-Opiomelanocortin, 99, 111, 115 Prophase, 111, 115, 121 Prospective Studies, 7, 115 Prospective study, 17, 25, 115 Prostate, 92, 111, 116, 123 Protease, 95, 116 Protein Binding, 116, 122 Protein S, 92, 116 Proteins, 24, 90, 91, 92, 95, 97, 103, 109, 110, 112, 113, 116, 118, 119, 123 Proximate cause, 19, 21, 116 Psychiatry, 20, 101, 116 Psychic, 107, 109, 116 Psychoactive, 116, 124

Psychogenic, 4, 19, 40, 116 Psychotherapy, 95, 116 Puberty, 4, 7, 12, 15, 16, 116 Public Health, 12, 17, 74, 116 Public Policy, 73, 116 Pulmonary, 92, 116, 124 Pulmonary Artery, 92, 116, 124 Pulse, 6, 15, 20, 21, 109, 116 Putamen, 14, 110, 116 R Race, 23, 116 Radiation, 99, 101, 106, 117 Radiation therapy, 101, 117 Radioactive, 104, 105, 110, 117 Radiography, 102, 117 Radiopharmaceutical, 101, 117 Randomized, 12, 23, 25, 34, 43, 49, 99, 117 Randomized clinical trial, 25, 117 Reagent, 107, 117 Receptor, 9, 14, 18, 19, 21, 23, 25, 28, 29, 89, 91, 98, 117, 119 Receptor, Insulin, 19, 117 Recombinant, 31, 34, 43, 46, 49, 67, 117 Refer, 1, 95, 99, 101, 107, 117, 119 Refractory, 30, 48, 117 Regimen, 25, 99, 117 Reproductive History, 9, 117 Respiration, 109, 117 Retrospective, 17, 118 Retrospective Studies, 17, 118 Ribonucleic acid, 19, 118 Risk factor, 22, 94, 115, 118 Rod, 95, 118 Rodenticides, 112, 118 Rosiglitazone, 23, 118 S Saliva, 118 Salivary, 31, 118 Saponins, 118, 120 Schizoid, 118, 124 Schizophrenia, 118, 124 Schizotypal Personality Disorder, 118, 124 Screening, 95, 118 Secretin, 22, 118 Secretion, 6, 8, 9, 10, 14, 16, 19, 20, 21, 22, 23, 32, 36, 42, 57, 93, 104, 105, 106, 109, 118, 119 Secretory, 4, 19, 118 Selective estrogen receptor modulator, 118, 122 Semen, 17, 99, 116, 119 Seminiferous tubule, 105, 119, 120

131

Semisynthetic, 93, 100, 119 Sensitization, 11, 27, 119 Septal, 119 Septum, 31, 119 Septum Pellucidum, 119 Sequencing, 114, 119 Serotonin, 110, 119 Serum, 11, 24, 31, 45, 95, 103, 107, 119 Sex Characteristics, 89, 91, 111, 116, 119, 122 Side effect, 65, 67, 89, 119, 122 Signal Transduction, 105, 119 Signs and Symptoms, 12, 119 Skeletal, 9, 91, 95, 120 Skeleton, 120 Small intestine, 98, 103, 106, 120 Somatic, 89, 108, 112, 120 Specialist, 79, 120 Species, 21, 100, 101, 103, 108, 113, 116, 120, 121, 123, 124 Specificity, 90, 120, 122 Sperm, 20, 28, 91, 94, 119, 120 Spermatozoa, 119, 120 Spinal cord, 93, 94, 110, 112, 120 Spontaneous Abortion, 8, 17, 114, 120 Steel, 95, 120 Sterility, 25, 28, 29, 31, 32, 33, 34, 35, 36, 37, 38, 39, 41, 42, 43, 44, 47, 48, 49, 105, 120 Steroid, 6, 26, 43, 44, 91, 97, 100, 101, 111, 118, 120 Stillbirth, 114, 120 Stimulus, 98, 100, 120, 122 Stomach, 89, 101, 102, 103, 106, 109, 112, 118, 120 Strand, 113, 120 Stress, 4, 7, 16, 19, 45, 94, 97, 109, 120 Stroke, 72, 93, 120 Stroma, 13, 121 Stromal, 13, 24, 99, 121 Stromal Cells, 14, 121 Subclinical, 9, 17, 23, 27, 59, 105, 121 Subcutaneous, 89, 98, 112, 121 Subiculum, 103, 121 Subspecies, 120, 121 Substance P, 109, 118, 121 Supplementation, 58, 121 Suppression, 6, 7, 8, 15, 16, 25, 43, 48, 121 Suppressive, 56, 121 Sympathomimetic, 98, 100, 110, 121 Synapse, 89, 110, 115, 121, 123 Synapsis, 121

Synaptic, 15, 110, 119, 121 Synergistic, 10, 115, 121 Systemic, 33, 92, 100, 105, 114, 117, 121 Systemic lupus erythematosus, 33, 121 Systolic, 23, 104, 121 Systolic blood pressure, 23, 121 T Tamoxifen, 31, 44, 118, 122 Temporal, 103, 122 Testicular, 20, 122 Testis, 91, 100, 111, 122 Testosterone, 9, 17, 24, 45, 91, 122 Theca Cells, 14, 107, 122 Therapeutics, 56, 58, 66, 122 Thermal, 114, 122 Third Ventricle, 104, 122 Threshold, 104, 122 Thyroid, 122, 123 Tissue Distribution, 14, 122 Tolerance, 102, 122 Tone, 122 Tonic, 4, 122 Toxic, iv, 99, 113, 122, 123 Toxicity, 98, 122 Toxicology, 74, 122 Toxins, 8, 91, 105, 123 Traction, 95, 123 Transcriptase, 24, 123 Transfection, 92, 123 Translational, 10, 14, 123 Transmitter, 14, 89, 98, 108, 110, 123 Transplantation, 95, 99, 104, 108, 123 Troglitazone, 5, 21, 123 Tumor marker, 92, 123 Type 2 diabetes, 3, 8, 13, 23, 123 Tyrosine, 14, 98, 117, 123 U Ultrasonography, 100, 102, 123 Urethra, 116, 123 Urinary, 9, 17, 26, 35, 43, 49, 123 Urine, 9, 17, 92, 97, 108, 123 Uterus, 94, 96, 99, 109, 111, 115, 123 V Vagina, 94, 109, 123 Vaginal, 31, 123 Vascular, 23, 105, 111, 113, 123 Vasodilator, 98, 124 Vein, 106, 110, 124 Ventricle, 94, 103, 116, 121, 124 Vesicular, 101, 103, 124 Veterinary Medicine, 52, 73, 124 Virilism, 104, 124

132

Anovulation

Vitamin A, 105, 124 Vitro, 10, 124 Vivo, 124 W White blood cell, 91, 108, 109, 124 Withdrawal, 6, 124

X Xenograft, 91, 124 Y Yeasts, 112, 124 Z Zygote, 96, 124